NCBI Summary
This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. This gene is expressed specifically in the brain, with highest expression in the cerebellum. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_068580)
CBM13-ppGalNAc-T9
Polypeptide N-acetylgalactosaminyltransferase 9 (EC 2.4.1.41) (Polypeptide GalNAc transferase 9) (GalNAc-T9) (pp-GaNTase 9) (Protein-UDP acetylgalactosaminyltransferase 9) (UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 9)
GALNT9
polypeptide N-acetylgalactosaminyltransferase 9
Undefined
Curated
Ricin-like
R-Type Lectins
b-trefoil
GalNAc / Mucin-type glycopeptide
Undefined
Undefined
Protein sequence and protein families (fasta) (237 amino acids) Download
MEVLPCSRVAHIERTRKPYNNDIDYYAKRNALRAAEVWMDDFKSHVYMAWNIPMSNPGVDFGDVSERLALRQRLKCRSFKWYLENVYPEMRVYNNTLTYGEVRNSKASAYCLDQGAEDGDRAILYPCHGMSSQLVRYSADGLLQLGPLGSTAFLPDSKCLVDDGTGRMPTLKKCEDVARPTQRLWDFTQSGPIVSRATGRCLEVEMSKDANFGLRLVVQRCSGQKWMIRNWIKHARH
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [ err > 2 Å]Download
The location of the lectin domain structural model is: 157-209
We infer [ err > 2 Å] as the interval of error of this structural model.
Template: 1XHB chain: A, O08912, NP_001153876.1, sequence identity: 18.9%, coverage: 96.2%, location in sequence: 95-553, (95-553 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (4 PubMed Identifiers)
  • GALNT9 gene expression is a prognostic marker in neuroblastoma patients. [23136245]
  • Identification of intrahepatic cholangiocarcinoma related genes by comparison with normal liver tissues using expressed sequence tags. [16712791]
  • Cloning and characterization of a new human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase, designated pp-GalNAc-T13, that is specifically expressed in neurons and synthesizes GalNAc alpha-serine/threonine antigen. [12407114]
  • Brain-specific expression of a novel human UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T9). [10978536]
UniProt Main References (1 PubMed Identifiers)
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
All isoforms of this gene containing a lectin domain
NP_068580.2, NP_001116108.1
RNA
RNA (Transcript ID: NM_021808.3)
polypeptide N-acetylgalactosaminyltransferase 9, transcript variant B
m7G-5')ppp(5'-GGCGCUUCUGAAGACGGGUGGGCAGACGAUGGAGGACGAGGCUCUGUCCCGCCCCUGCAGAGCUUCCUUCGUUCCGGCCCCUUCCAGCGAAGGGCAGGGCUCCGAGCAGAGACAACAGACAGAAACCCAGAAACCACCUGCCACGAUGUGAACCUGAUGCAGAAACGCGGUUCGCUCCCUCGGGAUGCAAAGGCCAACUUCAGCCUGGCACGGCGGCGCCGCGGACUCCACCAUCCCGGGGAAGGAGCCGGACCCCUGUGUGGCAGUGUGGCGGCAGCAUGGAGGUGCUGCCCUGCUCCCGCGUGGCCCACAUCGAGCGCACCAGGAAGCCCUACAACAACGACAUUGACUACUAUGCCAAGCGCAACGCCCUGCGCGCCGCCGAGGUGUGGAUGGAUGACUUCAAGUCCCACGUGUACAUGGCCUGGAACAUCCCCAUGUCGAACCCAGGGGUGGACUUCGGGGACGUGUCUGAGAGGCUGGCCCUGCGUCAGAGGCUGAAGUGUCGCAGCUUCAAGUGGUACCUGGAGAACGUGUACCCGGAGAUGAGGGUCUACAACAACACCCUCACGUACGGAGAGGUGAGAAACAGCAAAGCCAGUGCCUACUGUCUGGACCAGGGAGCGGAGGACGGCGACCGGGCGAUCCUCUACCCCUGCCACGGGAUGUCCUCCCAGCUGGUGCGGUACAGCGCUGAUGGACUGCUGCAGCUGGGGCCUCUGGGCUCCACAGCCUUCUUGCCUGACUCCAAGUGUCUGGUGGAUGACGGCACGGGCCGCAUGCCCACCCUGAAGAAGUGUGAGGAUGUGGCGCGGCCAACACAGCGGCUGUGGGACUUCACCCAGAGUGGCCCCAUUGUGAGCCGGGCCACGGGCCGCUGCCUGGAGGUGGAGAUGUCCAAAGAUGCCAACUUUGGGCUCCGGCUGGUGGUACAGAGGUGCUCGGGGCAGAAGUGGAUGAUCAGAAACUGGAUCAAACACGCACGGCACUGACCCCACCUCCGCCCGGACCCCCACAGACCUCGGGAAGGCGCUGGGCCGAGCCAGUGUGGCUGAGUGACCGGGGUGUGCCCGGCAGACACAGCAGGACAGGGCUCUAUGUGCGGCCAGGACAGCAGAGGCUGAGGGGCCGGGGUGUGGCUGAGUGACCAGGGUGUCACCCACUGCAUCUGGAGUACAGCUUCUCCUAGGACAGGCGGCUCUACCCGAGGGAGGGCGUCUGGGGACAGUGAUGCCAACUCAAACACGUGCCUUCUCCACGGUAUCUCCUGGCCAGGCUGCUGGGACAGCCGCCGCCUCUGCAUGUACCACAGCCCCCCACGCCCCAUAGGGAGGCCAAGCCCCGGACCAUGCACCAGGCUGCACCCUGGUGUCUUCCACCCGCAGGCCUCCCAUGCUCCAAGCAGCCUCCCCCAGCACUUGCGGCCGCUCAGCCCUCCAACCAAGACCUAAGUCACACAUCAUAAUGCAGCUCCUUGUGGUCUGGUAAGAGGGGUGCUGGAGGACAUGGACAGCGACAAACCUGAGGCCGUGUCUAGGAGGCUGGCACGACUGCUUCAGCAGAGACCAAAUAAAGAGAGGAUUAGGCAGCAGCACUGUGUGUGUCUUCCUGGGAGCCGAGCUGGGGGUUGGGGCCCGGUCCCACCUCUUUCCCAGGCACCUGGGCCCUGCCGCAGCCCAGCCCCUUGCCUGUUUUAAUAAAUACAGUUUUAUUGGCGCCCAGCCACA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 50614)
polypeptide N-acetylgalactosaminyltransferase 9
strand -
GALNAC-T9
NCBI CDS gene sequence (714 bp)
5'-ATGGAGGTGCTGCCCTGCTCCCGCGTGGCCCACATCGAGCGCACCAGGAAGCCCTACAACAACGACATTGACTACTATGCCAAGCGCAACGCCCTGCGCGCCGCCGAGGTGTGGATGGATGACTTCAAGTCCCACGTGTACATGGCCTGGAACATCCCCATGTCGAACCCAGGGGTGGACTTCGGGGACGTGTCTGAGAGGCTGGCCCTGCGTCAGAGGCTGAAGTGTCGCAGCTTCAAGTGGTACCTGGAGAACGTGTACCCGGAGATGAGGGTCTACAACAACACCCTCACGTACGGAGAGGTGAGAAACAGCAAAGCCAGTGCCTACTGTCTGGACCAGGGAGCGGAGGACGGCGACCGGGCGATCCTCTACCCCTGCCACGGGATGTCCTCCCAGCTGGTGCGGTACAGCGCTGATGGACTGCTGCAGCTGGGGCCTCTGGGCTCCACAGCCTTCTTGCCTGACTCCAAGTGTCTGGTGGATGACGGCACGGGCCGCATGCCCACCCTGAAGAAGTGTGAGGATGTGGCGCGGCCAACACAGCGGCTGTGGGACTTCACCCAGAGTGGCCCCATTGTGAGCCGGGCCACGGGCCGCTGCCTGGAGGTGGAGATGTCCAAAGATGCCAACTTTGGGCTCCGGCTGGTGGTACAGAGGTGCTCGGGGCAGAAGTGGATGATCAGAAACTGGATCAAACACGCACGGCACTGA-3'
NCBI CDS gene sequence with introns (location: 132197107.. 132203669) (6563 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 132196372.. 132206028) (9657 bp)Download
NCBI gene sequence (location: [132196372.. 132206028 + 1000]) (10657 bp)Download
Cite How to cite