NCBI Summary
This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in inflammatory and immune response. Multiple transcript variants encoding distinct isoforms have been identified for this gene. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_057268)
DCIR Dendritic cell immunoreceptor
C-type lectin domain family 4 member A (C-type lectin DDB27) (C-type lectin superfamily member 6) (Dendritic cell immunoreceptor) (Lectin-like immunoreceptor) (CD antigen CD367)
CLEC4A
C-type lectin domain family 4 member A
Curated
C-type lectin
CLEC4A(2)
C-type - Type II transmembrane receptors
a/b mixed / C-type lectin-like
0.428
Protein sequence and protein families (fasta) (237 amino acids) Download
MTSEITYAEVRFKNEFKSSGINTASSAASKERTAPHKSNTGFPKLLCASLLIFFLLLAISFFIAFVIFFQKYSQLLEKKTTKELVHTTLECVKKNMPVEETAWSCCPKNWKSFSSNCYFISTESASWQDSEKDCARMEAHLLVINTQEEQDFIFQNLQEESAYFVGLSDPEGQRHWQWVDQTPYNESSTFWHPREPSDPNERCVVLNFRKSPKRWGWNDVNCLGPQRSVCEMMKIHL
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.

Ligand
Glycan ligands from structural data
bGlcNAc12Man
GlcNAc(b1-2)Man
References
NCBI References (10 PubMed Identifiers)
  • Pivotal role of the carbohydrate recognition domain in self-interaction of CLEC4A to elicit the ITIM-mediated inhibitory function in murine conventional dendritic cells in vitro. [32415968]
  • The cartilage-specific lectin C-type lectin domain family 3 member A (CLEC3A) enhances tissue plasminogen activator-mediated plasminogen activation. [29146595]
  • Crystal structure of human dendritic cell inhibitory receptor C-type lectin domain reveals the binding mode with N-glycan. [27015765]
  • Contribution of dendritic cell immunoreceptor (DCIR) polymorphisms in susceptibility of systemic lupus erythematosus and primary Sjogren's syndrome. [26429306]
  • DCIR interacts with ligands from both endogenous and pathogenic origin. [24239607]
  • Evolutionary analysis reveals collective properties and specificity in the C-type lectin and lectin-like domain superfamily. [12945048]
  • The expression pattern of the ITIM-bearing lectin CLECSF6 in neutrophils suggests a key role in the control of inflammation. [11994513]
  • Cloning and characterization of a novel ITIM containing lectin-like immunoreceptor LLIR and its two transmembrane region deletion variants. [11178971]
  • C-type lectin-like domains. [10508765]
  • APCs express DCIR, a novel C-type lectin surface receptor containing an immunoreceptor tyrosine-based inhibitory motif. [10438934]
UniProt Main References (5 PubMed Identifiers)
  • The finished DNA sequence of human chromosome 12. [16541075]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Targeting DCIR on human plasmacytoid dendritic cells results in antigen presentation and inhibits IFN-alpha production. [18258799]
  • Cross-priming CD8+ T cells by targeting antigens to human dendritic cells through DCIR. [20530286]
  • DCIR-mediated enhancement of HIV-1 infection requires the ITIM-associated signal transduction pathway. [21536857]
All isoforms of this gene containing a lectin domain
NP_919430.1, NP_919429.2, XP_011518986.1, NP_057268.1, XP_016874871.1, XP_024304765.1, NP_919432.1
RNA
RNA (Transcript ID: NM_016184.4)
C-type lectin domain family 4 member A, transcript variant 1
m7G-5')ppp(5'-GCAUUUGUUUCAAGGCUGUGAUUCUCACUAUACUGGUCCUGAGGAAAGGGCUUCUGUGAACUGCGGUUUUUAGUUUUUAUUGUGGUUCUUAGUUCUCAUGAGACCCCUCUUGAGGAUAUGUGCCUAUCUGGUGCCUCUGCUCUCCACUAGUUGAGUGAAAGGAAGGAGGUAAUUUACCACCAUGUUUGGUUCCUGUUUAUAAGAUGUUUUAAGAAAGAUCUGAAACAGAUUUUCUGAAGAAAGCAGAAGCUCUCUUCCCAUUAUGACUUCGGAAAUCACUUAUGCUGAAGUGAGGUUCAAAAAUGAAUUCAAGUCCUCAGGCAUCAACACAGCCUCUUCUGCAGCUUCCAAGGAGAGGACUGCCCCUCACAAAAGUAAUACCGGAUUCCCCAAGCUGCUUUGUGCCUCACUGUUGAUAUUUUUCCUGCUAUUGGCAAUCUCAUUCUUUAUUGCUUUUGUCAUUUUCUUUCAAAAAUAUUCUCAGCUUCUUGAAAAAAAGACUACAAAAGAGCUGGUUCAUACAACAUUGGAGUGUGUGAAAAAAAAUAUGCCCGUGGAAGAGACAGCCUGGAGCUGUUGCCCAAAGAAUUGGAAGUCAUUUAGUUCCAACUGCUACUUUAUUUCUACUGAAUCAGCAUCUUGGCAAGACAGUGAGAAGGACUGUGCUAGAAUGGAGGCUCACCUGCUGGUGAUAAACACUCAAGAAGAGCAGGAUUUCAUCUUCCAGAAUCUGCAAGAAGAAUCUGCUUAUUUUGUGGGGCUCUCAGAUCCAGAAGGUCAGCGACAUUGGCAAUGGGUUGAUCAGACACCAUACAAUGAAAGUUCCACAUUCUGGCAUCCACGUGAGCCCAGUGAUCCCAAUGAGCGCUGCGUUGUGCUAAAUUUUCGUAAAUCACCCAAAAGAUGGGGCUGGAAUGAUGUUAAUUGUCUUGGUCCUCAAAGGUCAGUUUGUGAGAUGAUGAAGAUCCACUUAUGAACUGAACAUUCUCCAUGAACAGGUGGUUGGAUUGGUAUCUGUCAUUGUAGGGAUAGAUAAUAAGCUCUUCUUAUUCAUGUGUAAGGGAGGUCCAUAGAAUUUAGGUGGUCUGUCAACUAUUCUACUUAUGAGAGAAUUGGUCUGUACAUUGACUGAUUCACUUUUUCAUAAAGUGAGCAUUUAUUGAGCAUUUUUUCAUGUGCCAGAGCCUGUACUGGAGGCCCCCAUUGUGCACACAUGGAGAGAACAUGAGUCUCUCUUAAUUUUUAUCUGGUUGCUAAAGAAUUAUUUACCAAUAAAAUUAUAUGAUGUGGUGUCUC-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 50856)
C-type lectin domain family 4 member A
strand +
DCIR, DDB27, CD367, hDCIR
NCBI CDS gene sequence (714 bp)
5'-ATGACTTCGGAAATCACTTATGCTGAAGTGAGGTTCAAAAATGAATTCAAGTCCTCAGGCATCAACACAGCCTCTTCTGCAGCTTCCAAGGAGAGGACTGCCCCTCACAAAAGTAATACCGGATTCCCCAAGCTGCTTTGTGCCTCACTGTTGATATTTTTCCTGCTATTGGCAATCTCATTCTTTATTGCTTTTGTCATTTTCTTTCAAAAATATTCTCAGCTTCTTGAAAAAAAGACTACAAAAGAGCTGGTTCATACAACATTGGAGTGTGTGAAAAAAAATATGCCCGTGGAAGAGACAGCCTGGAGCTGTTGCCCAAAGAATTGGAAGTCATTTAGTTCCAACTGCTACTTTATTTCTACTGAATCAGCATCTTGGCAAGACAGTGAGAAGGACTGTGCTAGAATGGAGGCTCACCTGCTGGTGATAAACACTCAAGAAGAGCAGGATTTCATCTTCCAGAATCTGCAAGAAGAATCTGCTTATTTTGTGGGGCTCTCAGATCCAGAAGGTCAGCGACATTGGCAATGGGTTGATCAGACACCATACAATGAAAGTTCCACATTCTGGCATCCACGTGAGCCCAGTGATCCCAATGAGCGCTGCGTTGTGCTAAATTTTCGTAAATCACCCAAAAGATGGGGCTGGAATGATGTTAATTGTCTTGGTCCTCAAAGGTCAGTTTGTGAGATGATGAAGATCCACTTATGA-3'
NCBI CDS gene sequence with introns (location: 8123879.. 8138287) (14409 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 8123617.. 8138607) (14991 bp)Download
NCBI gene sequence (location: [8123617 - 1000].. 8138607) (15991 bp)Download
Cite How to cite