NCBI Summary
This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in inflammatory and immune response. Multiple transcript variants encoding distinct isoforms have been identified for this gene. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_057268)
DCIR Dendritic cell immunoreceptor
C-type lectin domain family 4 member A (C-type lectin DDB27) (C-type lectin superfamily member 6) (Dendritic cell immunoreceptor) (Lectin-like immunoreceptor) (CD antigen CD367)
CLEC4A
C-type lectin domain family 4 member A
Curated
C-type lectin
CLEC4A(2)
C-type - Type II transmembrane receptors
a/b mixed / C-type lectin-like
0.428
Protein sequence and protein families (fasta) (237 amino acids) Download
MTSEITYAEVRFKNEFKSSGINTASSAASKERTAPHKSNTGFPKLLCASLLIFFLLLAISFFIAFVIFFQKYSQLLEKKTTKELVHTTLECVKKNMPVEETAWSCCPKNWKSFSSNCYFISTESASWQDSEKDCARMEAHLLVINTQEEQDFIFQNLQEESAYFVGLSDPEGQRHWQWVDQTPYNESSTFWHPREPSDPNERCVVLNFRKSPKRWGWNDVNCLGPQRSVCEMMKIHL
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
bGlcNAc12Man
GlcNAc(b1-2)Man
References
NCBI References (10 PubMed Identifiers)
  • Pivotal role of the carbohydrate recognition domain in self-interaction of CLEC4A to elicit the ITIM-mediated inhibitory function in murine conventional dendritic cells in vitro. [32415968]
  • The cartilage-specific lectin C-type lectin domain family 3 member A (CLEC3A) enhances tissue plasminogen activator-mediated plasminogen activation. [29146595]
  • Crystal structure of human dendritic cell inhibitory receptor C-type lectin domain reveals the binding mode with N-glycan. [27015765]
  • Contribution of dendritic cell immunoreceptor (DCIR) polymorphisms in susceptibility of systemic lupus erythematosus and primary Sjogren's syndrome. [26429306]
  • DCIR interacts with ligands from both endogenous and pathogenic origin. [24239607]
  • Evolutionary analysis reveals collective properties and specificity in the C-type lectin and lectin-like domain superfamily. [12945048]
  • The expression pattern of the ITIM-bearing lectin CLECSF6 in neutrophils suggests a key role in the control of inflammation. [11994513]
  • Cloning and characterization of a novel ITIM containing lectin-like immunoreceptor LLIR and its two transmembrane region deletion variants. [11178971]
  • C-type lectin-like domains. [10508765]
  • APCs express DCIR, a novel C-type lectin surface receptor containing an immunoreceptor tyrosine-based inhibitory motif. [10438934]
UniProt Main References (5 PubMed Identifiers)
  • The finished DNA sequence of human chromosome 12. [16541075]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Targeting DCIR on human plasmacytoid dendritic cells results in antigen presentation and inhibits IFN-alpha production. [18258799]
  • Cross-priming CD8+ T cells by targeting antigens to human dendritic cells through DCIR. [20530286]
  • DCIR-mediated enhancement of HIV-1 infection requires the ITIM-associated signal transduction pathway. [21536857]
All isoforms of this gene containing a lectin domain
NP_919430.1, NP_919429.2, XP_011518986.1, NP_057268.1, XP_016874871.1, XP_024304765.1, NP_919432.1
RNA
RNA (Transcript ID: NM_016184.4)
C-type lectin domain family 4 member A, transcript variant 1
m7G-5')ppp(5'-GCAUUUGUUUCAAGGCUGUGAUUCUCACUAUACUGGUCCUGAGGAAAGGGCUUCUGUGAACUGCGGUUUUUAGUUUUUAUUGUGGUUCUUAGUUCUCAUGAGACCCCUCUUGAGGAUAUGUGCCUAUCUGGUGCCUCUGCUCUCCACUAGUUGAGUGAAAGGAAGGAGGUAAUUUACCACCAUGUUUGGUUCCUGUUUAUAAGAUGUUUUAAGAAAGAUCUGAAACAGAUUUUCUGAAGAAAGCAGAAGCUCUCUUCCCAUUAUGACUUCGGAAAUCACUUAUGCUGAAGUGAGGUUCAAAAAUGAAUUCAAGUCCUCAGGCAUCAACACAGCCUCUUCUGCAGCUUCCAAGGAGAGGACUGCCCCUCACAAAAGUAAUACCGGAUUCCCCAAGCUGCUUUGUGCCUCACUGUUGAUAUUUUUCCUGCUAUUGGCAAUCUCAUUCUUUAUUGCUUUUGUCAUUUUCUUUCAAAAAUAUUCUCAGCUUCUUGAAAAAAAGACUACAAAAGAGCUGGUUCAUACAACAUUGGAGUGUGUGAAAAAAAAUAUGCCCGUGGAAGAGACAGCCUGGAGCUGUUGCCCAAAGAAUUGGAAGUCAUUUAGUUCCAACUGCUACUUUAUUUCUACUGAAUCAGCAUCUUGGCAAGACAGUGAGAAGGACUGUGCUAGAAUGGAGGCUCACCUGCUGGUGAUAAACACUCAAGAAGAGCAGGAUUUCAUCUUCCAGAAUCUGCAAGAAGAAUCUGCUUAUUUUGUGGGGCUCUCAGAUCCAGAAGGUCAGCGACAUUGGCAAUGGGUUGAUCAGACACCAUACAAUGAAAGUUCCACAUUCUGGCAUCCACGUGAGCCCAGUGAUCCCAAUGAGCGCUGCGUUGUGCUAAAUUUUCGUAAAUCACCCAAAAGAUGGGGCUGGAAUGAUGUUAAUUGUCUUGGUCCUCAAAGGUCAGUUUGUGAGAUGAUGAAGAUCCACUUAUGAACUGAACAUUCUCCAUGAACAGGUGGUUGGAUUGGUAUCUGUCAUUGUAGGGAUAGAUAAUAAGCUCUUCUUAUUCAUGUGUAAGGGAGGUCCAUAGAAUUUAGGUGGUCUGUCAACUAUUCUACUUAUGAGAGAAUUGGUCUGUACAUUGACUGAUUCACUUUUUCAUAAAGUGAGCAUUUAUUGAGCAUUUUUUCAUGUGCCAGAGCCUGUACUGGAGGCCCCCAUUGUGCACACAUGGAGAGAACAUGAGUCUCUCUUAAUUUUUAUCUGGUUGCUAAAGAAUUAUUUACCAAUAAAAUUAUAUGAUGUGGUGUCUC-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 50856)
C-type lectin domain family 4 member A
strand +
DCIR, DDB27, CD367, hDCIR
NCBI CDS gene sequence (714 bp)
5'-ATGACTTCGGAAATCACTTATGCTGAAGTGAGGTTCAAAAATGAATTCAAGTCCTCAGGCATCAACACAGCCTCTTCTGCAGCTTCCAAGGAGAGGACTGCCCCTCACAAAAGTAATACCGGATTCCCCAAGCTGCTTTGTGCCTCACTGTTGATATTTTTCCTGCTATTGGCAATCTCATTCTTTATTGCTTTTGTCATTTTCTTTCAAAAATATTCTCAGCTTCTTGAAAAAAAGACTACAAAAGAGCTGGTTCATACAACATTGGAGTGTGTGAAAAAAAATATGCCCGTGGAAGAGACAGCCTGGAGCTGTTGCCCAAAGAATTGGAAGTCATTTAGTTCCAACTGCTACTTTATTTCTACTGAATCAGCATCTTGGCAAGACAGTGAGAAGGACTGTGCTAGAATGGAGGCTCACCTGCTGGTGATAAACACTCAAGAAGAGCAGGATTTCATCTTCCAGAATCTGCAAGAAGAATCTGCTTATTTTGTGGGGCTCTCAGATCCAGAAGGTCAGCGACATTGGCAATGGGTTGATCAGACACCATACAATGAAAGTTCCACATTCTGGCATCCACGTGAGCCCAGTGATCCCAATGAGCGCTGCGTTGTGCTAAATTTTCGTAAATCACCCAAAAGATGGGGCTGGAATGATGTTAATTGTCTTGGTCCTCAAAGGTCAGTTTGTGAGATGATGAAGATCCACTTATGA-3'
NCBI CDS gene sequence with introns (location: 8123879.. 8138287) (14409 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 8123617.. 8138607) (14991 bp)Download
NCBI gene sequence (location: [8123617 - 1000].. 8138607) (15991 bp)Download
How to cite: Schnider B., M'Rad Y., el Ahmadie J., de Brevern AG., Imberty A., Lisacek F., HumanLectome, an update of UniLectin for the annotation and prediction of human lectins, Nucleic Acids Reasearch doi.org/10.1093/nar/gkad905