NCBI Summary
Sialic acid-binding immunoglobulin (Ig)-like lectins, or SIGLECs (e.g., CD33 (MIM 159590)), are a family of type 1 transmembrane proteins each having a unique expression pattern, mostly in hemopoietic cells. SIGLEC8 is a member of the CD33-like subgroup of SIGLECs, which are localized to 19q13.3-q13.4 and have 2 conserved cytoplasmic tyrosine-based motifs: an immunoreceptor tyrosine-based inhibitory motif, or ITIM (see MIM 604964), and a motif homologous to one identified in signaling lymphocyte activation molecule (SLAM; MIM 603492) that mediates an association with SLAM-associated protein (SAP; MIM 300490) (summarized by Foussias et al., 2000 [PubMed 11095983]).[supplied by OMIM, May 2010].
Protein
Protein (NP_055257)
SIGLEC-8
Sialic acid-binding Ig-like lectin 8 (Siglec-8) (Sialoadhesin family member 2) (SAF-2)
SIGLEC8
sialic acid binding Ig like lectin 8
Curated
I-type lectin
I-Type Lectins - CD33-related Siglecs
b-sandwich / Ig-like
0.541
Protein sequence and protein families (fasta) (499 amino acids) Download
MLLLLLLLPLLWGTKGMEGDRQYGDGYLLQVQELVTVQEGLCVHVPCSFSYPQDGWTDSDPVHGYWFRAGDRPYQDAPVATNNPDREVQAETQGRFQLLGDIWSNDCSLSIRDARKRDKGSYFFRLERGSMKWSYKSQLNYKTKQLSVFVTALTHRPDILILGTLESGHSRNLTCSVPWACKQGTPPMISWIGASVSSPGPTTARSSVLTLTPKPQDHGTSLTCQVTLPGTGVTTTSTVRLDVSYPPWNLTMTVFQGDATASTALGNGSSLSVLEGQSLRLVCAVNSNPPARLSWTRGSLTLCPSRSSNPGLLELPRVHVRDEGEFTCRAQNAQGSQHISLSLSLQNEGTGTSRPVSQVTLAAVGGAGATALAFLSFCIIFIIVRSCRKKSARPAAGVGDTGMEDAKAIRGSASQGPLTESWKDGNPLKKPPPAVAPSSGEEGELHYATLSFHKVKPQDPQGQEATDSEYSEIKIHKRETAETQACLRNHNPSSKEVRG
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
aNeuAc23bGal(6SO3)14(aFuc13)GlcNAc
NeuAc(a2-3)Gal(b1-4)[Fuc(a1-3)]GlcNAc
References
NCBI References (10 PubMed Identifiers)
  • First Evidence for a Role of Siglec-8 in Breast Cancer. [33670444]
  • Promoter region single nucleotide polymorphism of siglec-8 gene associates with susceptibility to allergic asthma. [32077788]
  • Sialic acid-binding immunoglobulin-like lectin (Siglec) 8 in patients with eosinophilic disorders: Receptor expression and targeting using chimeric antibodies. [30543818]
  • Sialic acid-binding immunoglobulin-like lectin 8 (Siglec-8) is an activating receptor mediating beta2-integrin-dependent function in human eosinophils. [28888781]
  • Leveraging Siglec-8 endocytic mechanisms to kill human eosinophils and malignant mast cells. [28734845]
  • Ligation of Siglec-8: a selective mechanism for induction of human eosinophil apoptosis. [12609831]
  • Identification, characterization and leucocyte expression of Siglec-10, a novel human sialic acid-binding receptor. [11284738]
  • Molecular characterization of a Siglec8 variant containing cytoplasmic tyrosine-based motifs, and mapping of the Siglec8 gene. [11095983]
  • Identification of SAF-2, a novel siglec expressed on eosinophils, mast cells, and basophils. [10856141]
  • Siglec-8. A novel eosinophil-specific member of the immunoglobulin superfamily. [10625619]
UniProt Main References (3 PubMed Identifiers)
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Structural basis for sulfation-dependent self-glycan recognition by the human immune-inhibitory receptor Siglec-8. [27357658]
  • Exome sequencing identifies frequent mutation of the SWI/SNF complex gene PBRM1 in renal carcinoma. [21248752]
All isoforms of this gene containing a lectin domain
NP_055257.2, XP_011525036.1, NP_001350477.1
RNA
RNA (Transcript ID: NM_014442.3)
sialic acid binding Ig like lectin 8, transcript variant 1
m7G-5')ppp(5'-AGUUUCUGAGAGAAGAACCCUGAGGAACAGACGUUCCCUGGCGGCCCUGGCGCCUUCAAACCCAGACAUGCUGCUGCUGCUGCUGCUGCUGCCCCUGCUCUGGGGGACAAAGGGGAUGGAGGGAGACAGACAAUAUGGGGAUGGUUACUUGCUGCAAGUGCAGGAGCUGGUGACGGUGCAGGAGGGCCUGUGUGUCCAUGUGCCCUGCUCCUUCUCCUACCCCCAGGAUGGCUGGACUGACUCUGACCCAGUUCAUGGCUACUGGUUCCGGGCAGGAGACAGACCAUACCAAGACGCUCCAGUGGCCACAAACAACCCAGACAGAGAAGUGCAGGCAGAGACCCAGGGCCGAUUCCAACUCCUUGGGGACAUUUGGAGCAACGACUGCUCCCUGAGCAUCAGAGACGCCAGGAAGAGGGAUAAGGGGUCAUAUUUCUUUCGGCUAGAGAGAGGAAGCAUGAAAUGGAGUUACAAAUCACAGUUGAAUUACAAAACUAAGCAGCUGUCUGUGUUUGUGACAGCCCUGACCCAUAGGCCUGACAUCCUCAUCCUAGGGACCCUAGAGUCUGGCCACUCCAGGAACCUGACCUGCUCUGUGCCCUGGGCCUGUAAGCAGGGGACACCCCCCAUGAUCUCCUGGAUUGGGGCCUCCGUGUCCUCCCCGGGCCCCACUACUGCCCGCUCCUCAGUGCUCACCCUUACCCCAAAGCCCCAGGACCACGGCACCAGCCUCACCUGUCAGGUGACCUUGCCUGGGACAGGUGUGACCACGACCAGUACCGUCCGCCUCGAUGUGUCCUACCCUCCUUGGAACUUGACCAUGACUGUCUUCCAAGGAGAUGCCACAGCAUCCACAGCCCUGGGAAAUGGCUCAUCUCUUUCAGUCCUUGAGGGCCAGUCUCUGCGCCUGGUCUGUGCUGUCAACAGCAAUCCCCCUGCCAGGCUGAGCUGGACCCGGGGGAGCCUGACCCUGUGCCCCUCACGGUCCUCAAACCCUGGGCUGCUGGAGCUGCCUCGAGUGCACGUGAGGGAUGAAGGGGAAUUCACCUGCCGAGCUCAGAACGCUCAGGGCUCCCAGCACAUUUCCCUGAGCCUCUCCCUGCAGAAUGAGGGCACAGGCACCUCAAGACCUGUAUCACAAGUGACACUGGCAGCAGUCGGGGGAGCUGGAGCCACAGCCCUGGCCUUCCUGUCCUUCUGCAUCAUCUUCAUCAUAGUGAGGUCCUGCAGGAAGAAAUCGGCAAGGCCAGCAGCGGGCGUGGGGGAUACAGGCAUGGAAGAUGCAAAGGCCAUCAGGGGCUCGGCCUCUCAGGGACCCCUGACUGAAUCCUGGAAAGAUGGCAACCCCCUGAAGAAGCCUCCCCCAGCUGUUGCCCCCUCGUCAGGGGAGGAAGGAGAGCUCCAUUAUGCAACCCUCAGCUUCCAUAAAGUGAAGCCUCAGGACCCGCAGGGACAGGAGGCCACUGACAGUGAAUACUCGGAGAUCAAGAUCCACAAGCGAGAAACUGCAGAGACUCAGGCCUGUUUGAGGAAUCACAACCCCUCCAGCAAAGAAGUCAGAGGCUGAUUCUCAUAGAACAAGAACCCUCUAGAGCCCCAUGCUAUGCAGUAGGUCACCAGGGCUCCCUCCUCCUGUCUAACCAAAACUUGGACCAAUGUCUCCCCUUUCCCCGGCUACCAGGGACCCAUCCCUGCCUCUAGCUUCUACUACCCACCAUUCUCCUCUCGACCUCUCUGAGGUUGACUAUUUUAGAUUCCACAUAGAGAUGAGGUCAUGUGGUACUUGCCUCUCUGUGUGUGGCUCAUUUUACACAAAAAAAUAUCCCCUAGGUUCAUCCAUGUUCUCUCAAAUGACAGAAUCAAGCACUGAAUAUUUUUUUUUCUUUGAGAGAUGGAGUUUCGCUCUGUUGCCCAGGCUGGAGUGCAGUGGUUCAAUCUCUGCUCACUGCAACCUCCACCUCCUGGGUUCAAACGAUUCUCCUGCCUCAGCUUCCCAAGUAGCUGGUACUACAGGCGUGUGUCACCACGCCCAGCUAAUUUUUGUAUUUUUUAGUAGAGACGGGGUUUCACUAUAAGUGGGCCAGGCUAGUCUCAAACUCCUGACCUCAAGUGAUCUGCCUGCCUUGGCCUCCCAAAGUGCUGGGAUUUCAGGCAUGAGCCACCGCACCCAGCUUGCAUUGAAUAUUUUCAAGGAGCUAAAAGAAGAUUUUAAAUGGUCUCACAAAAACAGAUAAAUAUUUGCACAGAUGGGUGUGCUAAUCAUUGUGCCUUGAUGGUUCCACGAUGUAUCCGGGUGUGGAAAUCUCACUGGGUCUCUCUCAAGGCCACUCGGCUACUCAGGACAGGGCUGGAAUUUAAAGCCUGUCCGAUUCUGAGGUCUCUUCUCUCAUCUAGCACUGAGUCAAGCAAUCAGCAGGCUGGGCACCCCUUAGCCAUAAGUUUUCAGGAAAUAAAUUCCUUGAGGGCAUUGACUUUUACAAAAGAGGGAGCAGCAAUGGCCUAGAGUCUCAGGAACAAGACAGGUGCACUGAGGAGAUGAAGGCCGGGACCCCCUGCCCAACCUGUAUGGCGGGUCUGUACUUAUUUUGUUUACCCCCAAUUUAAAACGUUUUUUUUUAUUGCAGGUUGUUUGUUUGAUAUGGUUUGGCUGUGUCCCCACCCAAAUCUUAUCUAGAAUUGUAAUCAGAAUUAUAAUCCCCAUGUGUUGGGGGAGGGACCUGGUGGGAGGUGAUAGGAUCAUGGGGGUGGUUCCCCCAUGCUGUUCUGAUAGUGAGUGAGUUAUCACGAGAUCUGAUGGUUUUGUAAGUGGUGGUUUCCCCUGCUCUUCUCUCUUGCCUGCCACCAUGUAAGAUGUGCCUGGUUCCCCUUCCGCCAUGAUUGUAAGUUUCCUGAGGCCUCCCCCGCCAUGUGGAACUGUGAGUCAAUUACACCUCUUUCAUUUAUAAAUUA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 27181)
sialic acid binding Ig like lectin 8
strand -
SIGLEC-8, SAF2, SIGLEC8L, MGC59785
NCBI CDS gene sequence (1500 bp)
5'-ATGCTGCTGCTGCTGCTGCTGCTGCCCCTGCTCTGGGGGACAAAGGGGATGGAGGGAGACAGACAATATGGGGATGGTTACTTGCTGCAAGTGCAGGAGCTGGTGACGGTGCAGGAGGGCCTGTGTGTCCATGTGCCCTGCTCCTTCTCCTACCCCCAGGATGGCTGGACTGACTCTGACCCAGTTCATGGCTACTGGTTCCGGGCAGGAGACAGACCATACCAAGACGCTCCAGTGGCCACAAACAACCCAGACAGAGAAGTGCAGGCAGAGACCCAGGGCCGATTCCAACTCCTTGGGGACATTTGGAGCAACGACTGCTCCCTGAGCATCAGAGACGCCAGGAAGAGGGATAAGGGGTCATATTTCTTTCGGCTAGAGAGAGGAAGCATGAAATGGAGTTACAAATCACAGTTGAATTACAAAACTAAGCAGCTGTCTGTGTTTGTGACAGCCCTGACCCATAGGCCTGACATCCTCATCCTAGGGACCCTAGAGTCTGGCCACTCCAGGAACCTGACCTGCTCTGTGCCCTGGGCCTGTAAGCAGGGGACACCCCCCATGATCTCCTGGATTGGGGCCTCCGTGTCCTCCCCGGGCCCCACTACTGCCCGCTCCTCAGTGCTCACCCTTACCCCAAAGCCCCAGGACCACGGCACCAGCCTCACCTGTCAGGTGACCTTGCCTGGGACAGGTGTGACCACGACCAGTACCGTCCGCCTCGATGTGTCCTACCCTCCTTGGAACTTGACCATGACTGTCTTCCAAGGAGATGCCACAGCATCCACAGCCCTGGGAAATGGCTCATCTCTTTCAGTCCTTGAGGGCCAGTCTCTGCGCCTGGTCTGTGCTGTCAACAGCAATCCCCCTGCCAGGCTGAGCTGGACCCGGGGGAGCCTGACCCTGTGCCCCTCACGGTCCTCAAACCCTGGGCTGCTGGAGCTGCCTCGAGTGCACGTGAGGGATGAAGGGGAATTCACCTGCCGAGCTCAGAACGCTCAGGGCTCCCAGCACATTTCCCTGAGCCTCTCCCTGCAGAATGAGGGCACAGGCACCTCAAGACCTGTATCACAAGTGACACTGGCAGCAGTCGGGGGAGCTGGAGCCACAGCCCTGGCCTTCCTGTCCTTCTGCATCATCTTCATCATAGTGAGGTCCTGCAGGAAGAAATCGGCAAGGCCAGCAGCGGGCGTGGGGGATACAGGCATGGAAGATGCAAAGGCCATCAGGGGCTCGGCCTCTCAGGGACCCCTGACTGAATCCTGGAAAGATGGCAACCCCCTGAAGAAGCCTCCCCCAGCTGTTGCCCCCTCGTCAGGGGAGGAAGGAGAGCTCCATTATGCAACCCTCAGCTTCCATAAAGTGAAGCCTCAGGACCCGCAGGGACAGGAGGCCACTGACAGTGAATACTCGGAGATCAAGATCCACAAGCGAGAAACTGCAGAGACTCAGGCCTGTTTGAGGAATCACAACCCCTCCAGCAAAGAAGTCAGAGGCTGA-3'
NCBI CDS gene sequence with introns (location: 51452379.. 51458387) (6009 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 51450997.. 51458454) (7458 bp)Download
NCBI gene sequence (location: [51450997.. 51458454 + 1000]) (8458 bp)Download
Cite How to cite