NCBI Summary
The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Protein
Protein (NP_055200)
SIGLEC-7
Sialic acid-binding Ig-like lectin 7 (Siglec-7) (Adhesion inhibitory receptor molecule 1) (AIRM-1) (CDw328) (D-siglec) (QA79 membrane protein) (p75) (CD antigen CD328)
SIGLEC7
sialic acid binding Ig like lectin 7
Curated
I-type lectin
I-Type Lectins - CD33-related Siglecs
b-sandwich / Ig-like
0.534
Protein sequence and protein families (fasta) (467 amino acids) Download
MLLLLLLPLLWGRERVEGQKSNRKDYSLTMQSSVTVQEGMCVHVRCSFSYPVDSQTDSDPVHGYWFRAGNDISWKAPVATNNPAWAVQEETRDRFHLLGDPQTKNCTLSIRDARMSDAGRYFFRMEKGNIKWNYKYDQLSVNVTALTHRPNILIPGTLESGCFQNLTCSVPWACEQGTPPMISWMGTSVSPLHPSTTRSSVLTLIPQPQHHGTSLTCQVTLPGAGVTTNRTIQLNVSYPPQNLTVTVFQGEGTASTALGNSSSLSVLEGQSLRLVCAVDSNPPARLSWTWRSLTLYPSQPSNPLVLELQVHLGDEGEFTCRAQNSLGSQHVSLNLSLQQEYTGKMRPVSGVLLGAVGGAGATALVFLSFCVIFIVVRSCRKKSARPAADVGDIGMKDANTIRGSASQGNLTESWADDNPRHHGLAAHSSGEEREIQYAPLSFHKGEPQDLSGQEATNNEYSEIKIPK
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
Oxamido-NeuAc
NeuAc
aNeuAc23bGal13(aNeuAc26)GlcNAc
NeuAc(a2-3)Gal(b1-3)[NeuAc(a2-6)]GlcNAc
2
GalNAc(b1-4)[NeuAc(a2-8)NeuAc(a2-3)]Gal(b1-4)Glc
References
NCBI References (10 PubMed Identifiers)
  • Genome-wide CRISPR screens reveal a specific ligand for the glycan-binding immune checkpoint receptor Siglec-7. [33495350]
  • The conserved arginine residue in all siglecs is essential for Siglec-7 binding to sialic acid. [33248687]
  • Identification and functional characterization of a Siglec-7 counter-receptor on K562 cells. [33640457]
  • Decidual glycodelin-A polarizes human monocytes into a decidual macrophage-like phenotype through Siglec-7. [32513821]
  • Discovery of a new sialic acid binding region that regulates Siglec-7. [32457377]
  • Engagement of p75/AIRM1 or CD33 inhibits the proliferation of normal or leukemic myeloid cells. [10611343]
  • Identification and characterization of a novel siglec, siglec-7, expressed by human natural killer cells and monocytes. [10567377]
  • TRAF family proteins interact with the common neurotrophin receptor and modulate apoptosis induction. [10514511]
  • Identification and molecular cloning of p75/AIRM1, a novel member of the sialoadhesin family that functions as an inhibitory receptor in human natural killer cells. [10499918]
  • SH3 domains of the adapter molecule Grb2 complex with two proteins in T cells: the guanine nucleotide exchange protein Sos and a 75-kDa protein that is a substrate for T cell antigen receptor-activated tyrosine kinases. [8188688]
UniProt Main References (8 PubMed Identifiers)
  • Siglec-7: a sialic acid-binding lectin of the immunoglobulin superfamily. [10764831]
  • Binding specificity of siglec7 to disialogangliosides of renal cell carcinoma: possible role of disialogangliosides in tumor progression. [11389909]
  • An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. [24275569]
  • High resolution crystal structures of Siglec-7. Insights into ligand specificity in the Siglec family. [12438315]
  • Structure of the saccharide-binding domain of the human natural killer cell inhibitory receptor p75/AIRM1. [14747738]
  • The structure of siglec-7 in complex with sialosides: leads for rational structure-based inhibitor design. [16623661]
  • Siglec-7 undergoes a major conformational change when complexed with the alpha(2,8)-disialylganglioside GT1b. [16895906]
  • The consensus coding sequences of human breast and colorectal cancers. [16959974]
All isoforms of this gene containing a lectin domain
NP_055200.1, NP_057627.2, XP_011525023.1, NP_001264130.1
RNA
RNA (Transcript ID: NM_014385.4)
sialic acid binding Ig like lectin 7, transcript variant 1
m7G-5')ppp(5'-GCAGUUCCUGAGAGAAGAACCCUGAGGAACAGACGUUCCCUCGCGGCCCUGGCACCUCCAACCCCAGAUAUGCUGCUGCUGCUGCUGCUGCCCCUGCUCUGGGGGAGGGAGAGGGUGGAAGGACAGAAGAGUAACCGGAAGGAUUACUCGCUGACGAUGCAGAGUUCCGUGACCGUGCAAGAGGGCAUGUGUGUCCAUGUGCGCUGCUCCUUCUCCUACCCAGUGGACAGCCAGACUGACUCUGACCCAGUUCAUGGCUACUGGUUCCGGGCAGGGAAUGAUAUAAGCUGGAAGGCUCCAGUGGCCACAAACAACCCAGCUUGGGCAGUGCAGGAGGAAACUCGGGACCGAUUCCACCUCCUUGGGGACCCACAGACCAAAAAUUGCACCCUGAGCAUCAGAGAUGCCAGAAUGAGUGAUGCGGGGAGAUACUUCUUUCGUAUGGAGAAAGGAAAUAUAAAAUGGAAUUAUAAAUAUGACCAGCUCUCUGUGAACGUGACAGCCUUGACCCACAGGCCCAACAUCCUUAUCCCCGGUACCCUGGAGUCUGGCUGCUUCCAGAAUCUGACCUGCUCUGUGCCCUGGGCCUGUGAGCAGGGGACGCCCCCUAUGAUCUCCUGGAUGGGGACCUCUGUGUCCCCCCUGCACCCCUCCACCACCCGCUCCUCAGUGCUCACCCUCAUCCCACAGCCCCAGCACCACGGCACCAGCCUCACCUGUCAGGUGACCUUGCCUGGGGCCGGCGUGACCACGAACAGGACCAUCCAACUCAAUGUGUCCUACCCUCCUCAGAACUUGACUGUGACUGUCUUCCAAGGAGAAGGCACAGCAUCCACAGCUCUGGGGAACAGCUCAUCUCUUUCAGUCCUAGAGGGCCAGUCUCUGCGCUUGGUCUGUGCUGUUGACAGCAAUCCCCCUGCCAGGCUGAGCUGGACCUGGAGGAGUCUGACCCUGUACCCCUCACAGCCCUCAAACCCUCUGGUACUGGAGCUGCAAGUGCACCUGGGGGAUGAAGGGGAAUUCACCUGUCGAGCUCAGAACUCUCUGGGUUCCCAGCACGUUUCCCUGAACCUCUCCCUGCAACAGGAGUACACAGGCAAAAUGAGGCCUGUAUCAGGAGUGUUGCUGGGGGCGGUCGGGGGAGCUGGAGCCACAGCCCUGGUCUUCCUCUCCUUCUGUGUCAUCUUCAUUGUAGUGAGGUCCUGCAGGAAGAAAUCGGCAAGGCCAGCAGCGGACGUGGGAGACAUAGGCAUGAAGGAUGCAAACACCAUCAGGGGCUCAGCCUCUCAGGGUAACCUGACUGAGUCCUGGGCAGAUGAUAACCCCCGACACCAUGGCCUGGCUGCCCACUCCUCAGGGGAGGAAAGAGAGAUCCAGUAUGCACCCCUCAGCUUUCAUAAGGGGGAGCCUCAGGACCUAUCAGGACAAGAAGCCACCAACAAUGAGUACUCAGAGAUCAAGAUCCCCAAGUAAGAAAAUGCAGAGGCUCGGGCUUGUUUGAGGGUUCACGACCCCUCCAGCAAAGGAGUCUGAGGCUGAUUCCAGUAGAAUUAGCAGCCCUCAAUGCUGUGCAACAAGACAUCAGAACUUAUUCCUCUUGUCUAACUGAAAAUGCAUGCCUGAUGACCAAACUCUCCCUUUCCCCAUCCAAUCGGUCCACACUCCCCGCCCUGGCCUCUGGUACCCACCAUUCUCCUCUGUACUUCUCUAAGGAUGACUACUUUAGAUUCCGAAUAUAGUGAGAUUGUAACGUG-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 27036)
sialic acid binding Ig like lectin 7
strand +
SIGLEC-7, p75/AIRM1, QA79, CD328
NCBI CDS gene sequence (1404 bp)
5'-ATGCTGCTGCTGCTGCTGCTGCCCCTGCTCTGGGGGAGGGAGAGGGTGGAAGGACAGAAGAGTAACCGGAAGGATTACTCGCTGACGATGCAGAGTTCCGTGACCGTGCAAGAGGGCATGTGTGTCCATGTGCGCTGCTCCTTCTCCTACCCAGTGGACAGCCAGACTGACTCTGACCCAGTTCATGGCTACTGGTTCCGGGCAGGGAATGATATAAGCTGGAAGGCTCCAGTGGCCACAAACAACCCAGCTTGGGCAGTGCAGGAGGAAACTCGGGACCGATTCCACCTCCTTGGGGACCCACAGACCAAAAATTGCACCCTGAGCATCAGAGATGCCAGAATGAGTGATGCGGGGAGATACTTCTTTCGTATGGAGAAAGGAAATATAAAATGGAATTATAAATATGACCAGCTCTCTGTGAACGTGACAGCCTTGACCCACAGGCCCAACATCCTTATCCCCGGTACCCTGGAGTCTGGCTGCTTCCAGAATCTGACCTGCTCTGTGCCCTGGGCCTGTGAGCAGGGGACGCCCCCTATGATCTCCTGGATGGGGACCTCTGTGTCCCCCCTGCACCCCTCCACCACCCGCTCCTCAGTGCTCACCCTCATCCCACAGCCCCAGCACCACGGCACCAGCCTCACCTGTCAGGTGACCTTGCCTGGGGCCGGCGTGACCACGAACAGGACCATCCAACTCAATGTGTCCTACCCTCCTCAGAACTTGACTGTGACTGTCTTCCAAGGAGAAGGCACAGCATCCACAGCTCTGGGGAACAGCTCATCTCTTTCAGTCCTAGAGGGCCAGTCTCTGCGCTTGGTCTGTGCTGTTGACAGCAATCCCCCTGCCAGGCTGAGCTGGACCTGGAGGAGTCTGACCCTGTACCCCTCACAGCCCTCAAACCCTCTGGTACTGGAGCTGCAAGTGCACCTGGGGGATGAAGGGGAATTCACCTGTCGAGCTCAGAACTCTCTGGGTTCCCAGCACGTTTCCCTGAACCTCTCCCTGCAACAGGAGTACACAGGCAAAATGAGGCCTGTATCAGGAGTGTTGCTGGGGGCGGTCGGGGGAGCTGGAGCCACAGCCCTGGTCTTCCTCTCCTTCTGTGTCATCTTCATTGTAGTGAGGTCCTGCAGGAAGAAATCGGCAAGGCCAGCAGCGGACGTGGGAGACATAGGCATGAAGGATGCAAACACCATCAGGGGCTCAGCCTCTCAGGGTAACCTGACTGAGTCCTGGGCAGATGATAACCCCCGACACCATGGCCTGGCTGCCCACTCCTCAGGGGAGGAAAGAGAGATCCAGTATGCACCCCTCAGCTTTCATAAGGGGGAGCCTCAGGACCTATCAGGACAAGAAGCCACCAACAATGAGTACTCAGAGATCAAGATCCCCAAGTAA-3'
NCBI CDS gene sequence with introns (location: 51142370.. 51153245) (10876 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 51142301.. 51153526) (11226 bp)Download
NCBI gene sequence (location: [51142301 - 1000].. 51153526) (12226 bp)Download
Cite How to cite