NCBI Summary
This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008].
Protein
Protein (NP_001009944)
Polycystin 1
Polycystin-1 (PC1) (Autosomal dominant polycystic kidney disease 1 protein)
PKD1
polycystin 1, transient receptor potential channel interacting
Undefined
Very low evidence
C-type lectin
Undefined
C-type - Polycysti
a/b mixed / C-type lectin-like
Uncharacterised
0.34
Protein sequence and protein families (fasta) (4303 amino acids) Download
MPPAAPARLALALGLGLWLGALAGGPGRGCGPCEPPCLCGPAPGAACRVNCSGRGLRTLGPALRIPADATALDVSHNLLRALDVGLLANLSALAELDISNNKISTLEEGIFANLFNLSEINLSGNPFECDCGLAWLPRWAEEQQVRVVQPEAATCAGPGSLAGQPLLGIPLLDSGCGEEYVACLPDNSSGTVAAVSFSAAHEGLLQPEACSAFCFSTGQGLAALSEQGWCLCGAAQPSSASFACLSLCSGPPPPPAPTCRGPTLLQHVFPASPGATLVGPHGPLASGQLAAFHIAAPLPVTATRWDFGDGSAEVDAAGPAASHRYVLPGRYHVTAVLALGAGSALLGTDVQVEAAPAALELVCPSSVQSDESLDLSIQNRGGSGLEAAYSIVALGEEPARAVHPLCPSDTEIFPGNGHCYRLVVEKAAWLQAQEQCQAWAGAALAMVDSPAVQRFLVSRVTRSLDVWIGFSTVQGVEVGPAPQGEAFSLESCQNWLPGEPHPATAEHCVRLGPTGWCNTDLCSAPHSYVCELQPGGPVQDAENLLVGAPSGDLQGPLTPLAQQDGLSAPHEPVEVMVFPGLRLSREAFLTTAEFGTQELRRPAQLRLQVYRLLSTAGTPENGSEPESRSPDNRTQLAPACMPGGRWCPGANICLPLDASCHPQACANGCTSGPGLPGAPYALWREFLFSVPAGPPAQYSVTLHGQDVLMLPGDLVGLQHDAGPGALLHCSPAPGHPGPRAPYLSANASSWLPHLPAQLEGTWACPACALRLLAATEQLTVLLGLRPNPGLRLPGRYEVRAEVGNGVSRHNLSCSFDVVSPVAGLRVIYPAPRDGRLYVPTNGSALVLQVDSGANATATARWPGGSVSARFENVCPALVATFVPGCPWETNDTLFSVVALPWLSEGEHVVDVVVENSASRANLSLRVTAEEPICGLRATPSPEARVLQGVLVRYSPVVEAGSDMVFRWTINDKQSLTFQNVVFNVIYQSAAVFKLSLTASNHVSNVTVNYNVTVERMNRMQGLQVSTVPAVLSPNATLALTAGVLVDSAVEVAFLWTFGDGEQALHQFQPPYNESFPVPDPSVAQVLVEHNVMHTYAAPGEYLLTVLASNAFENLTQQVPVSVRASLPSVAVGVSDGVLVAGRPVTFYPHPLPSPGGVLYTWDFGDGSPVLTQSQPAANHTYASRGTYHVRLEVNNTVSGAAAQADVRVFEELRGLSVDMSLAVEQGAPVVVSAAVQTGDNITWTFDMGDGTVLSGPEATVEHVYLRAQNCTVTVGAASPAGHLARSLHVLVFVLEVLRVEPAACIPTQPDARLTAYVTGNPAHYLFDWTFGDGSSNTTVRGCPTVTHNFTRSGTFPLALVLSSRVNRAHYFTSICVEPEVGNVTLQPERQFVQLGDEAWLVACAWPPFPYRYTWDFGTEEAAPTRARGPEVTFIYRDPGSYLVTVTASNNISAANDSALVEVQEPVLVTSIKVNGSLGLELQQPYLFSAVGRGRPASYLWDLGDGGWLEGPEVTHAYNSTGDFTVRVAGWNEVSRSEAWLNVTVKRRVRGLVVNASRTVVPLNGSVSFSTSLEAGSDVRYSWVLCDRCTPIPGGPTISYTFRSVGTFNIIVTAENEVGSAQDSIFVYVLQLIEGLQVVGGGRYFPTNHTVQLQAVVRDGTNVSYSWTAWRDRGPALAGSGKGFSLTVLEAGTYHVQLRATNMLGSAWADCTMDFVEPVGWLMVAASPNPAAVNTSVTLSAELAGGSGVVYTWSLEEGLSWETSEPFTTHSFPTPGLHLVTMTAGNPLGSANATVEVDVQVPVSGLSIRASEPGGSFVAAGSSVPFWGQLATGTNVSWCWAVPGGSSKRGPHVTMVFPDAGTFSIRLNASNAVSWVSATYNLTAEEPIVGLVLWASSKVVAPGQLVHFQILLAAGSAVTFRLQVGGANPEVLPGPRFSHSFPRVGDHVVSVRGKNHVSWAQAQVRIVVLEAVSGLQVPNCCEPGIATGTERNFTARVQRGSRVAYAWYFSLQKVQGDSLVILSGRDVTYTPVAAGLLEIQVRAFNALGSENRTLVLEVQDAVQYVALQSGPCFTNRSAQFEAATSPSPRRVAYHWDFGDGSPGQDTDEPRAEHSYLRPGDYRVQVNASNLVSFFVAQATVTVQVLACREPEVDVVLPLQVLMRRSQRNYLEAHVDLRDCVTYQTEYRWEVYRTASCQRPGRPARVALPGVDVSRPRLVLPRLALPVGHYCFVFVVSFGDTPLTQSIQANVTVAPERLVPIIEGGSYRVWSDTRDLVLDGSESYDPNLEDGDQTPLSFHWACVASTQREAGGCALNFGPRGSSTVTIPRERLAAGVEYTFSLTVWKAGRKEEATNQTVLIRSGRVPIVSLECVSCKAQAVYEVSRSSYVYLEGRCLNCSSGSKRGRWAARTFSNKTLVLDETTTSTGSAGMRLVLRRGVLRDGEGYTFTLTVLGRSGEEEGCASIRLSPNRPPLGGSCRLFPLGAVHALTTKVHFECTGWHDAEDAGAPLVYALLLRRCRQGHCEEFCVYKGSLSSYGAVLPPGFRPHFEVGLAVVVQDQLGAAVVALNRSLAITLPEPNGSATGLTVWLHGLTASVLPGLLRQADPQHVIEYSLALVTVLNEYERALDVAAEPKHERQHRAQIRKNITETLVSLRVHTVDDIQQIAAALAQCMGPSRELVCRSCLKQTLHKLEAMMLILQAETTAGTVTPTAIGDSILNITGDLIHLASSDVRAPQPSELGAESPSRMVASQAYNLTSALMRILMRSRVLNEEPLTLAGEEIVAQGKRSDPRSLLCYGGAPGPGCHFSIPEAFSGALANLSDVVQLIFLVDSNPFPFGYISNYTVSTKVASMAFQTQAGAQIPIERLASERAITVKVPNNSDWAARGHRSSANSANSVVVQPQASVGAVVTLDSSNPAAGLHLQLNYTLLDGHYLSEEPEPYLAVYLHSEPRPNEHNCSASRRIRPESLQGADHRPYTFFISPGSRDPAGSYHLNLSSHFRWSALQVSVGLYTSLCQYFSEEDMVWRTEGLLPLEETSPRQAVCLTRHLTAFGASLFVPPSHVRFVFPEPTADVNYIVMLTCAVCLVTYMVMAAILHKLDQLDASRGRAIPFCGQRGRFKYEILVKTGWGRGSGTTAHVGIMLYGVDSRSGHRHLDGDRAFHRNSLDIFRIATPHSLGSVWKIRVWHDNKGLSPAWFLQHVIVRDLQTARSAFFLVNDWLSVETEANGGLVEKEVLAASDAALLRFRRLLVAELQRGFFDKHIWLSIWDRPPRSRFTRIQRATCCVLLICLFLGANAVWYGAVGDSAYSTGHVSRLSPLSVDTVAVGLVSSVVVYPVYLAILFLFRMSRSKVAGSPSPTPAGQQVLDIDSCLDSSVLDSSFLTFSGLHAEQAFVGQMKSDLFLDDSKSLVCWPSGEGTLSWPDLLSDPSIVGSNLRQLARGQAGHGLGPEEDGFSLASPYSPAKSFSASDEDLIQQVLAEGVSSPAPTQDTHMETDLLSSLSSTPGEKTETLALQRLGELGPPSPGLNWEQPQAARLSRTGLVEGLRKRLLPAWCASLAHGLSLLLVAVAVAVSGWVGASFPPGVSVAWLLSSSASFLASFLGWEPLKVLLEALYFSLVAKRLHPDEDDTLVESPAVTPVSARVPRVRPPHGFALFLAKEEARKVKRLHGMLRSLLVYMLFLLVTLLASYGDASCHGHAYRLQSAIKQELHSRAFLAITRSEELWPWMAHVLLPYVHGNQSSPELGPPRLRQVRLQEALYPDPPGPRVHTCSAAGGFSTSDYDVGWESPHNGSGTWAYSAPDLLGAWSWGSCAVYDSGGYVQELGLSLEESRDRLRFLQLHNWLDNRSRAVFLELTRYSPAVGLHAAVTLRLEFPAAGRALAALSVRPFALRRLSAGLSLPLLTSVCLLLFAVHFAVAEARTWHREGRWRVLRLGAWARWLLVALTAATALVRLAQLGAADRQWTRFVRGRPRRFTSFDQVAQLSSAARGLAASLLFLLLVKAAQQLRFVRQWSVFGKTLCRALPELLGVTLGLVVLGVAYAQLAILLVSSCVDSLWSVAQALLVLCPGTGLSTLCPAESWHLSPLLCVGLWALRLWGALRLGAVILRWRYHALRGELYRPAWEPQDYEMVELFLRRLRLWMGLSKVKEFRHKVRFEGMEPLPSRSSRGSKVSPDVPPPSAGSDASHPSTSSSQLDGLSVSLGRLGTRCEPEPSRLQAVFEALLTQFDRLNQATEDVYQLEQQLHSLQGRRSSRAPAGSSRGPSPGLRPALPSRLARASRGVDLATGPSRTPLRAKNKVHPSST
Mol* PDB structure viewer
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.57, 2.03] ÅDownload
The location of the lectin domain structural model is: 394-536
We infer [1.57, 2.03] Å as the interval of error of this structural model.
Template 1: 6JJJ chain: A, P70194, NP_058031.2, sequence identity: 27.3%, coverage: 93.7%, location in sequence: 393-543, (393-543 in PDB).
Template 2: 5VYB chain: A, Q6EIG7, NP_001007034.1, sequence identity: 23.8%, coverage: 97.2%, location in sequence: 63-209, (63-209 in PDB).
Template 3: 3ZHG chain: A, Q8CJ91, NP_081248.4, sequence identity: 22.4%, coverage: 91.6%, location in sequence: 191-322, (191-322 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • PKD1-Associated Arachnoid Cysts in Autosomal Dominant Polycystic Kidney Disease. [34175641]
  • Polycystin-1 Enhances Stemmness Potential of Umbilical Cord Blood-Derived Mesenchymal Stem Cells. [34064452]
  • Cross Talk Between Renal Transporters and Polycystin-1 as a Potential Molecular Target Involved in Autosomal Dominant Polycystic Kidney Disease. [33994377]
  • Polycystin-1 modulates RUNX2 activation and osteocalcin gene expression via ERK signalling in a human craniosynostosis cell model. [33656806]
  • A novel nonsense mutation in the PKD1 gene (C3817T) is associated with autosomal dominant polycystic kidney disease (ADPKD) in a large three-generation Italian family. [7581371]
  • The polycystic kidney disease 1 (PKD1) gene encodes a novel protein with multiple cell recognition domains. [7663510]
  • Analysis of the genomic sequence for the autosomal dominant polycystic kidney disease (PKD1) gene predicts the presence of a leucine-rich repeat. The American PKD1 Consortium (APKD1 Consortium). [7633406]
  • Congenital Hepatic Fibrosis Overview [20301743]
  • Polycystic Kidney Disease, Autosomal Dominant [20301424]
  • Studies of genetic linkage between adult polycystic kidney disease and three markers on chromosome 16. [2821260]
UniProt Main References (51 PubMed Identifiers)
  • Polycystic kidney disease: the complete structure of the PKD1 gene and its protein. The International Polycystic Kidney Disease Consortium. [7736581]
  • The sequence and analysis of duplication-rich human chromosome 16. [15616553]
  • The polycystic kidney disease 1 gene encodes a 14 kb transcript and lies within a duplicated region on chromosome 16. The European Polycystic Kidney Disease Consortium. [8004675]
  • The polycystic kidney disease 1 gene encodes a 14 kb transcript and lies within a duplicated region on chromosome 16. The European Polycystic Kidney Disease Consortium. [8069919]
  • Interaction between RGS7 and polycystin. [10339594]
  • Cleavage of polycystin-1 requires the receptor for egg jelly domain and is disrupted by human autosomal-dominant polycystic kidney disease 1-associated mutations. [12482949]
  • Characterization of cis-autoproteolysis of polycystin-1, the product of human polycystic kidney disease 1 gene. [17525154]
  • Protein kinase X (PRKX) can rescue the effects of polycystic kidney disease-1 gene (PKD1) deficiency. [17980165]
  • Protein kinase D-mediated phosphorylation of polycystin-2 (TRPP2) is essential for its effects on cell growth and calcium channel activity. [20881056]
  • Polycystin-1 surface localization is stimulated by polycystin-2 and cleavage at the G protein-coupled receptor proteolytic site. [20980620]
  • Show more
All isoforms of this gene containing a lectin domain
XP_024306068.1, NP_001009944.3, NP_000287.4, XP_024306067.1, XP_011520830.1, XP_011520831.1, XP_024306066.1
RNA
RNA (Transcript ID: NM_001009944.3)
polycystin 1, transient receptor potential channel interacting, transcript variant 1
m7G-5')ppp(5'-GCACUGCAGCGCCAGCGUCCGAGCGGGCGGCCGAGCUCCCGGAGCGGCCUGGCCCCGAGCCCCGAGCGGGCGUCGCUCAGCAGCAGGUCGCGGCCGCAGCCCCAUCCAGCCCCGCGCCCGCCAUGCCGUCCGCGGGCCCCGCCUGAGCUGCGGCCUCCGCGCGCGGGCGGGCCUGGGGACGGCGGGGCCAUGCGCGCGCUGCCCUAACGAUGCCGCCCGCCGCGCCCGCCCGCCUGGCGCUGGCCCUGGGCCUGGGCCUGUGGCUCGGGGCGCUGGCGGGGGGCCCCGGGCGCGGCUGCGGGCCCUGCGAGCCCCCCUGCCUCUGCGGCCCAGCGCCCGGCGCCGCCUGCCGCGUCAACUGCUCGGGCCGCGGGCUGCGGACGCUCGGUCCCGCGCUGCGCAUCCCCGCGGACGCCACAGCGCUAGACGUCUCCCACAACCUGCUCCGGGCGCUGGACGUUGGGCUCCUGGCGAACCUCUCGGCGCUGGCAGAGCUGGAUAUAAGCAACAACAAGAUUUCUACGUUAGAAGAAGGAAUAUUUGCUAAUUUAUUUAAUUUAAGUGAAAUAAACCUGAGUGGGAACCCGUUUGAGUGUGACUGUGGCCUGGCGUGGCUGCCGCGAUGGGCGGAGGAGCAGCAGGUGCGGGUGGUGCAGCCCGAGGCAGCCACGUGUGCUGGGCCUGGCUCCCUGGCUGGCCAGCCUCUGCUUGGCAUCCCCUUGCUGGACAGUGGCUGUGGUGAGGAGUAUGUCGCCUGCCUCCCUGACAACAGCUCAGGCACCGUGGCAGCAGUGUCCUUUUCAGCUGCCCACGAAGGCCUGCUUCAGCCAGAGGCCUGCAGCGCCUUCUGCUUCUCCACCGGCCAGGGCCUCGCAGCCCUCUCGGAGCAGGGCUGGUGCCUGUGUGGGGCGGCCCAGCCCUCCAGUGCCUCCUUUGCCUGCCUGUCCCUCUGCUCCGGCCCCCCGCCACCUCCUGCCCCCACCUGUAGGGGCCCCACCCUCCUCCAGCACGUCUUCCCUGCCUCCCCAGGGGCCACCCUGGUGGGGCCCCACGGACCUCUGGCCUCUGGCCAGCUAGCAGCCUUCCACAUCGCUGCCCCGCUCCCUGUCACUGCCACACGCUGGGACUUCGGAGACGGCUCCGCCGAGGUGGAUGCCGCUGGGCCGGCUGCCUCGCAUCGCUAUGUGCUGCCUGGGCGCUAUCACGUGACGGCCGUGCUGGCCCUGGGGGCCGGCUCAGCCCUGCUGGGGACAGACGUGCAGGUGGAAGCGGCACCUGCCGCCCUGGAGCUCGUGUGCCCGUCCUCGGUGCAGAGUGACGAGAGCCUCGACCUCAGCAUCCAGAACCGCGGUGGUUCAGGCCUGGAGGCCGCCUACAGCAUCGUGGCCCUGGGCGAGGAGCCGGCCCGAGCGGUGCACCCGCUCUGCCCCUCGGACACGGAGAUCUUCCCUGGCAACGGGCACUGCUACCGCCUGGUGGUGGAGAAGGCGGCCUGGCUGCAGGCGCAGGAGCAGUGUCAGGCCUGGGCCGGGGCCGCCCUGGCAAUGGUGGACAGUCCCGCCGUGCAGCGCUUCCUGGUCUCCCGGGUCACCAGGAGCCUAGACGUGUGGAUCGGCUUCUCGACUGUGCAGGGGGUGGAGGUGGGCCCAGCGCCGCAGGGCGAGGCCUUCAGCCUGGAGAGCUGCCAGAACUGGCUGCCCGGGGAGCCACACCCAGCCACAGCCGAGCACUGCGUCCGGCUCGGGCCCACCGGGUGGUGUAACACCGACCUGUGCUCAGCGCCGCACAGCUACGUCUGCGAGCUGCAGCCCGGAGGCCCAGUGCAGGAUGCCGAGAACCUCCUCGUGGGAGCGCCCAGUGGGGACCUGCAGGGACCCCUGACGCCUCUGGCACAGCAGGACGGCCUCUCAGCCCCGCACGAGCCCGUGGAGGUCAUGGUAUUCCCGGGCCUGCGUCUGAGCCGUGAAGCCUUCCUCACCACGGCCGAAUUUGGGACCCAGGAGCUCCGGCGGCCCGCCCAGCUGCGGCUGCAGGUGUACCGGCUCCUCAGCACAGCAGGGACCCCGGAGAACGGCAGCGAGCCUGAGAGCAGGUCCCCGGACAACAGGACCCAGCUGGCCCCCGCGUGCAUGCCAGGGGGACGCUGGUGCCCUGGAGCCAACAUCUGCUUGCCGCUGGACGCCUCCUGCCACCCCCAGGCCUGCGCCAAUGGCUGCACGUCAGGGCCAGGGCUACCCGGGGCCCCCUAUGCGCUAUGGAGAGAGUUCCUCUUCUCCGUUCCCGCGGGGCCCCCCGCGCAGUACUCGGUCACCCUCCACGGCCAGGAUGUCCUCAUGCUCCCUGGUGACCUCGUUGGCUUGCAGCACGACGCUGGCCCUGGCGCCCUCCUGCACUGCUCGCCGGCUCCCGGCCACCCUGGUCCCCGGGCCCCGUACCUCUCCGCCAACGCCUCGUCAUGGCUGCCCCACUUGCCAGCCCAGCUGGAGGGCACUUGGGCCUGCCCUGCCUGUGCCCUGCGGCUGCUUGCAGCCACGGAACAGCUCACCGUGCUGCUGGGCUUGAGGCCCAACCCUGGACUGCGGCUGCCUGGGCGCUAUGAGGUCCGGGCAGAGGUGGGCAAUGGCGUGUCCAGGCACAACCUCUCCUGCAGCUUUGACGUGGUCUCCCCAGUGGCUGGGCUGCGGGUCAUCUACCCUGCCCCCCGCGACGGCCGCCUCUACGUGCCCACCAACGGCUCAGCCUUGGUGCUCCAGGUGGACUCUGGUGCCAACGCCACGGCCACGGCUCGCUGGCCUGGGGGCAGUGUCAGCGCCCGCUUUGAGAAUGUCUGCCCUGCCCUGGUGGCCACCUUCGUGCCCGGCUGCCCCUGGGAGACCAACGAUACCCUGUUCUCAGUGGUAGCACUGCCGUGGCUCAGUGAGGGGGAGCACGUGGUGGACGUGGUGGUGGAAAACAGCGCCAGCCGGGCCAACCUCAGCCUGCGGGUGACGGCGGAGGAGCCCAUCUGUGGCCUCCGCGCCACGCCCAGCCCCGAGGCCCGUGUACUGCAGGGAGUCCUAGUGAGGUACAGCCCCGUGGUGGAGGCCGGCUCGGACAUGGUCUUCCGGUGGACCAUCAACGACAAGCAGUCCCUGACCUUCCAGAACGUGGUCUUCAAUGUCAUUUAUCAGAGCGCGGCGGUCUUCAAGCUCUCACUGACGGCCUCCAACCACGUGAGCAACGUCACCGUGAACUACAACGUAACCGUGGAGCGGAUGAACAGGAUGCAGGGUCUGCAGGUCUCCACAGUGCCGGCCGUGCUGUCCCCCAAUGCCACGCUAGCACUGACGGCGGGCGUGCUGGUGGACUCGGCCGUGGAGGUGGCCUUCCUGUGGACCUUUGGGGAUGGGGAGCAGGCCCUCCACCAGUUCCAGCCUCCGUACAACGAGUCCUUCCCGGUUCCAGACCCCUCGGUGGCCCAGGUGCUGGUGGAGCACAAUGUCAUGCACACCUACGCUGCCCCAGGUGAGUACCUCCUGACCGUGCUGGCAUCUAAUGCCUUCGAGAACCUGACGCAGCAGGUGCCUGUGAGCGUGCGCGCCUCCCUGCCCUCCGUGGCUGUGGGUGUGAGUGACGGCGUCCUGGUGGCCGGCCGGCCCGUCACCUUCUACCCGCACCCGCUGCCCUCGCCUGGGGGUGUUCUUUACACGUGGGACUUCGGGGACGGCUCCCCUGUCCUGACCCAGAGCCAGCCGGCUGCCAACCACACCUAUGCCUCGAGGGGCACCUACCACGUGCGCCUGGAGGUCAACAACACGGUGAGCGGUGCGGCGGCCCAGGCGGAUGUGCGCGUCUUUGAGGAGCUCCGCGGACUCAGCGUGGACAUGAGCCUGGCCGUGGAGCAGGGCGCCCCCGUGGUGGUCAGCGCCGCGGUGCAGACGGGCGACAACAUCACGUGGACCUUCGACAUGGGGGACGGCACCGUGCUGUCGGGCCCGGAGGCAACAGUGGAGCAUGUGUACCUGCGGGCACAGAACUGCACAGUGACCGUGGGUGCGGCCAGCCCCGCCGGCCACCUGGCCCGGAGCCUGCACGUGCUGGUCUUCGUCCUGGAGGUGCUGCGCGUUGAACCCGCCGCCUGCAUCCCCACGCAGCCUGACGCGCGGCUCACGGCCUACGUCACCGGGAACCCGGCCCACUACCUCUUCGACUGGACCUUCGGGGAUGGCUCCUCCAACACGACCGUGCGGGGGUGCCCGACGGUGACACACAACUUCACGCGGAGCGGCACGUUCCCCCUGGCGCUGGUGCUGUCCAGCCGCGUGAACAGGGCGCAUUACUUCACCAGCAUCUGCGUGGAGCCAGAGGUGGGCAACGUCACCCUGCAGCCAGAGAGGCAGUUUGUGCAGCUCGGGGACGAGGCCUGGCUGGUGGCAUGUGCCUGGCCCCCGUUCCCCUACCGCUACACCUGGGACUUUGGCACCGAGGAAGCCGCCCCCACCCGUGCCAGGGGCCCUGAGGUGACGUUCAUCUACCGAGACCCAGGCUCCUAUCUUGUGACAGUCACCGCGUCCAACAACAUCUCUGCUGCCAAUGACUCAGCCCUGGUGGAGGUGCAGGAGCCCGUGCUGGUCACCAGCAUCAAGGUCAAUGGCUCCCUUGGGCUGGAGCUGCAGCAGCCGUACCUGUUCUCUGCUGUGGGCCGUGGGCGCCCCGCCAGCUACCUGUGGGAUCUGGGGGACGGUGGGUGGCUCGAGGGUCCGGAGGUCACCCACGCUUACAACAGCACAGGUGACUUCACCGUUAGGGUGGCCGGCUGGAAUGAGGUGAGCCGCAGCGAGGCCUGGCUCAAUGUGACGGUGAAGCGGCGCGUGCGGGGGCUCGUCGUCAAUGCAAGCCGCACGGUGGUGCCCCUGAAUGGGAGCGUGAGCUUCAGCACGUCGCUGGAGGCCGGCAGUGAUGUGCGCUAUUCCUGGGUGCUCUGUGACCGCUGCACGCCCAUCCCUGGGGGUCCUACCAUCUCUUACACCUUCCGCUCCGUGGGCACCUUCAAUAUCAUCGUCACGGCUGAGAACGAGGUGGGCUCCGCCCAGGACAGCAUCUUCGUCUAUGUCCUGCAGCUCAUAGAGGGGCUGCAGGUGGUGGGCGGUGGCCGCUACUUCCCCACCAACCACACGGUACAGCUGCAGGCCGUGGUUAGGGAUGGCACCAACGUCUCCUACAGCUGGACUGCCUGGAGGGACAGGGGCCCGGCCCUGGCCGGCAGCGGCAAAGGCUUCUCGCUCACCGUGCUCGAGGCCGGCACCUACCAUGUGCAGCUGCGGGCCACCAACAUGCUGGGCAGCGCCUGGGCCGACUGCACCAUGGACUUCGUGGAGCCUGUGGGGUGGCUGAUGGUGGCCGCCUCCCCGAACCCAGCUGCCGUCAACACAAGCGUCACCCUCAGUGCCGAGCUGGCUGGUGGCAGUGGUGUCGUAUACACUUGGUCCUUGGAGGAGGGGCUGAGCUGGGAGACCUCCGAGCCAUUUACCACCCAUAGCUUCCCCACACCCGGCCUGCACUUGGUCACCAUGACGGCAGGGAACCCGCUGGGCUCAGCCAACGCCACCGUGGAAGUGGAUGUGCAGGUGCCUGUGAGUGGCCUCAGCAUCAGGGCCAGCGAGCCCGGAGGCAGCUUCGUGGCGGCCGGGUCCUCUGUGCCCUUUUGGGGGCAGCUGGCCACGGGCACCAAUGUGAGCUGGUGCUGGGCUGUGCCCGGCGGCAGCAGCAAGCGUGGCCCUCAUGUCACCAUGGUCUUCCCGGAUGCUGGCACCUUCUCCAUCCGGCUCAAUGCCUCCAACGCAGUCAGCUGGGUCUCAGCCACGUACAACCUCACGGCGGAGGAGCCCAUCGUGGGCCUGGUGCUGUGGGCCAGCAGCAAGGUGGUGGCGCCCGGGCAGCUGGUCCAUUUUCAGAUCCUGCUGGCUGCCGGCUCAGCUGUCACCUUCCGCCUGCAGGUCGGCGGGGCCAACCCCGAGGUGCUCCCCGGGCCCCGUUUCUCCCACAGCUUCCCCCGCGUCGGAGACCACGUGGUGAGCGUGCGGGGCAAAAACCACGUGAGCUGGGCCCAGGCGCAGGUGCGCAUCGUGGUGCUGGAGGCCGUGAGUGGGCUGCAGGUGCCCAACUGCUGCGAGCCUGGCAUCGCCACGGGCACUGAGAGGAACUUCACAGCCCGCGUGCAGCGCGGCUCUCGGGUCGCCUACGCCUGGUACUUCUCGCUGCAGAAGGUCCAGGGCGACUCGCUGGUCAUCCUGUCGGGCCGCGACGUCACCUACACGCCCGUGGCCGCGGGGCUGUUGGAGAUCCAGGUGCGCGCCUUCAACGCCCUGGGCAGUGAGAACCGCACGCUGGUGCUGGAGGUUCAGGACGCCGUCCAGUAUGUGGCCCUGCAGAGCGGCCCCUGCUUCACCAACCGCUCGGCGCAGUUUGAGGCCGCCACCAGCCCCAGCCCCCGGCGUGUGGCCUACCACUGGGACUUUGGGGAUGGGUCGCCAGGGCAGGACACAGAUGAGCCCAGGGCCGAGCACUCCUACCUGAGGCCUGGGGACUACCGCGUGCAGGUGAACGCCUCCAACCUGGUGAGCUUCUUCGUGGCGCAGGCCACGGUGACCGUCCAGGUGCUGGCCUGCCGGGAGCCGGAGGUGGACGUGGUCCUGCCCCUGCAGGUGCUGAUGCGGCGAUCACAGCGCAACUACUUGGAGGCCCACGUUGACCUGCGCGACUGCGUCACCUACCAGACUGAGUACCGCUGGGAGGUGUAUCGCACCGCCAGCUGCCAGCGGCCGGGGCGCCCAGCGCGUGUGGCCCUGCCCGGCGUGGACGUGAGCCGGCCUCGGCUGGUGCUGCCGCGGCUGGCGCUGCCUGUGGGGCACUACUGCUUUGUGUUUGUCGUGUCAUUUGGGGACACGCCACUGACACAGAGCAUCCAGGCCAAUGUGACGGUGGCCCCCGAGCGCCUGGUGCCCAUCAUUGAGGGUGGCUCAUACCGCGUGUGGUCAGACACACGGGACCUGGUGCUGGAUGGGAGCGAGUCCUACGACCCCAACCUGGAGGACGGCGACCAGACGCCGCUCAGUUUCCACUGGGCCUGUGUGGCUUCGACACAGAGGGAGGCUGGCGGGUGUGCGCUGAACUUUGGGCCCCGCGGGAGCAGCACGGUCACCAUUCCACGGGAGCGGCUGGCGGCUGGCGUGGAGUACACCUUCAGCCUGACCGUGUGGAAGGCCGGCCGCAAGGAGGAGGCCACCAACCAGACGGUGCUGAUCCGGAGUGGCCGGGUGCCCAUUGUGUCCUUGGAGUGUGUGUCCUGCAAGGCACAGGCCGUGUACGAAGUGAGCCGCAGCUCCUACGUGUACUUGGAGGGCCGCUGCCUCAAUUGCAGCAGCGGCUCCAAGCGAGGGCGGUGGGCUGCACGUACGUUCAGCAACAAGACGCUGGUGCUGGAUGAGACCACCACAUCCACGGGCAGUGCAGGCAUGCGACUGGUGCUGCGGCGGGGCGUGCUGCGGGACGGCGAGGGAUACACCUUCACGCUCACGGUGCUGGGCCGCUCUGGCGAGGAGGAGGGCUGCGCCUCCAUCCGCCUGUCCCCCAACCGCCCGCCGCUGGGGGGCUCUUGCCGCCUCUUCCCACUGGGCGCUGUGCACGCCCUCACCACCAAGGUGCACUUCGAAUGCACGGGCUGGCAUGACGCGGAGGAUGCUGGCGCCCCGCUGGUGUACGCCCUGCUGCUGCGGCGCUGUCGCCAGGGCCACUGCGAGGAGUUCUGUGUCUACAAGGGCAGCCUCUCCAGCUACGGAGCCGUGCUGCCCCCGGGUUUCAGGCCACACUUCGAGGUGGGCCUGGCCGUGGUGGUGCAGGACCAGCUGGGAGCCGCUGUGGUCGCCCUCAACAGGUCUUUGGCCAUCACCCUCCCAGAGCCCAACGGCAGCGCAACGGGGCUCACAGUCUGGCUGCACGGGCUCACCGCUAGUGUGCUCCCAGGGCUGCUGCGGCAGGCCGAUCCCCAGCACGUCAUCGAGUACUCGUUGGCCCUGGUCACCGUGCUGAACGAGUACGAGCGGGCCCUGGACGUGGCGGCAGAGCCCAAGCACGAGCGGCAGCACCGAGCCCAGAUACGCAAGAACAUCACGGAGACUCUGGUGUCCCUGAGGGUCCACACUGUGGAUGACAUCCAGCAGAUCGCUGCUGCGCUGGCCCAGUGCAUGGGGCCCAGCAGGGAGCUCGUAUGCCGCUCGUGCCUGAAGCAGACGCUGCACAAGCUGGAGGCCAUGAUGCUCAUCCUGCAGGCAGAGACCACCGCGGGCACCGUGACGCCCACCGCCAUCGGAGACAGCAUCCUCAACAUCACAGGAGACCUCAUCCACCUGGCCAGCUCGGACGUGCGGGCACCACAGCCCUCAGAGCUGGGAGCCGAGUCACCAUCUCGGAUGGUGGCGUCCCAGGCCUACAACCUGACCUCUGCCCUCAUGCGCAUCCUCAUGCGCUCCCGCGUGCUCAACGAGGAGCCCCUGACGCUGGCGGGCGAGGAGAUCGUGGCCCAGGGCAAGCGCUCGGACCCGCGGAGCCUGCUGUGCUAUGGCGGCGCCCCAGGGCCUGGCUGCCACUUCUCCAUCCCCGAGGCUUUCAGCGGGGCCCUGGCCAACCUCAGUGACGUGGUGCAGCUCAUCUUUCUGGUGGACUCCAAUCCCUUUCCCUUUGGCUAUAUCAGCAACUACACCGUCUCCACCAAGGUGGCCUCGAUGGCAUUCCAGACACAGGCCGGCGCCCAGAUCCCCAUCGAGCGGCUGGCCUCAGAGCGCGCCAUCACCGUGAAGGUGCCCAACAACUCGGACUGGGCUGCCCGGGGCCACCGCAGCUCCGCCAACUCCGCCAACUCCGUUGUGGUCCAGCCCCAGGCCUCCGUCGGUGCUGUGGUCACCCUGGACAGCAGCAACCCUGCGGCCGGGCUGCAUCUGCAGCUCAACUAUACGCUGCUGGACGGCCACUACCUGUCUGAGGAACCUGAGCCCUACCUGGCAGUCUACCUACACUCGGAGCCCCGGCCCAAUGAGCACAACUGCUCGGCUAGCAGGAGGAUCCGCCCAGAGUCACUCCAGGGUGCUGACCACCGGCCCUACACCUUCUUCAUUUCCCCGGGGAGCAGAGACCCAGCGGGGAGUUACCAUCUGAACCUCUCCAGCCACUUCCGCUGGUCGGCGCUGCAGGUGUCCGUGGGCCUGUACACGUCCCUGUGCCAGUACUUCAGCGAGGAGGACAUGGUGUGGCGGACAGAGGGGCUGCUGCCCCUGGAGGAGACCUCGCCCCGCCAGGCCGUCUGCCUCACCCGCCACCUCACCGCCUUCGGCGCCAGCCUCUUCGUGCCCCCAAGCCAUGUCCGCUUUGUGUUUCCUGAGCCGACAGCGGAUGUAAACUACAUCGUCAUGCUGACAUGUGCUGUGUGCCUGGUGACCUACAUGGUCAUGGCCGCCAUCCUGCACAAGCUGGACCAGUUGGAUGCCAGCCGGGGCCGCGCCAUCCCUUUCUGUGGGCAGCGGGGCCGCUUCAAGUACGAGAUCCUCGUCAAGACAGGCUGGGGCCGGGGCUCAGGUACCACGGCCCACGUGGGCAUCAUGCUGUAUGGGGUGGACAGCCGGAGCGGCCACCGGCACCUGGACGGCGACAGAGCCUUCCACCGCAACAGCCUGGACAUCUUCCGGAUCGCCACCCCGCACAGCCUGGGUAGCGUGUGGAAGAUCCGAGUGUGGCACGACAACAAAGGGCUCAGCCCUGCCUGGUUCCUGCAGCACGUCAUCGUCAGGGACCUGCAGACGGCACGCAGCGCCUUCUUCCUGGUCAAUGACUGGCUUUCGGUGGAGACGGAGGCCAACGGGGGCCUGGUGGAGAAGGAGGUGCUGGCCGCGAGCGACGCAGCCCUUUUGCGCUUCCGGCGCCUGCUGGUGGCUGAGCUGCAGCGUGGCUUCUUUGACAAGCACAUCUGGCUCUCCAUAUGGGACCGGCCGCCUCGUAGCCGUUUCACUCGCAUCCAGAGGGCCACCUGCUGCGUUCUCCUCAUCUGCCUCUUCCUGGGCGCCAACGCCGUGUGGUACGGGGCUGUUGGCGACUCUGCCUACAGCACGGGGCAUGUGUCCAGGCUGAGCCCGCUGAGCGUCGACACAGUCGCUGUUGGCCUGGUGUCCAGCGUGGUUGUCUAUCCCGUCUACCUGGCCAUCCUUUUUCUCUUCCGGAUGUCCCGGAGCAAGGUGGCUGGGAGCCCGAGCCCCACACCUGCCGGGCAGCAGGUGCUGGACAUCGACAGCUGCCUGGACUCGUCCGUGCUGGACAGCUCCUUCCUCACGUUCUCAGGCCUCCACGCUGAGCAGGCCUUUGUUGGACAGAUGAAGAGUGACUUGUUUCUGGAUGAUUCUAAGAGUCUGGUGUGCUGGCCCUCCGGCGAGGGAACGCUCAGUUGGCCGGACCUGCUCAGUGACCCGUCCAUUGUGGGUAGCAAUCUGCGGCAGCUGGCACGGGGCCAGGCGGGCCAUGGGCUGGGCCCAGAGGAGGACGGCUUCUCCCUGGCCAGCCCCUACUCGCCUGCCAAAUCCUUCUCAGCAUCAGAUGAAGACCUGAUCCAGCAGGUCCUUGCCGAGGGGGUCAGCAGCCCAGCCCCUACCCAAGACACCCACAUGGAAACGGACCUGCUCAGCAGCCUGUCCAGCACUCCUGGGGAGAAGACAGAGACGCUGGCGCUGCAGAGGCUGGGGGAGCUGGGGCCACCCAGCCCAGGCCUGAACUGGGAACAGCCCCAGGCAGCGAGGCUGUCCAGGACAGGACUGGUGGAGGGUCUGCGGAAGCGCCUGCUGCCGGCCUGGUGUGCCUCCCUGGCCCACGGGCUCAGCCUGCUCCUGGUGGCUGUGGCUGUGGCUGUCUCAGGGUGGGUGGGUGCGAGCUUCCCCCCGGGCGUGAGUGUUGCGUGGCUCCUGUCCAGCAGCGCCAGCUUCCUGGCCUCAUUCCUCGGCUGGGAGCCACUGAAGGUCUUGCUGGAAGCCCUGUACUUCUCACUGGUGGCCAAGCGGCUGCACCCGGAUGAAGAUGACACCCUGGUAGAGAGCCCGGCUGUGACGCCUGUGAGCGCACGUGUGCCCCGCGUACGGCCACCCCACGGCUUUGCACUCUUCCUGGCCAAGGAAGAAGCCCGCAAGGUCAAGAGGCUACAUGGCAUGCUGCGGAGCCUCCUGGUGUACAUGCUUUUUCUGCUGGUGACCCUGCUGGCCAGCUAUGGGGAUGCCUCAUGCCAUGGGCACGCCUACCGUCUGCAAAGCGCCAUCAAGCAGGAGCUGCACAGCCGGGCCUUCCUGGCCAUCACGCGGUCUGAGGAGCUCUGGCCAUGGAUGGCCCACGUGCUGCUGCCCUACGUCCACGGGAACCAGUCCAGCCCAGAGCUGGGGCCCCCACGGCUGCGGCAGGUGCGGCUGCAGGAAGCACUCUACCCAGACCCUCCCGGCCCCAGGGUCCACACGUGCUCGGCCGCAGGAGGCUUCAGCACCAGCGAUUACGACGUUGGCUGGGAGAGUCCUCACAAUGGCUCGGGGACGUGGGCCUAUUCAGCGCCGGAUCUGCUGGGGGCAUGGUCCUGGGGCUCCUGUGCCGUGUAUGACAGCGGGGGCUACGUGCAGGAGCUGGGCCUGAGCCUGGAGGAGAGCCGCGACCGGCUGCGCUUCCUGCAGCUGCACAACUGGCUGGACAACAGGAGCCGCGCUGUGUUCCUGGAGCUCACGCGCUACAGCCCGGCCGUGGGGCUGCACGCCGCCGUCACGCUGCGCCUCGAGUUCCCGGCGGCCGGCCGCGCCCUGGCCGCCCUCAGCGUCCGCCCCUUUGCGCUGCGCCGCCUCAGCGCGGGCCUCUCGCUGCCUCUGCUCACCUCGGUGUGCCUGCUGCUGUUCGCCGUGCACUUCGCCGUGGCCGAGGCCCGUACUUGGCACAGGGAAGGGCGCUGGCGCGUGCUGCGGCUCGGAGCCUGGGCGCGGUGGCUGCUGGUGGCGCUGACGGCGGCCACGGCACUGGUACGCCUCGCCCAGCUGGGUGCCGCUGACCGCCAGUGGACCCGUUUCGUGCGCGGCCGCCCGCGCCGCUUCACUAGCUUCGACCAGGUGGCGCAGCUGAGCUCCGCAGCCCGUGGCCUGGCGGCCUCGCUGCUCUUCCUGCUUUUGGUCAAGGCUGCCCAGCAGCUACGCUUCGUGCGCCAGUGGUCCGUCUUUGGCAAGACAUUAUGCCGAGCUCUGCCAGAGCUCCUGGGGGUCACCUUGGGCCUGGUGGUGCUCGGGGUAGCCUACGCCCAGCUGGCCAUCCUGCUCGUGUCUUCCUGUGUGGACUCCCUCUGGAGCGUGGCCCAGGCCCUGUUGGUGCUGUGCCCUGGGACUGGGCUCUCUACCCUGUGUCCUGCCGAGUCCUGGCACCUGUCACCCCUGCUGUGUGUGGGGCUCUGGGCACUGCGGCUGUGGGGCGCCCUACGGCUGGGGGCUGUUAUUCUCCGCUGGCGCUACCACGCCUUGCGUGGAGAGCUGUACCGGCCGGCCUGGGAGCCCCAGGACUACGAGAUGGUGGAGUUGUUCCUGCGCAGGCUGCGCCUCUGGAUGGGCCUCAGCAAGGUCAAGGAGUUCCGCCACAAAGUCCGCUUUGAAGGGAUGGAGCCGCUGCCCUCUCGCUCCUCCAGGGGCUCCAAGGUAUCCCCGGAUGUGCCCCCACCCAGCGCUGGCUCCGAUGCCUCGCACCCCUCCACCUCCUCCAGCCAGCUGGAUGGGCUGAGCGUGAGCCUGGGCCGGCUGGGGACAAGGUGUGAGCCUGAGCCCUCCCGCCUCCAAGCCGUGUUCGAGGCCCUGCUCACCCAGUUUGACCGACUCAACCAGGCCACAGAGGACGUCUACCAGCUGGAGCAGCAGCUGCACAGCCUGCAAGGCCGCAGGAGCAGCCGGGCGCCCGCCGGAUCUUCCCGUGGCCCAUCCCCGGGCCUGCGGCCAGCACUGCCCAGCCGCCUUGCCCGGGCCAGUCGGGGUGUGGACCUGGCCACUGGCCCCAGCAGGACACCCCUUCGGGCCAAGAACAAGGUCCACCCCAGCAGCACUUAGUCCUCCUUCCUGGCGGGGGUGGGCCGUGGAGUCGGAGUGGACACCGCUCAGUAUUACUUUCUGCCGCUGUCAAGGCCGAGGGCCAGGCAGAAUGGCUGCACGUAGGUUCCCCAGAGAGCAGGCAGGGGCAUCUGUCUGUCUGUGGGCUUCAGCACUUUAAAGAGGCUGUGUGGCCAACCAGGACCCAGGGUCCCCUCCCCAGCUCCCUUGGGAAGGACACAGCAGUAUUGGACGGUUUCUAGCCUCUGAGAUGCUAAUUUAUUUCCCCGAGUCCUCAGGUACAGCGGGCUGUGCCCGGCCCCACCCCCUGGGCAGAUGUCCCCCACUGCUAAGGCUGCUGGCUUCAGGGAGGGUUAGCCUGCACCGCCGCCACCCUGCCCCUAAGUUAUUACCUCUCCAGUUCCUACCGUACUCCCUGCACCGUCUCACUGUGUGUCUCGUGUCAGUAAUUUAUAUGGUGUUAAAAUGUGUAUAUUUUUGUAUGUCACUAUUUUCACUAGGGCUGAGGGGCCUGCGCCCAGAGCUGGCCUCCCCCAACACCUGCUGCGCUUGGUAGGUGUGGUGGCGUUAUGGCAGCCCGGCUGCUGCUUGGAUGCGAGCUUGGCCUUGGGCCGGUGCUGGGGGCACAGCUGUCUGCCAGGCACUCUCAUCACCCCAGAGGCCUUGUCAUCCUCCCUUGCCCCAGGCCAGGUAGCAAGAGAGCAGCGCCCAGGCCUGCUGGCAUCAGGUCUGGGCAAGUAGCAGGACUAGGCAUGUCAGAGGACCCCAGGGUGGUUAGAGGAAAAGACUCCUCCUGGGGGCUGGCUCCCAGGGUGGAGGAAGGUGACUGUGUGUGUGUGUGUGUGCGCGCGCGCACGCGCGAGUGUGCUGUAUGGCCCAGGCAGCCUCAAGGCCCUCGGAGCUGGCUGUGCCUGCUUCUGUGUACCACUUCUGUGGGCAUGGCCGCUUCUAGAGCCUCGACACCCCCCCAACCCCCGCACCAAGCAGACAAAGUCAAUAAAAGAGCUGUCUGACUGCAA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 5310)
polycystin 1, transient receptor potential channel interacting
strand -
PBP, Pc-1, TRPP1
NCBI CDS gene sequence (12912 bp)
5'-ATGCCGCCCGCCGCGCCCGCCCGCCTGGCGCTGGCCCTGGGCCTGGGCCTGTGGCTCGGGGCGCTGGCGGGGGGCCCCGGGCGCGGCTGCGGGCCCTGCGAGCCCCCCTGCCTCTGCGGCCCAGCGCCCGGCGCCGCCTGCCGCGTCAACTGCTCGGGCCGCGGGCTGCGGACGCTCGGTCCCGCGCTGCGCATCCCCGCGGACGCCACAGCGCTAGACGTCTCCCACAACCTGCTCCGGGCGCTGGACGTTGGGCTCCTGGCGAACCTCTCGGCGCTGGCAGAGCTGGATATAAGCAACAACAAGATTTCTACGTTAGAAGAAGGAATATTTGCTAATTTATTTAATTTAAGTGAAATAAACCTGAGTGGGAACCCGTTTGAGTGTGACTGTGGCCTGGCGTGGCTGCCGCGATGGGCGGAGGAGCAGCAGGTGCGGGTGGTGCAGCCCGAGGCAGCCACGTGTGCTGGGCCTGGCTCCCTGGCTGGCCAGCCTCTGCTTGGCATCCCCTTGCTGGACAGTGGCTGTGGTGAGGAGTATGTCGCCTGCCTCCCTGACAACAGCTCAGGCACCGTGGCAGCAGTGTCCTTTTCAGCTGCCCACGAAGGCCTGCTTCAGCCAGAGGCCTGCAGCGCCTTCTGCTTCTCCACCGGCCAGGGCCTCGCAGCCCTCTCGGAGCAGGGCTGGTGCCTGTGTGGGGCGGCCCAGCCCTCCAGTGCCTCCTTTGCCTGCCTGTCCCTCTGCTCCGGCCCCCCGCCACCTCCTGCCCCCACCTGTAGGGGCCCCACCCTCCTCCAGCACGTCTTCCCTGCCTCCCCAGGGGCCACCCTGGTGGGGCCCCACGGACCTCTGGCCTCTGGCCAGCTAGCAGCCTTCCACATCGCTGCCCCGCTCCCTGTCACTGCCACACGCTGGGACTTCGGAGACGGCTCCGCCGAGGTGGATGCCGCTGGGCCGGCTGCCTCGCATCGCTATGTGCTGCCTGGGCGCTATCACGTGACGGCCGTGCTGGCCCTGGGGGCCGGCTCAGCCCTGCTGGGGACAGACGTGCAGGTGGAAGCGGCACCTGCCGCCCTGGAGCTCGTGTGCCCGTCCTCGGTGCAGAGTGACGAGAGCCTCGACCTCAGCATCCAGAACCGCGGTGGTTCAGGCCTGGAGGCCGCCTACAGCATCGTGGCCCTGGGCGAGGAGCCGGCCCGAGCGGTGCACCCGCTCTGCCCCTCGGACACGGAGATCTTCCCTGGCAACGGGCACTGCTACCGCCTGGTGGTGGAGAAGGCGGCCTGGCTGCAGGCGCAGGAGCAGTGTCAGGCCTGGGCCGGGGCCGCCCTGGCAATGGTGGACAGTCCCGCCGTGCAGCGCTTCCTGGTCTCCCGGGTCACCAGGAGCCTAGACGTGTGGATCGGCTTCTCGACTGTGCAGGGGGTGGAGGTGGGCCCAGCGCCGCAGGGCGAGGCCTTCAGCCTGGAGAGCTGCCAGAACTGGCTGCCCGGGGAGCCACACCCAGCCACAGCCGAGCACTGCGTCCGGCTCGGGCCCACCGGGTGGTGTAACACCGACCTGTGCTCAGCGCCGCACAGCTACGTCTGCGAGCTGCAGCCCGGAGGCCCAGTGCAGGATGCCGAGAACCTCCTCGTGGGAGCGCCCAGTGGGGACCTGCAGGGACCCCTGACGCCTCTGGCACAGCAGGACGGCCTCTCAGCCCCGCACGAGCCCGTGGAGGTCATGGTATTCCCGGGCCTGCGTCTGAGCCGTGAAGCCTTCCTCACCACGGCCGAATTTGGGACCCAGGAGCTCCGGCGGCCCGCCCAGCTGCGGCTGCAGGTGTACCGGCTCCTCAGCACAGCAGGGACCCCGGAGAACGGCAGCGAGCCTGAGAGCAGGTCCCCGGACAACAGGACCCAGCTGGCCCCCGCGTGCATGCCAGGGGGACGCTGGTGCCCTGGAGCCAACATCTGCTTGCCGCTGGACGCCTCCTGCCACCCCCAGGCCTGCGCCAATGGCTGCACGTCAGGGCCAGGGCTACCCGGGGCCCCCTATGCGCTATGGAGAGAGTTCCTCTTCTCCGTTCCCGCGGGGCCCCCCGCGCAGTACTCGGTCACCCTCCACGGCCAGGATGTCCTCATGCTCCCTGGTGACCTCGTTGGCTTGCAGCACGACGCTGGCCCTGGCGCCCTCCTGCACTGCTCGCCGGCTCCCGGCCACCCTGGTCCCCGGGCCCCGTACCTCTCCGCCAACGCCTCGTCATGGCTGCCCCACTTGCCAGCCCAGCTGGAGGGCACTTGGGCCTGCCCTGCCTGTGCCCTGCGGCTGCTTGCAGCCACGGAACAGCTCACCGTGCTGCTGGGCTTGAGGCCCAACCCTGGACTGCGGCTGCCTGGGCGCTATGAGGTCCGGGCAGAGGTGGGCAATGGCGTGTCCAGGCACAACCTCTCCTGCAGCTTTGACGTGGTCTCCCCAGTGGCTGGGCTGCGGGTCATCTACCCTGCCCCCCGCGACGGCCGCCTCTACGTGCCCACCAACGGCTCAGCCTTGGTGCTCCAGGTGGACTCTGGTGCCAACGCCACGGCCACGGCTCGCTGGCCTGGGGGCAGTGTCAGCGCCCGCTTTGAGAATGTCTGCCCTGCCCTGGTGGCCACCTTCGTGCCCGGCTGCCCCTGGGAGACCAACGATACCCTGTTCTCAGTGGTAGCACTGCCGTGGCTCAGTGAGGGGGAGCACGTGGTGGACGTGGTGGTGGAAAACAGCGCCAGCCGGGCCAACCTCAGCCTGCGGGTGACGGCGGAGGAGCCCATCTGTGGCCTCCGCGCCACGCCCAGCCCCGAGGCCCGTGTACTGCAGGGAGTCCTAGTGAGGTACAGCCCCGTGGTGGAGGCCGGCTCGGACATGGTCTTCCGGTGGACCATCAACGACAAGCAGTCCCTGACCTTCCAGAACGTGGTCTTCAATGTCATTTATCAGAGCGCGGCGGTCTTCAAGCTCTCACTGACGGCCTCCAACCACGTGAGCAACGTCACCGTGAACTACAACGTAACCGTGGAGCGGATGAACAGGATGCAGGGTCTGCAGGTCTCCACAGTGCCGGCCGTGCTGTCCCCCAATGCCACGCTAGCACTGACGGCGGGCGTGCTGGTGGACTCGGCCGTGGAGGTGGCCTTCCTGTGGACCTTTGGGGATGGGGAGCAGGCCCTCCACCAGTTCCAGCCTCCGTACAACGAGTCCTTCCCGGTTCCAGACCCCTCGGTGGCCCAGGTGCTGGTGGAGCACAATGTCATGCACACCTACGCTGCCCCAGGTGAGTACCTCCTGACCGTGCTGGCATCTAATGCCTTCGAGAACCTGACGCAGCAGGTGCCTGTGAGCGTGCGCGCCTCCCTGCCCTCCGTGGCTGTGGGTGTGAGTGACGGCGTCCTGGTGGCCGGCCGGCCCGTCACCTTCTACCCGCACCCGCTGCCCTCGCCTGGGGGTGTTCTTTACACGTGGGACTTCGGGGACGGCTCCCCTGTCCTGACCCAGAGCCAGCCGGCTGCCAACCACACCTATGCCTCGAGGGGCACCTACCACGTGCGCCTGGAGGTCAACAACACGGTGAGCGGTGCGGCGGCCCAGGCGGATGTGCGCGTCTTTGAGGAGCTCCGCGGACTCAGCGTGGACATGAGCCTGGCCGTGGAGCAGGGCGCCCCCGTGGTGGTCAGCGCCGCGGTGCAGACGGGCGACAACATCACGTGGACCTTCGACATGGGGGACGGCACCGTGCTGTCGGGCCCGGAGGCAACAGTGGAGCATGTGTACCTGCGGGCACAGAACTGCACAGTGACCGTGGGTGCGGCCAGCCCCGCCGGCCACCTGGCCCGGAGCCTGCACGTGCTGGTCTTCGTCCTGGAGGTGCTGCGCGTTGAACCCGCCGCCTGCATCCCCACGCAGCCTGACGCGCGGCTCACGGCCTACGTCACCGGGAACCCGGCCCACTACCTCTTCGACTGGACCTTCGGGGATGGCTCCTCCAACACGACCGTGCGGGGGTGCCCGACGGTGACACACAACTTCACGCGGAGCGGCACGTTCCCCCTGGCGCTGGTGCTGTCCAGCCGCGTGAACAGGGCGCATTACTTCACCAGCATCTGCGTGGAGCCAGAGGTGGGCAACGTCACCCTGCAGCCAGAGAGGCAGTTTGTGCAGCTCGGGGACGAGGCCTGGCTGGTGGCATGTGCCTGGCCCCCGTTCCCCTACCGCTACACCTGGGACTTTGGCACCGAGGAAGCCGCCCCCACCCGTGCCAGGGGCCCTGAGGTGACGTTCATCTACCGAGACCCAGGCTCCTATCTTGTGACAGTCACCGCGTCCAACAACATCTCTGCTGCCAATGACTCAGCCCTGGTGGAGGTGCAGGAGCCCGTGCTGGTCACCAGCATCAAGGTCAATGGCTCCCTTGGGCTGGAGCTGCAGCAGCCGTACCTGTTCTCTGCTGTGGGCCGTGGGCGCCCCGCCAGCTACCTGTGGGATCTGGGGGACGGTGGGTGGCTCGAGGGTCCGGAGGTCACCCACGCTTACAACAGCACAGGTGACTTCACCGTTAGGGTGGCCGGCTGGAATGAGGTGAGCCGCAGCGAGGCCTGGCTCAATGTGACGGTGAAGCGGCGCGTGCGGGGGCTCGTCGTCAATGCAAGCCGCACGGTGGTGCCCCTGAATGGGAGCGTGAGCTTCAGCACGTCGCTGGAGGCCGGCAGTGATGTGCGCTATTCCTGGGTGCTCTGTGACCGCTGCACGCCCATCCCTGGGGGTCCTACCATCTCTTACACCTTCCGCTCCGTGGGCACCTTCAATATCATCGTCACGGCTGAGAACGAGGTGGGCTCCGCCCAGGACAGCATCTTCGTCTATGTCCTGCAGCTCATAGAGGGGCTGCAGGTGGTGGGCGGTGGCCGCTACTTCCCCACCAACCACACGGTACAGCTGCAGGCCGTGGTTAGGGATGGCACCAACGTCTCCTACAGCTGGACTGCCTGGAGGGACAGGGGCCCGGCCCTGGCCGGCAGCGGCAAAGGCTTCTCGCTCACCGTGCTCGAGGCCGGCACCTACCATGTGCAGCTGCGGGCCACCAACATGCTGGGCAGCGCCTGGGCCGACTGCACCATGGACTTCGTGGAGCCTGTGGGGTGGCTGATGGTGGCCGCCTCCCCGAACCCAGCTGCCGTCAACACAAGCGTCACCCTCAGTGCCGAGCTGGCTGGTGGCAGTGGTGTCGTATACACTTGGTCCTTGGAGGAGGGGCTGAGCTGGGAGACCTCCGAGCCATTTACCACCCATAGCTTCCCCACACCCGGCCTGCACTTGGTCACCATGACGGCAGGGAACCCGCTGGGCTCAGCCAACGCCACCGTGGAAGTGGATGTGCAGGTGCCTGTGAGTGGCCTCAGCATCAGGGCCAGCGAGCCCGGAGGCAGCTTCGTGGCGGCCGGGTCCTCTGTGCCCTTTTGGGGGCAGCTGGCCACGGGCACCAATGTGAGCTGGTGCTGGGCTGTGCCCGGCGGCAGCAGCAAGCGTGGCCCTCATGTCACCATGGTCTTCCCGGATGCTGGCACCTTCTCCATCCGGCTCAATGCCTCCAACGCAGTCAGCTGGGTCTCAGCCACGTACAACCTCACGGCGGAGGAGCCCATCGTGGGCCTGGTGCTGTGGGCCAGCAGCAAGGTGGTGGCGCCCGGGCAGCTGGTCCATTTTCAGATCCTGCTGGCTGCCGGCTCAGCTGTCACCTTCCGCCTGCAGGTCGGCGGGGCCAACCCCGAGGTGCTCCCCGGGCCCCGTTTCTCCCACAGCTTCCCCCGCGTCGGAGACCACGTGGTGAGCGTGCGGGGCAAAAACCACGTGAGCTGGGCCCAGGCGCAGGTGCGCATCGTGGTGCTGGAGGCCGTGAGTGGGCTGCAGGTGCCCAACTGCTGCGAGCCTGGCATCGCCACGGGCACTGAGAGGAACTTCACAGCCCGCGTGCAGCGCGGCTCTCGGGTCGCCTACGCCTGGTACTTCTCGCTGCAGAAGGTCCAGGGCGACTCGCTGGTCATCCTGTCGGGCCGCGACGTCACCTACACGCCCGTGGCCGCGGGGCTGTTGGAGATCCAGGTGCGCGCCTTCAACGCCCTGGGCAGTGAGAACCGCACGCTGGTGCTGGAGGTTCAGGACGCCGTCCAGTATGTGGCCCTGCAGAGCGGCCCCTGCTTCACCAACCGCTCGGCGCAGTTTGAGGCCGCCACCAGCCCCAGCCCCCGGCGTGTGGCCTACCACTGGGACTTTGGGGATGGGTCGCCAGGGCAGGACACAGATGAGCCCAGGGCCGAGCACTCCTACCTGAGGCCTGGGGACTACCGCGTGCAGGTGAACGCCTCCAACCTGGTGAGCTTCTTCGTGGCGCAGGCCACGGTGACCGTCCAGGTGCTGGCCTGCCGGGAGCCGGAGGTGGACGTGGTCCTGCCCCTGCAGGTGCTGATGCGGCGATCACAGCGCAACTACTTGGAGGCCCACGTTGACCTGCGCGACTGCGTCACCTACCAGACTGAGTACCGCTGGGAGGTGTATCGCACCGCCAGCTGCCAGCGGCCGGGGCGCCCAGCGCGTGTGGCCCTGCCCGGCGTGGACGTGAGCCGGCCTCGGCTGGTGCTGCCGCGGCTGGCGCTGCCTGTGGGGCACTACTGCTTTGTGTTTGTCGTGTCATTTGGGGACACGCCACTGACACAGAGCATCCAGGCCAATGTGACGGTGGCCCCCGAGCGCCTGGTGCCCATCATTGAGGGTGGCTCATACCGCGTGTGGTCAGACACACGGGACCTGGTGCTGGATGGGAGCGAGTCCTACGACCCCAACCTGGAGGACGGCGACCAGACGCCGCTCAGTTTCCACTGGGCCTGTGTGGCTTCGACACAGAGGGAGGCTGGCGGGTGTGCGCTGAACTTTGGGCCCCGCGGGAGCAGCACGGTCACCATTCCACGGGAGCGGCTGGCGGCTGGCGTGGAGTACACCTTCAGCCTGACCGTGTGGAAGGCCGGCCGCAAGGAGGAGGCCACCAACCAGACGGTGCTGATCCGGAGTGGCCGGGTGCCCATTGTGTCCTTGGAGTGTGTGTCCTGCAAGGCACAGGCCGTGTACGAAGTGAGCCGCAGCTCCTACGTGTACTTGGAGGGCCGCTGCCTCAATTGCAGCAGCGGCTCCAAGCGAGGGCGGTGGGCTGCACGTACGTTCAGCAACAAGACGCTGGTGCTGGATGAGACCACCACATCCACGGGCAGTGCAGGCATGCGACTGGTGCTGCGGCGGGGCGTGCTGCGGGACGGCGAGGGATACACCTTCACGCTCACGGTGCTGGGCCGCTCTGGCGAGGAGGAGGGCTGCGCCTCCATCCGCCTGTCCCCCAACCGCCCGCCGCTGGGGGGCTCTTGCCGCCTCTTCCCACTGGGCGCTGTGCACGCCCTCACCACCAAGGTGCACTTCGAATGCACGGGCTGGCATGACGCGGAGGATGCTGGCGCCCCGCTGGTGTACGCCCTGCTGCTGCGGCGCTGTCGCCAGGGCCACTGCGAGGAGTTCTGTGTCTACAAGGGCAGCCTCTCCAGCTACGGAGCCGTGCTGCCCCCGGGTTTCAGGCCACACTTCGAGGTGGGCCTGGCCGTGGTGGTGCAGGACCAGCTGGGAGCCGCTGTGGTCGCCCTCAACAGGTCTTTGGCCATCACCCTCCCAGAGCCCAACGGCAGCGCAACGGGGCTCACAGTCTGGCTGCACGGGCTCACCGCTAGTGTGCTCCCAGGGCTGCTGCGGCAGGCCGATCCCCAGCACGTCATCGAGTACTCGTTGGCCCTGGTCACCGTGCTGAACGAGTACGAGCGGGCCCTGGACGTGGCGGCAGAGCCCAAGCACGAGCGGCAGCACCGAGCCCAGATACGCAAGAACATCACGGAGACTCTGGTGTCCCTGAGGGTCCACACTGTGGATGACATCCAGCAGATCGCTGCTGCGCTGGCCCAGTGCATGGGGCCCAGCAGGGAGCTCGTATGCCGCTCGTGCCTGAAGCAGACGCTGCACAAGCTGGAGGCCATGATGCTCATCCTGCAGGCAGAGACCACCGCGGGCACCGTGACGCCCACCGCCATCGGAGACAGCATCCTCAACATCACAGGAGACCTCATCCACCTGGCCAGCTCGGACGTGCGGGCACCACAGCCCTCAGAGCTGGGAGCCGAGTCACCATCTCGGATGGTGGCGTCCCAGGCCTACAACCTGACCTCTGCCCTCATGCGCATCCTCATGCGCTCCCGCGTGCTCAACGAGGAGCCCCTGACGCTGGCGGGCGAGGAGATCGTGGCCCAGGGCAAGCGCTCGGACCCGCGGAGCCTGCTGTGCTATGGCGGCGCCCCAGGGCCTGGCTGCCACTTCTCCATCCCCGAGGCTTTCAGCGGGGCCCTGGCCAACCTCAGTGACGTGGTGCAGCTCATCTTTCTGGTGGACTCCAATCCCTTTCCCTTTGGCTATATCAGCAACTACACCGTCTCCACCAAGGTGGCCTCGATGGCATTCCAGACACAGGCCGGCGCCCAGATCCCCATCGAGCGGCTGGCCTCAGAGCGCGCCATCACCGTGAAGGTGCCCAACAACTCGGACTGGGCTGCCCGGGGCCACCGCAGCTCCGCCAACTCCGCCAACTCCGTTGTGGTCCAGCCCCAGGCCTCCGTCGGTGCTGTGGTCACCCTGGACAGCAGCAACCCTGCGGCCGGGCTGCATCTGCAGCTCAACTATACGCTGCTGGACGGCCACTACCTGTCTGAGGAACCTGAGCCCTACCTGGCAGTCTACCTACACTCGGAGCCCCGGCCCAATGAGCACAACTGCTCGGCTAGCAGGAGGATCCGCCCAGAGTCACTCCAGGGTGCTGACCACCGGCCCTACACCTTCTTCATTTCCCCGGGGAGCAGAGACCCAGCGGGGAGTTACCATCTGAACCTCTCCAGCCACTTCCGCTGGTCGGCGCTGCAGGTGTCCGTGGGCCTGTACACGTCCCTGTGCCAGTACTTCAGCGAGGAGGACATGGTGTGGCGGACAGAGGGGCTGCTGCCCCTGGAGGAGACCTCGCCCCGCCAGGCCGTCTGCCTCACCCGCCACCTCACCGCCTTCGGCGCCAGCCTCTTCGTGCCCCCAAGCCATGTCCGCTTTGTGTTTCCTGAGCCGACAGCGGATGTAAACTACATCGTCATGCTGACATGTGCTGTGTGCCTGGTGACCTACATGGTCATGGCCGCCATCCTGCACAAGCTGGACCAGTTGGATGCCAGCCGGGGCCGCGCCATCCCTTTCTGTGGGCAGCGGGGCCGCTTCAAGTACGAGATCCTCGTCAAGACAGGCTGGGGCCGGGGCTCAGGTACCACGGCCCACGTGGGCATCATGCTGTATGGGGTGGACAGCCGGAGCGGCCACCGGCACCTGGACGGCGACAGAGCCTTCCACCGCAACAGCCTGGACATCTTCCGGATCGCCACCCCGCACAGCCTGGGTAGCGTGTGGAAGATCCGAGTGTGGCACGACAACAAAGGGCTCAGCCCTGCCTGGTTCCTGCAGCACGTCATCGTCAGGGACCTGCAGACGGCACGCAGCGCCTTCTTCCTGGTCAATGACTGGCTTTCGGTGGAGACGGAGGCCAACGGGGGCCTGGTGGAGAAGGAGGTGCTGGCCGCGAGCGACGCAGCCCTTTTGCGCTTCCGGCGCCTGCTGGTGGCTGAGCTGCAGCGTGGCTTCTTTGACAAGCACATCTGGCTCTCCATATGGGACCGGCCGCCTCGTAGCCGTTTCACTCGCATCCAGAGGGCCACCTGCTGCGTTCTCCTCATCTGCCTCTTCCTGGGCGCCAACGCCGTGTGGTACGGGGCTGTTGGCGACTCTGCCTACAGCACGGGGCATGTGTCCAGGCTGAGCCCGCTGAGCGTCGACACAGTCGCTGTTGGCCTGGTGTCCAGCGTGGTTGTCTATCCCGTCTACCTGGCCATCCTTTTTCTCTTCCGGATGTCCCGGAGCAAGGTGGCTGGGAGCCCGAGCCCCACACCTGCCGGGCAGCAGGTGCTGGACATCGACAGCTGCCTGGACTCGTCCGTGCTGGACAGCTCCTTCCTCACGTTCTCAGGCCTCCACGCTGAGCAGGCCTTTGTTGGACAGATGAAGAGTGACTTGTTTCTGGATGATTCTAAGAGTCTGGTGTGCTGGCCCTCCGGCGAGGGAACGCTCAGTTGGCCGGACCTGCTCAGTGACCCGTCCATTGTGGGTAGCAATCTGCGGCAGCTGGCACGGGGCCAGGCGGGCCATGGGCTGGGCCCAGAGGAGGACGGCTTCTCCCTGGCCAGCCCCTACTCGCCTGCCAAATCCTTCTCAGCATCAGATGAAGACCTGATCCAGCAGGTCCTTGCCGAGGGGGTCAGCAGCCCAGCCCCTACCCAAGACACCCACATGGAAACGGACCTGCTCAGCAGCCTGTCCAGCACTCCTGGGGAGAAGACAGAGACGCTGGCGCTGCAGAGGCTGGGGGAGCTGGGGCCACCCAGCCCAGGCCTGAACTGGGAACAGCCCCAGGCAGCGAGGCTGTCCAGGACAGGACTGGTGGAGGGTCTGCGGAAGCGCCTGCTGCCGGCCTGGTGTGCCTCCCTGGCCCACGGGCTCAGCCTGCTCCTGGTGGCTGTGGCTGTGGCTGTCTCAGGGTGGGTGGGTGCGAGCTTCCCCCCGGGCGTGAGTGTTGCGTGGCTCCTGTCCAGCAGCGCCAGCTTCCTGGCCTCATTCCTCGGCTGGGAGCCACTGAAGGTCTTGCTGGAAGCCCTGTACTTCTCACTGGTGGCCAAGCGGCTGCACCCGGATGAAGATGACACCCTGGTAGAGAGCCCGGCTGTGACGCCTGTGAGCGCACGTGTGCCCCGCGTACGGCCACCCCACGGCTTTGCACTCTTCCTGGCCAAGGAAGAAGCCCGCAAGGTCAAGAGGCTACATGGCATGCTGCGGAGCCTCCTGGTGTACATGCTTTTTCTGCTGGTGACCCTGCTGGCCAGCTATGGGGATGCCTCATGCCATGGGCACGCCTACCGTCTGCAAAGCGCCATCAAGCAGGAGCTGCACAGCCGGGCCTTCCTGGCCATCACGCGGTCTGAGGAGCTCTGGCCATGGATGGCCCACGTGCTGCTGCCCTACGTCCACGGGAACCAGTCCAGCCCAGAGCTGGGGCCCCCACGGCTGCGGCAGGTGCGGCTGCAGGAAGCACTCTACCCAGACCCTCCCGGCCCCAGGGTCCACACGTGCTCGGCCGCAGGAGGCTTCAGCACCAGCGATTACGACGTTGGCTGGGAGAGTCCTCACAATGGCTCGGGGACGTGGGCCTATTCAGCGCCGGATCTGCTGGGGGCATGGTCCTGGGGCTCCTGTGCCGTGTATGACAGCGGGGGCTACGTGCAGGAGCTGGGCCTGAGCCTGGAGGAGAGCCGCGACCGGCTGCGCTTCCTGCAGCTGCACAACTGGCTGGACAACAGGAGCCGCGCTGTGTTCCTGGAGCTCACGCGCTACAGCCCGGCCGTGGGGCTGCACGCCGCCGTCACGCTGCGCCTCGAGTTCCCGGCGGCCGGCCGCGCCCTGGCCGCCCTCAGCGTCCGCCCCTTTGCGCTGCGCCGCCTCAGCGCGGGCCTCTCGCTGCCTCTGCTCACCTCGGTGTGCCTGCTGCTGTTCGCCGTGCACTTCGCCGTGGCCGAGGCCCGTACTTGGCACAGGGAAGGGCGCTGGCGCGTGCTGCGGCTCGGAGCCTGGGCGCGGTGGCTGCTGGTGGCGCTGACGGCGGCCACGGCACTGGTACGCCTCGCCCAGCTGGGTGCCGCTGACCGCCAGTGGACCCGTTTCGTGCGCGGCCGCCCGCGCCGCTTCACTAGCTTCGACCAGGTGGCGCAGCTGAGCTCCGCAGCCCGTGGCCTGGCGGCCTCGCTGCTCTTCCTGCTTTTGGTCAAGGCTGCCCAGCAGCTACGCTTCGTGCGCCAGTGGTCCGTCTTTGGCAAGACATTATGCCGAGCTCTGCCAGAGCTCCTGGGGGTCACCTTGGGCCTGGTGGTGCTCGGGGTAGCCTACGCCCAGCTGGCCATCCTGCTCGTGTCTTCCTGTGTGGACTCCCTCTGGAGCGTGGCCCAGGCCCTGTTGGTGCTGTGCCCTGGGACTGGGCTCTCTACCCTGTGTCCTGCCGAGTCCTGGCACCTGTCACCCCTGCTGTGTGTGGGGCTCTGGGCACTGCGGCTGTGGGGCGCCCTACGGCTGGGGGCTGTTATTCTCCGCTGGCGCTACCACGCCTTGCGTGGAGAGCTGTACCGGCCGGCCTGGGAGCCCCAGGACTACGAGATGGTGGAGTTGTTCCTGCGCAGGCTGCGCCTCTGGATGGGCCTCAGCAAGGTCAAGGAGTTCCGCCACAAAGTCCGCTTTGAAGGGATGGAGCCGCTGCCCTCTCGCTCCTCCAGGGGCTCCAAGGTATCCCCGGATGTGCCCCCACCCAGCGCTGGCTCCGATGCCTCGCACCCCTCCACCTCCTCCAGCCAGCTGGATGGGCTGAGCGTGAGCCTGGGCCGGCTGGGGACAAGGTGTGAGCCTGAGCCCTCCCGCCTCCAAGCCGTGTTCGAGGCCCTGCTCACCCAGTTTGACCGACTCAACCAGGCCACAGAGGACGTCTACCAGCTGGAGCAGCAGCTGCACAGCCTGCAAGGCCGCAGGAGCAGCCGGGCGCCCGCCGGATCTTCCCGTGGCCCATCCCCGGGCCTGCGGCCAGCACTGCCCAGCCGCCTTGCCCGGGCCAGTCGGGGTGTGGACCTGGCCACTGGCCCCAGCAGGACACCCCTTCGGGCCAAGAACAAGGTCCACCCCAGCAGCACTTAG-3'
NCBI CDS gene sequence with introns (location: 2089727.. 2135689) (45963 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 2088708.. 2135898) (47191 bp)Download
NCBI gene sequence (location: [2088708.. 2135898 + 1000]) (48191 bp)Download
Cite How to cite