NCBI Summary
This gene is a member of the aggrecan/versican proteoglycan family. The encoded protein is an integral part of the extracellular matrix in cartilagenous tissue and it withstands compression in cartilage. Mutations in this gene may be involved in skeletal dysplasia and spinal degeneration. Multiple alternatively spliced transcript variants that encode different protein isoforms have been observed in this gene. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_037359)
CLEC4H1 - Aggrecan
Aggrecan core protein (Cartilage-specific proteoglycan core protein) (CSPCP) (Chondroitin sulfate proteoglycan core protein 1) (Chondroitin sulfate proteoglycan 1) [Cleaved into: Aggrecan core protein 2]
ACAN
aggrecan
Undefined
Curated
C-type lectin
CLEC4H1
C-type - Proteoglycans or lecticans
a/b mixed / C-type lectin-like
Hyaluronan
Undefined
0.383
Protein sequence and protein families (fasta) (2530 amino acids) Download
MTTLLWVFVTLRVITAAVTVETSDHDNSLSVSIPQPSPLRVLLGTSLTIPCYFIDPMHPVTTAPSTAPLAPRIKWSRVSKEKEVVLLVATEGRVRVNSAYQDKVSLPNYPAIPSDATLEVQSLRSNDSGVYRCEVMHGIEDSEATLEVVVKGIVFHYRAISTRYTLDFDRAQRACLQNSAIIATPEQLQAAYEDGFHQCDAGWLADQTVRYPIHTPREGCYGDKDEFPGVRTYGIRDTNETYDVYCFAEEMEGEVFYATSPEKFTFQEAANECRRLGARLATTGQLYLAWQAGMDMCSAGWLADRSVRYPISKARPNCGGNLLGVRTVYVHANQTGYPDPSSRYDAICYTGEDFVDIPENFFGVGGEEDITVQTVTWPDMELPLPRNITEGEARGSVILTVKPIFEVSPSPLEPEEPFTFAPEIGATAFAEVENETGEATRPWGFPTPGLGPATAFTSEDLVVQVTAVPGQPHLPGGVVFHYRPGPTRYSLTFEEAQQACLRTGAVIASPEQLQAAYEAGYEQCDAGWLRDQTVRYPIVSPRTPCVGDKDSSPGVRTYGVRPSTETYDVYCFVDRLEGEVFFATRLEQFTFQEALEFCESHNATLATTGQLYAAWSRGLDKCYAGWLADGSLRYPIVTPRPACGGDKPGVRTVYLYPNQTGLPDPLSRHHAFCFRGISAVPSPGEEEGGTPTSPSGVEEWIVTQVVPGVAAVPVEEETTAVPSGETTAILEFTTEPENQTEWEPAYTPVGTSPLPGILPTWPPTGAATEESTEGPSATEVPSASEEPSPSEVPFPSEEPSPSEEPFPSVRPFPSVELFPSEEPFPSKEPSPSEEPSASEEPYTPSPPVPSWTELPSSGEESGAPDVSGDFTGSGDVSGHLDFSGQLSGDRASGLPSGDLDSSGLTSTVGSGLPVESGLPSGDEERIEWPSTPTVGELPSGAEILEGSASGVGDLSGLPSGEVLETSASGVGDLSGLPSGEVLETTAPGVEDISGLPSGEVLETTAPGVEDISGLPSGEVLETTAPGVEDISGLPSGEVLETTAPGVEDISGLPSGEVLETTAPGVEDISGLPSGEVLETTAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETAAPGVEDISGLPSGEVLETTAPGVEEISGLPSGEVLETTAPGVDEISGLPSGEVLETTAPGVEEISGLPSGEVLETSTSAVGDLSGLPSGGEVLEISVSGVEDISGLPSGEVVETSASGIEDVSELPSGEGLETSASGVEDLSRLPSGEEVLEISASGFGDLSGLPSGGEGLETSASEVGTDLSGLPSGREGLETSASGAEDLSGLPSGKEDLVGSASGDLDLGKLPSGTLGSGQAPETSGLPSGFSGEYSGVDLGSGPPSGLPDFSGLPSGFPTVSLVDSTLVEVVTASTASELEGRGTIGISGAGEISGLPSSELDISGRASGLPSGTELSGQASGSPDVSGEIPGLFGVSGQPSGFPDTSGETSGVTELSGLSSGQPGISGEASGVLYGTSQPFGITDLSGETSGVPDLSGQPSGLPGFSGATSGVPDLVSGTTSGSGESSGITFVDTSLVEVAPTTFKEEEGLGSVELSGLPSGEADLSGKSGMVDVSGQFSGTVDSSGFTSQTPEFSGLPSGIAEVSGESSRAEIGSSLPSGAYYGSGTPSSFPTVSLVDRTLVESVTQAPTAQEAGEGPSGILELSGAHSGAPDMSGEHSGFLDLSGLQSGLIEPSGEPPGTPYFSGDFASTTNVSGESSVAMGTSGEASGLPEVTLITSEFVEGVTEPTISQELGQRPPVTHTPQLFESSGKVSTAGDISGATPVLPGSGVEVSSVPESSSETSAYPEAGFGASAAPEASREDSGSPDLSETTSAFHEANLERSSGLGVSGSTLTFQEGEASAAPEVSGESTTTSDVGTEAPGLPSATPTASGDRTEISGDLSGHTSQLGVVISTSIPESEWTQQTQRPAETHLEIESSSLLYSGEETHTVETATSPTDASIPASPEWKRESESTAAAPARSCAEEPCGAGTCKETEGHVICLCPPGYTGEHCNIDQEVCEEGWNKYQGHCYRHFPDRETWVDAERRCREQQSHLSSIVTPEEQEFVNNNAQDYQWIGLNDRTIEGDFRWSDGHPMQFENWRPNQPDNFFAAGEDCVVMIWHEKGEWNDVPCNYHLPFTCKKGTVACGEPPVVEHARTFGQKKDRYEINSLVRYQCTEGFVQRHMPTIRCQPSGHWEEPQITCTDPTTYKRRLQKRSSRHPRRSRPSTAH
Mol* PDB structure viewer

Either no PDB or existing PDB of non-glycosylated form

Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.43, 1.79] ÅDownload
The location of the lectin domain structural model is: 2314-2445
We infer [1.43, 1.79] Å as the interval of error of this structural model.
Template 1: 6JJJ chain: A, P70194, NP_058031.2, sequence identity: 37.1%, coverage: 97.0%, location in sequence: 393-543, (393-543 in PDB).
Template 2: 6PWS chain: A, E1BIQ4, XP_005198961.1, sequence identity: 34.8%, coverage: 95.5%, location in sequence: 174-302, (162-290 in PDB).
Template 3: 3WHD chain: C, Q8WXI8, NP_525126.2, sequence identity: 34.8%, coverage: 98.5%, location in sequence: 63-215, (63-215 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • [Clinical and genetic analysis of five Chinese pedigrees affected with short stature due to variants of ACAN gene]. [34625928]
  • Azilsartan prevented AGE-induced inflammatory response and degradation of aggrecan in human chondrocytes through inhibition of Sox4. [34051020]
  • A High Proportion of Novel ACAN Mutations and Their Prevalence in a Large Cohort of Chinese Short Stature Children. [33606014]
  • Aggrecan: a new biomarker for acute type A aortic dissection. [33990642]
  • Growth-Promoting Therapies May Be Useful In Short Stature Patients With Nonspecific Skeletal Abnormalities Caused By Acan Heterozygous Mutations: Six Chinese Cases And Literature Review. [33471655]
  • The interglobular domain of cartilage aggrecan is cleaved by PUMP, gelatinases, and cathepsin B. [1326552]
  • The structure of aggrecan fragments in human synovial fluid. Evidence for the involvement in osteoarthritis of a novel proteinase which cleaves the Glu 373-Ala 374 bond of the interglobular domain. [1569188]
  • Complete coding sequence and deduced primary structure of the human cartilage large aggregating proteoglycan, aggrecan. Human-specific repeats, and additional alternatively spliced forms. [1985970]
  • A new epidermal growth factor-like domain in the human core protein for the large cartilage-specific proteoglycan. Evidence for alternative splicing of the domain. [2789216]
  • Absence of proteoglycan core protein in cartilage from the cmd/cmd (cartilage matrix deficiency) mouse. [7240256]
UniProt Main References (12 PubMed Identifiers)
  • Analysis of the DNA sequence and duplication history of human chromosome 15. [16572171]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Catabolism of aggrecan by explant cultures of human articular cartilage in the presence of retinoic acid. [7574678]
  • Analysis of aggrecan and tenascin gene expression in mouse skeletal tissues by northern and in situ hybridization using species specific cDNA probes. [7524681]
  • The structure of aggrecan fragments in human synovial fluid. Evidence that aggrecanase mediates cartilage degradation in inflammatory joint disease, joint injury, and osteoarthritis. [8216415]
  • Length variation in the keratan sulfate domain of mammalian aggrecan. [7827755]
  • Age-related changes in the content of the C-terminal region of aggrecan in human articular cartilage. [8611178]
  • A mutation in the variable repeat region of the aggrecan gene (AGC1) causes a form of spondyloepiphyseal dysplasia associated with severe, premature osteoarthritis. [16080123]
  • Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry. [16335952]
  • Interaction of cartilage oligomeric matrix protein/thrombospondin 5 with aggrecan. [17588949]
  • Show more
All isoforms of this gene containing a lectin domain
XP_011519616.1, NP_001126.3, XP_011519615.1, NP_037359.3, NP_001356197.1
RNA
RNA (Transcript ID: NM_013227.4)
aggrecan, transcript variant 2
m7G-5')ppp(5'-GCCCGCCCACCUACCUCCCCGCCGCUCCAGAGGGGGCUCGCAGAGCUGAGGACGCGCGCAGCGCUGCUCAAGGUCUCUCUCUCUCAGCACCCUCGCCGGCCGGCGUCUGACGCGGGUGCCAGGGUCUCCGGGCACCUUUCAGUGUCCAUUCCCUCAGCCAGCCAGGACUCCGCAACCCAGCAGUUGCCGCUGCGGCCACAGCCCGAGGGGACCUGCGGACAGGACGCCGGCAGGAGGAGGGGUGCGCAGCGCCCGCGCAGAGCGUCUCCCUCGCUACGCAGCGAGACCCGGGCCUCCCGGCCCCAGGAGCCCCCAGCUGCCUCGCCAGGUGUGUGGGACUGAAGUUCUUGGAGAAGGGAGUCCAACUCUUCAAGGUGAACUAUGACCACUUUACUCUGGGUUUUCGUGACUCUGAGGGUCAUCACUGCAGCUGUCACUGUAGAAACUUCAGACCAUGACAACUCGCUGAGUGUCAGCAUCCCCCAACCGUCCCCGCUGAGGGUCCUCCUGGGGACCUCCCUCACCAUCCCCUGCUAUUUCAUCGACCCCAUGCACCCUGUGACCACCGCCCCUUCUACCGCCCCACUGGCCCCAAGAAUCAAGUGGAGCCGUGUGUCCAAGGAGAAGGAGGUAGUGCUGCUGGUGGCCACUGAAGGGCGCGUGCGGGUCAACAGUGCCUAUCAGGACAAGGUCUCACUGCCCAACUACCCGGCCAUCCCCAGUGACGCCACCUUGGAAGUCCAGAGCCUGCGCUCCAAUGACUCUGGGGUCUACCGCUGCGAGGUGAUGCAUGGCAUCGAGGACAGCGAGGCCACCCUGGAAGUCGUGGUGAAAGGCAUCGUGUUCCAUUACAGAGCCAUCUCUACACGCUACACCCUCGACUUUGACAGGGCGCAGCGGGCCUGCCUGCAGAACAGUGCCAUCAUUGCCACGCCUGAGCAGCUGCAGGCCGCCUACGAAGACGGCUUCCACCAGUGUGACGCCGGCUGGCUGGCUGACCAGACUGUCAGAUACCCCAUCCACACUCCCCGGGAAGGCUGCUAUGGAGACAAGGAUGAGUUUCCUGGUGUGAGGACGUAUGGCAUCCGAGACACCAACGAGACCUAUGAUGUGUACUGCUUCGCCGAGGAGAUGGAGGGUGAGGUCUUUUAUGCAACAUCUCCAGAGAAGUUCACCUUCCAGGAAGCAGCCAAUGAGUGCCGGCGGCUGGGUGCCCGGCUGGCCACCACGGGCCAGCUCUACCUGGCCUGGCAGGCUGGCAUGGACAUGUGCAGCGCCGGCUGGCUGGCCGACCGCAGCGUGCGCUACCCCAUCUCCAAGGCCCGGCCCAACUGCGGUGGCAACCUCCUGGGCGUGAGGACCGUCUACGUGCAUGCCAACCAGACGGGCUACCCCGACCCCUCAUCCCGCUACGACGCCAUCUGCUACACAGGUGAAGACUUUGUGGACAUCCCAGAAAACUUCUUUGGAGUGGGGGGUGAGGAGGACAUCACCGUCCAGACAGUGACCUGGCCUGACAUGGAGCUGCCACUGCCUCGAAACAUCACUGAGGGUGAAGCCCGAGGCAGCGUGAUCCUUACCGUAAAGCCCAUCUUCGAGGUCUCCCCCAGUCCCCUGGAACCCGAGGAGCCCUUCACGUUUGCCCCUGAAAUAGGGGCCACUGCCUUCGCUGAGGUUGAGAAUGAGACUGGAGAGGCCACCAGGCCCUGGGGCUUUCCCACACCUGGCCUGGGCCCUGCCACGGCAUUCACCAGUGAGGACCUCGUCGUGCAGGUGACCGCUGUCCCUGGGCAGCCGCAUUUGCCAGGGGGGGUCGUCUUCCACUACCGCCCGGGACCCACCCGCUACUCGCUGACCUUUGAGGAGGCACAGCAGGCCUGCCUGCGCACGGGGGCGGUCAUUGCCUCGCCGGAGCAGCUCCAGGCCGCCUACGAAGCAGGCUAUGAGCAGUGUGACGCCGGCUGGCUGCGGGACCAGACCGUCAGAUACCCCAUUGUGAGCCCCCGGACCCCAUGCGUGGGUGACAAGGACAGCAGCCCAGGGGUCAGGACCUAUGGCGUGCGCCCAUCAACAGAGACCUACGAUGUCUACUGCUUUGUAGACAGACUUGAGGGGGAGGUGUUCUUCGCCACACGCCUUGAGCAGUUCACCUUCCAGGAAGCACUGGAGUUCUGUGAAUCUCACAAUGCUACGCUGGCCACCACGGGCCAGCUCUACGCCGCCUGGAGCCGCGGCCUGGACAAGUGCUAUGCCGGCUGGCUGGCCGACGGCAGCCUCCGCUACCCCAUCGUCACCCCAAGGCCUGCCUGCGGUGGGGACAAGCCAGGCGUGAGAACGGUCUACCUCUACCCUAACCAGACGGGCCUCCCAGACCCACUGUCCCGGCACCAUGCCUUCUGCUUCCGAGGCAUUUCAGCGGUUCCUUCUCCAGGAGAAGAAGAGGGUGGCACACCCACAUCACCCUCUGGUGUGGAGGAGUGGAUCGUGACCCAAGUGGUUCCUGGUGUGGCUGCUGUCCCCGUAGAAGAGGAGACAACUGCUGUACCCUCAGGGGAGACUACUGCCAUCCUAGAGUUCACCACCGAGCCAGAAAACCAGACAGAAUGGGAACCAGCCUAUACCCCAGUGGGCACAUCCCCGCUGCCAGGGAUCCUUCCUACUUGGCCUCCCACUGGCGCAGCAACAGAGGAAAGUACAGAAGGCCCUUCUGCAACUGAAGUGCCCUCUGCCUCAGAGGAACCAUCCCCCUCAGAGGUGCCAUUCCCCUCAGAGGAGCCAUCCCCCUCAGAGGAACCAUUCCCCUCAGUGAGGCCAUUCCCCUCAGUGGAGCUGUUCCCCUCAGAGGAGCCAUUCCCCUCCAAGGAGCCAUCCCCCUCAGAGGAACCAUCAGCCUCGGAAGAGCCGUAUACACCUUCACCCCCCGUGCCCAGCUGGACUGAGCUGCCCAGCUCUGGGGAGGAAUCUGGGGCCCCUGAUGUCAGUGGUGACUUCACAGGCAGUGGAGAUGUUUCAGGACACCUUGACUUCAGUGGGCAGCUGUCAGGGGACAGGGCAAGUGGACUGCCCUCUGGAGACCUGGACUCCAGUGGUCUUACUUCCACAGUGGGCUCAGGCCUGCCUGUGGAAAGUGGACUACCCUCAGGGGAUGAAGAGAGAAUUGAGUGGCCCAGCACUCCUACGGUUGGUGAACUGCCCUCUGGAGCUGAGAUCCUAGAGGGCUCUGCCUCUGGAGUUGGGGAUCUCAGUGGACUUCCUUCUGGAGAAGUUCUAGAGACCUCUGCCUCUGGAGUAGGAGACCUCAGUGGGCUUCCUUCUGGAGAAGUUCUAGAGACCACUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACCACUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACCACUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACCACUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACCACUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACCACUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACCGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACCGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACCGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACCGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACCGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACCGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACCGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACUGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACUGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACUGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACUGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACUGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACUGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACUGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACUGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACUGCUGCCCCUGGAGUAGAGGACAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACUACUGCCCCUGGAGUAGAGGAGAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACUACUGCCCCUGGAGUAGAUGAGAUCAGUGGGCUUCCUUCUGGAGAAGUUCUAGAGACUACUGCCCCUGGAGUAGAGGAGAUCAGCGGGCUUCCUUCUGGAGAAGUUCUAGAGACUUCUACCUCUGCGGUAGGGGACCUCAGUGGACUUCCUUCUGGAGGAGAAGUUCUAGAGAUUUCUGUCUCUGGAGUAGAGGACAUCAGUGGGCUUCCUUCUGGAGAGGUUGUAGAGACUUCUGCCUCUGGAAUAGAGGAUGUCAGUGAACUUCCUUCAGGAGAAGGUCUAGAGACCUCUGCUUCUGGAGUAGAGGACCUCAGCAGGCUCCCUUCUGGAGAAGAAGUUCUAGAGAUUUCUGCCUCUGGAUUUGGGGACCUCAGUGGACUUCCUUCUGGAGGAGAAGGUCUAGAGACCUCUGCUUCUGAAGUAGGGACUGACCUCAGUGGGCUUCCUUCUGGAAGGGAGGGUCUAGAGACUUCAGCUUCUGGAGCUGAGGACCUCAGUGGGUUGCCUUCUGGAAAAGAAGACUUGGUGGGGUCAGCUUCUGGAGACUUGGACUUGGGCAAACUGCCUUCUGGAACUCUAGGAAGUGGGCAAGCUCCAGAAACAAGUGGUCUUCCCUCUGGAUUUAGUGGUGAGUAUUCUGGGGUGGACCUUGGAAGUGGCCCACCCUCUGGCCUGCCUGACUUUAGUGGACUUCCAUCUGGAUUCCCAACUGUUUCCCUAGUGGAUUCUACAUUGGUGGAAGUGGUCACAGCCUCCACUGCAAGUGAACUGGAAGGGAGGGGAACCAUUGGCAUCAGUGGUGCAGGAGAAAUAUCUGGACUGCCCUCCAGUGAGCUGGACAUUAGUGGGAGAGCUAGUGGACUCCCUUCAGGAACUGAACUCAGUGGCCAAGCAUCUGGGUCUCCUGAUGUCAGUGGGGAAAUACCUGGACUCUUUGGUGUCAGUGGACAGCCAUCAGGGUUUCCUGACACUAGUGGGGAAACAUCUGGAGUGACUGAGCUUAGCGGGCUGUCCUCUGGACAACCAGGUAUUAGUGGAGAAGCAUCUGGAGUUCUUUAUGGCACUAGUCAACCCUUUGGCAUAACUGAUCUGAGUGGAGAAACAUCUGGGGUCCCUGAUCUCAGUGGGCAGCCUUCAGGGUUACCAGGGUUCAGUGGGGCAACAUCAGGAGUCCCUGACCUGGUUUCUGGUACCACGAGUGGCAGCGGUGAAUCUUCUGGGAUUACAUUUGUGGACACCAGUUUGGUUGAAGUGGCCCCUACUACAUUUAAAGAAGAAGAAGGCUUAGGGUCUGUGGAACUCAGUGGCCUCCCUUCCGGAGAGGCAGAUCUGUCAGGCAAAUCUGGGAUGGUGGAUGUCAGUGGACAGUUUUCUGGAACAGUCGAUUCCAGUGGGUUUACAUCCCAGACUCCGGAAUUCAGUGGCCUACCAAGUGGCAUAGCUGAGGUCAGUGGAGAAUCCUCCAGAGCUGAGAUUGGGAGCAGCCUGCCCUCGGGAGCAUAUUAUGGCAGUGGAACUCCAUCUAGUUUCCCCACUGUCUCUCUUGUAGACAGAACUUUGGUGGAAUCUGUAACCCAGGCUCCAACAGCCCAAGAGGCAGGAGAAGGGCCUUCUGGCAUUUUAGAACUCAGUGGUGCUCAUUCUGGAGCACCAGACAUGUCUGGGGAGCAUUCUGGAUUUCUGGACCUAAGUGGGCUGCAGUCCGGGCUGAUAGAGCCCAGCGGAGAGCCACCAGGUACUCCAUAUUUUAGUGGGGAUUUUGCCAGCACCACCAAUGUAAGUGGAGAAUCCUCUGUAGCCAUGGGCACCAGUGGAGAGGCCUCAGGACUUCCAGAAGUUACUUUAAUCACUUCUGAGUUCGUGGAGGGUGUUACUGAACCAACUAUUUCUCAGGAACUAGGCCAAAGGCCCCCUGUGACACACACACCCCAGCUUUUUGAGUCCAGUGGAAAAGUCUCCACAGCUGGGGACAUUAGUGGAGCUACCCCAGUGCUCCCUGGGUCUGGAGUAGAAGUAUCAUCAGUCCCAGAAUCUAGCAGUGAGACGUCCGCCUAUCCUGAAGCUGGGUUCGGGGCAUCUGCCGCCCCUGAGGCCAGCAGAGAAGAUUCUGGGUCCCCUGAUCUGAGUGAAACCACCUCUGCAUUCCACGAAGCUAACCUUGAGAGAUCCUCUGGCCUAGGAGUGAGCGGCAGCACUUUGACAUUUCAAGAAGGCGAGGCGUCCGCUGCCCCAGAAGUGAGUGGAGAAUCCACCACCACCAGUGAUGUGGGGACAGAGGCACCAGGCUUGCCUUCAGCCACUCCCACGGCUUCUGGAGACAGGACUGAAAUCAGCGGAGACCUGUCUGGUCACACCUCGCAGCUGGGCGUUGUCAUCAGCACCAGCAUCCCAGAGUCUGAGUGGACCCAGCAGACCCAGCGCCCUGCAGAGACGCAUCUAGAAAUUGAGUCCUCAAGCCUCCUGUACUCAGGAGAAGAGACUCACACAGUCGAAACAGCCACCUCCCCAACAGAUGCUUCCAUCCCAGCUUCUCCGGAAUGGAAACGUGAAUCAGAAUCAACUGCUGCAGCCCCCGCCAGGUCCUGUGCAGAGGAGCCCUGUGGAGCUGGGACCUGCAAGGAGACAGAGGGACACGUCAUAUGCCUGUGCCCCCCUGGCUACACUGGCGAGCACUGUAACAUAGACCAGGAGGUAUGUGAGGAGGGCUGGAACAAGUACCAGGGCCACUGUUACCGCCACUUCCCGGACCGCGAGACCUGGGUGGAUGCUGAGCGCCGGUGUCGGGAGCAGCAGUCACACCUGAGCAGCAUCGUCACCCCCGAGGAGCAGGAGUUUGUCAACAACAAUGCCCAAGACUACCAGUGGAUCGGCCUGAACGACAGGACCAUCGAAGGGGACUUCCGCUGGUCAGAUGGACACCCCAUGCAAUUUGAGAACUGGCGCCCCAACCAGCCUGACAACUUUUUUGCCGCUGGAGAGGACUGUGUGGUGAUGAUCUGGCACGAGAAGGGCGAGUGGAAUGAUGUUCCCUGCAAUUACCACCUCCCCUUCACGUGUAAAAAGGGCACAGUGGCCUGCGGAGAGCCCCCUGUGGUGGAGCAUGCCAGGACCUUCGGGCAGAAGAAGGACCGGUAUGAGAUCAAUUCCCUGGUGCGGUACCAGUGCACAGAGGGGUUUGUCCAGCGCCACAUGCCCACCAUCCGGUGCCAGCCCAGCGGGCACUGGGAGGAGCCUCAGAUCACCUGCACAGACCCCACCACCUACAAACGCAGACUACAGAAGCGGAGCUCACGGCACCCUCGGAGGAGCCGCCCCAGCACAGCCCACUGAGAAGAGCUUCCAGGACGCACCCAGGACGCUGAGCCCAGGAGCCUGCCAGGCUGACGUGCAUCCCACCCAGACGGUGUCCUCUUCUUGUCGCUUUUUGUCAUAUAAGGAAUCCCAUUAAAGAAGGAAAAAAAUAAAUCCCACAUUUGUGUAUGCACCCACUCACCCCUCCAAAUCAGCAAAACCGCAUCUAAUUUGUCCGCCGAAUGCCAAAGCAAAGCAAACUUAUUAUAACCCUUGGACUGAGUUUAGAGACAUUUCUUCAAUUUCCCAUCGUGCCUUUCCAGGGACCAGUGCAGGGACAGGGGGAGAAGGGGAGGGGUUAAGUUAAAUAAAGAAGAUUAUUUUUGUUUCCUGACUUUAUCCAAGAGCAGUGCAAUCGUUGGUUAUUUCACCUCCAGGGAGAGCUAGGGAGGAGGGAGGAGGGCUCCAAAGGAGCUGGAAGGAGCAGAGGCCUGAGAGCAGGAAGAACUCGGAACCGCAGCUGAAUGUAUUGGAUGAGAAGGAGCCAGGAGGGCUACACCAUCUGUAUGAGGGAAAAGCCUUGGGGGAGAGGGGUGGGUUCCUGCCUCCUGCCGAGGGUAAGCCGGCAGGAGAGAGCCAUCAGAGGGACCUCCGCUGCCUGGGAGUUGGGUUCCCUCCAAGGGUCCCUCUUUCAGUGUCCUCUCUCUCACCUGGGUCUGCCACCCUAACAGGUGGCAACUCGGCAGGGCUGCUGGGGGCACUUCCUGCCCAGUGGGGGGUGCCGCCCAACCUUCUCCCCUCCCCACCCCCGCCCCCGGGACCGUGCAGGCACCAGGGUUCCGUGCACCUAUUUAUAUUUUUGAAAACUGAAGAUUAUAAUAUUAUAAUAAUAAUAAAGACAUUGGAAGAGA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 176)
aggrecan
strand +
CSPGCP
319
NCBI CDS gene sequence (7593 bp)
5'-ATGACCACTTTACTCTGGGTTTTCGTGACTCTGAGGGTCATCACTGCAGCTGTCACTGTAGAAACTTCAGACCATGACAACTCGCTGAGTGTCAGCATCCCCCAACCGTCCCCGCTGAGGGTCCTCCTGGGGACCTCCCTCACCATCCCCTGCTATTTCATCGACCCCATGCACCCTGTGACCACCGCCCCTTCTACCGCCCCACTGGCCCCAAGAATCAAGTGGAGCCGTGTGTCCAAGGAGAAGGAGGTAGTGCTGCTGGTGGCCACTGAAGGGCGCGTGCGGGTCAACAGTGCCTATCAGGACAAGGTCTCACTGCCCAACTACCCGGCCATCCCCAGTGACGCCACCTTGGAAGTCCAGAGCCTGCGCTCCAATGACTCTGGGGTCTACCGCTGCGAGGTGATGCATGGCATCGAGGACAGCGAGGCCACCCTGGAAGTCGTGGTGAAAGGCATCGTGTTCCATTACAGAGCCATCTCTACACGCTACACCCTCGACTTTGACAGGGCGCAGCGGGCCTGCCTGCAGAACAGTGCCATCATTGCCACGCCTGAGCAGCTGCAGGCCGCCTACGAAGACGGCTTCCACCAGTGTGACGCCGGCTGGCTGGCTGACCAGACTGTCAGATACCCCATCCACACTCCCCGGGAAGGCTGCTATGGAGACAAGGATGAGTTTCCTGGTGTGAGGACGTATGGCATCCGAGACACCAACGAGACCTATGATGTGTACTGCTTCGCCGAGGAGATGGAGGGTGAGGTCTTTTATGCAACATCTCCAGAGAAGTTCACCTTCCAGGAAGCAGCCAATGAGTGCCGGCGGCTGGGTGCCCGGCTGGCCACCACGGGCCAGCTCTACCTGGCCTGGCAGGCTGGCATGGACATGTGCAGCGCCGGCTGGCTGGCCGACCGCAGCGTGCGCTACCCCATCTCCAAGGCCCGGCCCAACTGCGGTGGCAACCTCCTGGGCGTGAGGACCGTCTACGTGCATGCCAACCAGACGGGCTACCCCGACCCCTCATCCCGCTACGACGCCATCTGCTACACAGGTGAAGACTTTGTGGACATCCCAGAAAACTTCTTTGGAGTGGGGGGTGAGGAGGACATCACCGTCCAGACAGTGACCTGGCCTGACATGGAGCTGCCACTGCCTCGAAACATCACTGAGGGTGAAGCCCGAGGCAGCGTGATCCTTACCGTAAAGCCCATCTTCGAGGTCTCCCCCAGTCCCCTGGAACCCGAGGAGCCCTTCACGTTTGCCCCTGAAATAGGGGCCACTGCCTTCGCTGAGGTTGAGAATGAGACTGGAGAGGCCACCAGGCCCTGGGGCTTTCCCACACCTGGCCTGGGCCCTGCCACGGCATTCACCAGTGAGGACCTCGTCGTGCAGGTGACCGCTGTCCCTGGGCAGCCGCATTTGCCAGGGGGGGTCGTCTTCCACTACCGCCCGGGACCCACCCGCTACTCGCTGACCTTTGAGGAGGCACAGCAGGCCTGCCTGCGCACGGGGGCGGTCATTGCCTCGCCGGAGCAGCTCCAGGCCGCCTACGAAGCAGGCTATGAGCAGTGTGACGCCGGCTGGCTGCGGGACCAGACCGTCAGATACCCCATTGTGAGCCCCCGGACCCCATGCGTGGGTGACAAGGACAGCAGCCCAGGGGTCAGGACCTATGGCGTGCGCCCATCAACAGAGACCTACGATGTCTACTGCTTTGTAGACAGACTTGAGGGGGAGGTGTTCTTCGCCACACGCCTTGAGCAGTTCACCTTCCAGGAAGCACTGGAGTTCTGTGAATCTCACAATGCTACGCTGGCCACCACGGGCCAGCTCTACGCCGCCTGGAGCCGCGGCCTGGACAAGTGCTATGCCGGCTGGCTGGCCGACGGCAGCCTCCGCTACCCCATCGTCACCCCAAGGCCTGCCTGCGGTGGGGACAAGCCAGGCGTGAGAACGGTCTACCTCTACCCTAACCAGACGGGCCTCCCAGACCCACTGTCCCGGCACCATGCCTTCTGCTTCCGAGGCATTTCAGCGGTTCCTTCTCCAGGAGAAGAAGAGGGTGGCACACCCACATCACCCTCTGGTGTGGAGGAGTGGATCGTGACCCAAGTGGTTCCTGGTGTGGCTGCTGTCCCCGTAGAAGAGGAGACAACTGCTGTACCCTCAGGGGAGACTACTGCCATCCTAGAGTTCACCACCGAGCCAGAAAACCAGACAGAATGGGAACCAGCCTATACCCCAGTGGGCACATCCCCGCTGCCAGGGATCCTTCCTACTTGGCCTCCCACTGGCGCAGCAACAGAGGAAAGTACAGAAGGCCCTTCTGCAACTGAAGTGCCCTCTGCCTCAGAGGAACCATCCCCCTCAGAGGTGCCATTCCCCTCAGAGGAGCCATCCCCCTCAGAGGAACCATTCCCCTCAGTGAGGCCATTCCCCTCAGTGGAGCTGTTCCCCTCAGAGGAGCCATTCCCCTCCAAGGAGCCATCCCCCTCAGAGGAACCATCAGCCTCGGAAGAGCCGTATACACCTTCACCCCCCGTGCCCAGCTGGACTGAGCTGCCCAGCTCTGGGGAGGAATCTGGGGCCCCTGATGTCAGTGGTGACTTCACAGGCAGTGGAGATGTTTCAGGACACCTTGACTTCAGTGGGCAGCTGTCAGGGGACAGGGCAAGTGGACTGCCCTCTGGAGACCTGGACTCCAGTGGTCTTACTTCCACAGTGGGCTCAGGCCTGCCTGTGGAAAGTGGACTACCCTCAGGGGATGAAGAGAGAATTGAGTGGCCCAGCACTCCTACGGTTGGTGAACTGCCCTCTGGAGCTGAGATCCTAGAGGGCTCTGCCTCTGGAGTTGGGGATCTCAGTGGACTTCCTTCTGGAGAAGTTCTAGAGACCTCTGCCTCTGGAGTAGGAGACCTCAGTGGGCTTCCTTCTGGAGAAGTTCTAGAGACCACTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACCACTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACCACTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACCACTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACCACTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACCACTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACCGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACCGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACCGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACCGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACCGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACCGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACCGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTGCTGCCCCTGGAGTAGAGGACATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTACTGCCCCTGGAGTAGAGGAGATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTACTGCCCCTGGAGTAGATGAGATCAGTGGGCTTCCTTCTGGAGAAGTTCTAGAGACTACTGCCCCTGGAGTAGAGGAGATCAGCGGGCTTCCTTCTGGAGAAGTTCTAGAGACTTCTACCTCTGCGGTAGGGGACCTCAGTGGACTTCCTTCTGGAGGAGAAGTTCTAGAGATTTCTGTCTCTGGAGTAGAGGACATCAGTGGGCTTCCTTCTGGAGAGGTTGTAGAGACTTCTGCCTCTGGAATAGAGGATGTCAGTGAACTTCCTTCAGGAGAAGGTCTAGAGACCTCTGCTTCTGGAGTAGAGGACCTCAGCAGGCTCCCTTCTGGAGAAGAAGTTCTAGAGATTTCTGCCTCTGGATTTGGGGACCTCAGTGGACTTCCTTCTGGAGGAGAAGGTCTAGAGACCTCTGCTTCTGAAGTAGGGACTGACCTCAGTGGGCTTCCTTCTGGAAGGGAGGGTCTAGAGACTTCAGCTTCTGGAGCTGAGGACCTCAGTGGGTTGCCTTCTGGAAAAGAAGACTTGGTGGGGTCAGCTTCTGGAGACTTGGACTTGGGCAAACTGCCTTCTGGAACTCTAGGAAGTGGGCAAGCTCCAGAAACAAGTGGTCTTCCCTCTGGATTTAGTGGTGAGTATTCTGGGGTGGACCTTGGAAGTGGCCCACCCTCTGGCCTGCCTGACTTTAGTGGACTTCCATCTGGATTCCCAACTGTTTCCCTAGTGGATTCTACATTGGTGGAAGTGGTCACAGCCTCCACTGCAAGTGAACTGGAAGGGAGGGGAACCATTGGCATCAGTGGTGCAGGAGAAATATCTGGACTGCCCTCCAGTGAGCTGGACATTAGTGGGAGAGCTAGTGGACTCCCTTCAGGAACTGAACTCAGTGGCCAAGCATCTGGGTCTCCTGATGTCAGTGGGGAAATACCTGGACTCTTTGGTGTCAGTGGACAGCCATCAGGGTTTCCTGACACTAGTGGGGAAACATCTGGAGTGACTGAGCTTAGCGGGCTGTCCTCTGGACAACCAGGTATTAGTGGAGAAGCATCTGGAGTTCTTTATGGCACTAGTCAACCCTTTGGCATAACTGATCTGAGTGGAGAAACATCTGGGGTCCCTGATCTCAGTGGGCAGCCTTCAGGGTTACCAGGGTTCAGTGGGGCAACATCAGGAGTCCCTGACCTGGTTTCTGGTACCACGAGTGGCAGCGGTGAATCTTCTGGGATTACATTTGTGGACACCAGTTTGGTTGAAGTGGCCCCTACTACATTTAAAGAAGAAGAAGGCTTAGGGTCTGTGGAACTCAGTGGCCTCCCTTCCGGAGAGGCAGATCTGTCAGGCAAATCTGGGATGGTGGATGTCAGTGGACAGTTTTCTGGAACAGTCGATTCCAGTGGGTTTACATCCCAGACTCCGGAATTCAGTGGCCTACCAAGTGGCATAGCTGAGGTCAGTGGAGAATCCTCCAGAGCTGAGATTGGGAGCAGCCTGCCCTCGGGAGCATATTATGGCAGTGGAACTCCATCTAGTTTCCCCACTGTCTCTCTTGTAGACAGAACTTTGGTGGAATCTGTAACCCAGGCTCCAACAGCCCAAGAGGCAGGAGAAGGGCCTTCTGGCATTTTAGAACTCAGTGGTGCTCATTCTGGAGCACCAGACATGTCTGGGGAGCATTCTGGATTTCTGGACCTAAGTGGGCTGCAGTCCGGGCTGATAGAGCCCAGCGGAGAGCCACCAGGTACTCCATATTTTAGTGGGGATTTTGCCAGCACCACCAATGTAAGTGGAGAATCCTCTGTAGCCATGGGCACCAGTGGAGAGGCCTCAGGACTTCCAGAAGTTACTTTAATCACTTCTGAGTTCGTGGAGGGTGTTACTGAACCAACTATTTCTCAGGAACTAGGCCAAAGGCCCCCTGTGACACACACACCCCAGCTTTTTGAGTCCAGTGGAAAAGTCTCCACAGCTGGGGACATTAGTGGAGCTACCCCAGTGCTCCCTGGGTCTGGAGTAGAAGTATCATCAGTCCCAGAATCTAGCAGTGAGACGTCCGCCTATCCTGAAGCTGGGTTCGGGGCATCTGCCGCCCCTGAGGCCAGCAGAGAAGATTCTGGGTCCCCTGATCTGAGTGAAACCACCTCTGCATTCCACGAAGCTAACCTTGAGAGATCCTCTGGCCTAGGAGTGAGCGGCAGCACTTTGACATTTCAAGAAGGCGAGGCGTCCGCTGCCCCAGAAGTGAGTGGAGAATCCACCACCACCAGTGATGTGGGGACAGAGGCACCAGGCTTGCCTTCAGCCACTCCCACGGCTTCTGGAGACAGGACTGAAATCAGCGGAGACCTGTCTGGTCACACCTCGCAGCTGGGCGTTGTCATCAGCACCAGCATCCCAGAGTCTGAGTGGACCCAGCAGACCCAGCGCCCTGCAGAGACGCATCTAGAAATTGAGTCCTCAAGCCTCCTGTACTCAGGAGAAGAGACTCACACAGTCGAAACAGCCACCTCCCCAACAGATGCTTCCATCCCAGCTTCTCCGGAATGGAAACGTGAATCAGAATCAACTGCTGCAGCCCCCGCCAGGTCCTGTGCAGAGGAGCCCTGTGGAGCTGGGACCTGCAAGGAGACAGAGGGACACGTCATATGCCTGTGCCCCCCTGGCTACACTGGCGAGCACTGTAACATAGACCAGGAGGTATGTGAGGAGGGCTGGAACAAGTACCAGGGCCACTGTTACCGCCACTTCCCGGACCGCGAGACCTGGGTGGATGCTGAGCGCCGGTGTCGGGAGCAGCAGTCACACCTGAGCAGCATCGTCACCCCCGAGGAGCAGGAGTTTGTCAACAACAATGCCCAAGACTACCAGTGGATCGGCCTGAACGACAGGACCATCGAAGGGGACTTCCGCTGGTCAGATGGACACCCCATGCAATTTGAGAACTGGCGCCCCAACCAGCCTGACAACTTTTTTGCCGCTGGAGAGGACTGTGTGGTGATGATCTGGCACGAGAAGGGCGAGTGGAATGATGTTCCCTGCAATTACCACCTCCCCTTCACGTGTAAAAAGGGCACAGTGGCCTGCGGAGAGCCCCCTGTGGTGGAGCATGCCAGGACCTTCGGGCAGAAGAAGGACCGGTATGAGATCAATTCCCTGGTGCGGTACCAGTGCACAGAGGGGTTTGTCCAGCGCCACATGCCCACCATCCGGTGCCAGCCCAGCGGGCACTGGGAGGAGCCTCAGATCACCTGCACAGACCCCACCACCTACAAACGCAGACTACAGAAGCGGAGCTCACGGCACCCTCGGAGGAGCCGCCCCAGCACAGCCCACTGA-3'
NCBI CDS gene sequence with introns (location: 88836207.. 88874481) (38275 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 88803436.. 88875353) (71918 bp)Download
NCBI gene sequence (location: [88803436 - 1000].. 88875353) (72918 bp)Download
Cite How to cite