NCBI Summary
This gene encodes a type I transmembrane lectin that shuttles between the endoplasmic reticulum, the Golgi apparatus and the plasma membrane. The encoded protein binds high mannose type glycoproteins and may facilitate their sorting, trafficking and quality control. [provided by RefSeq, Oct 2008].
Protein
Protein (NP_006807)
VIP36 - lectin, mannose binding 2
Vesicular integral-membrane protein VIP36 (Glycoprotein GP36b) (Lectin mannose-binding 2) (Vesicular integral-membrane protein 36) (VIP36)
LMAN2
lectin, mannose binding 2
Undefined
Curated
ERGIC-VIP L-type
L-Type Lectins
b-sandwich / ConA-like
Man / Man(a1-2)Man / High mannose N-glycan
0.594
MAAEGWIWRWGWGRRCLGRPGLLGPGPGPTTPLFLLLLLGSVTADITDGNSEHLKREHSLIKPYQGVGSSSMPLWDFQGSTMLTSQYVRLTPDERSKEGSIWNHQPCFLKDWEMHVHFKVHGTGKKNLHGDGIALWYTRDRLVPGPVFGSKDNFHGLAIFLDTYPNDETTERVFPYISVMVNNGSLSYDHSKDGRWTELAGCTADFRNRDHDTFLAVRYSRGRLTVMTDLEDKNEWKNCIDITGVRLPTGYYFGASAGTGDLSDNHDIISMKLFQLMVEHTPDEESIDWTKIEPSVNFLKSPKDNVDDPTGNFRSGPLTGWRVFLLLLCALLGIVVCAVVGAVVFQKRQERNKRFY
No structure currently available in the PDB RCSB Databank.
Structural models
SWISS-MODEL structural models
The location of the lectin domain structural model is: 50-277
We infer [0.28, 0.77] Å as the interval of error of this structural model.
Template 1: 2DUR chain: A, P49256, NP_001003258.1, sequence identity: 99.1%, coverage: 99.6%, location in sequence: 51-301, (51-301 in PDB).
Template 2: 1R1Z chain: A, Q62902, NP_446338.1, sequence identity: 35.1%, coverage: 98.2%, location in sequence: 28-277, (28-277 in PDB).
Template 3: 4GKY chain: A, P49257, NP_005561.1, sequence identity: 34.2%, coverage: 98.2%, location in sequence: 41-269, (41-269 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
We infer [0.28, 0.77] Å as the interval of error of this structural model.
Template 1: 2DUR chain: A, P49256, NP_001003258.1, sequence identity: 99.1%, coverage: 99.6%, location in sequence: 51-301, (51-301 in PDB).
Template 2: 1R1Z chain: A, Q62902, NP_446338.1, sequence identity: 35.1%, coverage: 98.2%, location in sequence: 28-277, (28-277 in PDB).
Template 3: 4GKY chain: A, P49257, NP_005561.1, sequence identity: 34.2%, coverage: 98.2%, location in sequence: 41-269, (41-269 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
- White matter DNA methylation profiling reveals deregulation of HIP1, LMAN2, MOBP, and other loci in multiple system atrophy. [31535203]
- Adaptor Protein CD2AP and L-type Lectin LMAN2 Regulate Exosome Cargo Protein Trafficking through the Golgi Complex. [27765817]
- Parallel quantification of lectin-glycan interaction using ultrafiltration. [23701871]
- Site-specific N-linked glycosylation of receptor guanylyl cyclase C regulates ligand binding, ligand-mediated activation and interaction with vesicular integral membrane protein 36, VIP36. [23269669]
- Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. [22703881]
- Detection of weak sugar binding activity of VIP36 using VIP36-streptavidin complex and membrane-based sugar chains. [17169971]
- Sugar-binding properties of VIP36, an intracellular animal lectin operating as a cargo receptor. [16129679]
- VIPL, a VIP36-like membrane protein with a putative function in the export of glycoproteins from the endoplasmic reticulum. [12878160]
- Profile-based data base scanning for animal L-type lectins and characterization of VIPL, a novel VIP36-like endoplasmic reticulum protein. [12609988]
- Quantitative ER <--> Golgi transport kinetics and protein separation upon Golgi exit revealed by vesicular integral membrane protein 36 dynamics in live cells. [11359937]
UniProt Main References (6 PubMed Identifiers)
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
- VIP36 localisation to the early secretory pathway. [10444376]
- Identification and quantification of N-linked glycoproteins using hydrazide chemistry, stable isotope labeling and mass spectrometry. [12754519]
- Initial characterization of the human central proteome. [21269460]
- An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. [24275569]
- N-terminome analysis of the human mitochondrial proteome. [25944712]
RNA
RNA (Transcript ID: NM_006816.3)
m7G-5')ppp(5'-AGUGGCCGAGAGGAGAGGAGAAUGGCGGCGGAAGGCUGGAUUUGGCGUUGGGGCUGGGGCCGGCGGUGCCUGGGAAGGCCUGGGCUUCUCGGCCCCGGCCCUGGCCCCACUACACCUCUCUUUCUUCUUUUGUUGUUGGGGUCUGUGACUGCGGAUAUAACUGACGGCAACAGUGAACAUCUCAAGCGGGAGCAUUCGCUCAUUAAGCCCUACCAAGGGGUCGGUUCCAGCUCUAUGCCCCUCUGGGACUUCCAGGGCAGCACUAUGCUCACGAGCCAGUACGUACGUCUGACCCCUGACGAGCGCAGCAAAGAGGGCUCUAUCUGGAACCACCAGCCGUGCUUCCUCAAAGACUGGGAAAUGCACGUCCACUUCAAAGUCCACGGCACAGGGAAGAAGAACCUCCAUGGAGACGGCAUCGCCUUGUGGUACACCCGGGACCGCCUCGUGCCAGGGCCUGUGUUUGGAAGCAAAGAUAACUUCCACGGCUUAGCCAUCUUCCUGGACACCUACCCCAAUGAUGAGACCACUGAGCGCGUGUUCCCGUACAUCUCGGUGAUGGUGAACAAUGGCUCCCUGUCCUACGACCACAGCAAGGAUGGGCGCUGGACCGAGCUGGCGGGCUGCACGGCUGACUUCCGCAACCGCGAUCACGACACCUUCCUGGCUGUGCGCUACUCCCGGGGCCGUCUGACGGUGAUGACCGACCUGGAGGACAAGAACGAGUGGAAGAACUGCAUUGACAUCACGGGAGUGCGCCUGCCCACCGGCUACUACUUCGGGGCCUCCGCCGGCACCGGCGACCUGUCUGACAAUCAUGACAUCAUCUCCAUGAAGCUGUUCCAGCUGAUGGUGGAGCACACGCCCGACGAGGAGAGCAUCGACUGGACCAAGAUCGAGCCCAGCGUCAACUUCCUCAAGUCGCCCAAAGACAACGUGGACGACCCCACGGGGAACUUCCGCAGCGGGCCCCUGACGGGGUGGCGGGUGUUCCUGCUGCUGCUGUGCGCUCUCCUGGGCAUCGUUGUCUGCGCCGUGGUGGGGGCCGUGGUGUUCCAGAAGCGGCAGGAGCGGAACAAGCGCUUCUACUGAGUGGCGCCUCCGGCGGGGCCUGUCCCUGGGCCCAGGAGCCAAUGUGAACUUUUUUUUUUACCGGGAUUAUAAAAGAACAACAAGAUGACCUUAUUUCUUAACUGUUUCAAAUAAAUGAUUAAAGUAUUUUCAUACAUUUUGCUUCUUGCCCAGCAGGGACAGGUGGCAGAGCCGAGGCUUAGGGUCUGGCACCCCCCACAGCUGGAGACGGAGGCUCUCCUGGGGCUGGUGUCUCAGGAGCAGGGGUCUGUGUCUACAGAUGGGCUGUGGCCCCUGCAGGCAGCUGUUGAACACUGGAGGGUCCCCCGGACCACACUGGGGUGGGCUCCUGAGGACGUGGGGAAGUGAUUUUGUUUUGUGGUGUGUGGCACGUGUGGCGACGGAUAAGGCCUGAACUGGGAAACCCAGGCCUUCCUGUUCACCCUGAGCUGCUUCCUGAGACAGAUGCUCAAGUGAGGCUGCAGGCGCGGUGUGGUGGGGCCGAGUGUGACCGUUUGCUAAAUAAAGUGAAAUACCCAA-3'- Poly-A tail - Coding region
DNA
DNA (Gene ID: 10960)
lectin, mannose binding 2
strand -
GP36B, VIP36
NCBI CDS gene sequence (1071 bp)
5'-ATGGCGGCGGAAGGCTGGATTTGGCGTTGGGGCTGGGGCCGGCGGTGCCTGGGAAGGCCTGGGCTTCTCGGCCCCGGCCCTGGCCCCACTACACCTCTCTTTCTTCTTTTGTTGTTGGGGTCTGTGACTGCGGATATAACTGACGGCAACAGTGAACATCTCAAGCGGGAGCATTCGCTCATTAAGCCCTACCAAGGGGTCGGTTCCAGCTCTATGCCCCTCTGGGACTTCCAGGGCAGCACTATGCTCACGAGCCAGTACGTACGTCTGACCCCTGACGAGCGCAGCAAAGAGGGCTCTATCTGGAACCACCAGCCGTGCTTCCTCAAAGACTGGGAAATGCACGTCCACTTCAAAGTCCACGGCACAGGGAAGAAGAACCTCCATGGAGACGGCATCGCCTTGTGGTACACCCGGGACCGCCTCGTGCCAGGGCCTGTGTTTGGAAGCAAAGATAACTTCCACGGCTTAGCCATCTTCCTGGACACCTACCCCAATGATGAGACCACTGAGCGCGTGTTCCCGTACATCTCGGTGATGGTGAACAATGGCTCCCTGTCCTACGACCACAGCAAGGATGGGCGCTGGACCGAGCTGGCGGGCTGCACGGCTGACTTCCGCAACCGCGATCACGACACCTTCCTGGCTGTGCGCTACTCCCGGGGCCGTCTGACGGTGATGACCGACCTGGAGGACAAGAACGAGTGGAAGAACTGCATTGACATCACGGGAGTGCGCCTGCCCACCGGCTACTACTTCGGGGCCTCCGCCGGCACCGGCGACCTGTCTGACAATCATGACATCATCTCCATGAAGCTGTTCCAGCTGATGGTGGAGCACACGCCCGACGAGGAGAGCATCGACTGGACCAAGATCGAGCCCAGCGTCAACTTCCTCAAGTCGCCCAAAGACAACGTGGACGACCCCACGGGGAACTTCCGCAGCGGGCCCCTGACGGGGTGGCGGGTGTTCCTGCTGCTGCTGTGCGCTCTCCTGGGCATCGTTGTCTGCGCCGTGGTGGGGGCCGTGGTGTTCCAGAAGCGGCAGGAGCGGAACAAGCGCTTCTACTGA-3'
By using this site you agree to our privacy policy.
Please confirm you agree with the privacy policy before using the site.
How to cite
