NCBI Summary
The protein encoded by this gene is a soluble beta-galactoside binding lectin. The encoded protein is found as a homodimer and can bind to lymphotoxin-alpha. A single nucleotide polymorphism in an intron of this gene can alter the transcriptional level of the protein, with a resultant increased risk of myocardial infarction. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_006489)
Galectin 2
Galectin-2 (Gal-2) (Beta-galactoside-binding lectin L-14-II) (HL14) (Lactose-binding lectin 2) (S-Lac lectin 2)
LGALS2
galectin 2
Undefined
Curated
galectin-like
S-Type Lectins - Prototypical
b-sandwich / ConA-like
0.416
Protein sequence and protein families (fasta) (132 amino acids) Download
MTGELEVKNMDMKPGSTLKITGSIADGTDGFVINLGQGTDKLNLHFNPRFSESTIVCNSLDGSNWGQEQREDHLCFSPGSEVKFTVTFESDKFKVKLPDGHELTFPNRLGHSHLSYLSVRGGFNMSSFKLKE
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.

Ligand
Glycan ligands from structural data
bGal14Glc
Gal(b1-4)Glc
References
NCBI References (10 PubMed Identifiers)
  • Syndecan 4, galectin 2, and death receptor 3 (DR3) as novel proteins in pathophysiology of preeclampsia. [31608721]
  • Genome-wide CRISPR screen identifies LGALS2 as an oxidative stress-responsive gene with an inhibitory function on colon tumor growth. [33110234]
  • A reference map of the human binary protein interactome. [32296183]
  • Placental Galectin-2 Expression in Gestational Diabetes: A Systematic, Histological Analysis. [32244351]
  • Extensive disruption of protein interactions by genetic variants across the allele frequency spectrum in human populations. [31515488]
  • X-ray crystal structure of the human dimeric S-Lac lectin, L-14-II, in complex with lactose at 2.9-A resolution. [8262940]
  • Crystallization and preliminary X-ray diffraction analysis of the human dimeric S-Lac lectin (L-14-II). [8411163]
  • Isolation and expression of a gene encoding L-14-II, a new human soluble lactose-binding lectin. [1375225]
  • Genomic sequence and organization of two members of a human lectin gene family. [1988031]
  • Evidence that a human soluble beta-galactoside-binding lectin is encoded by a family of genes. [3020551]
UniProt Main References (4 PubMed Identifiers)
  • A genome annotation-driven approach to cloning the human ORFeome. [15461802]
  • The DNA sequence of human chromosome 22. [10591208]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • The consensus coding sequences of human breast and colorectal cancers. [16959974]
RNA
RNA (Transcript ID: NM_006498.3)
galectin 2
m7G-5')ppp(5'-CUGUUUGUGCUGGGUACUGGGAGAUGCAGGCGGGGAGACACAAGGUAGAAGGGGCAAAGUCCUCACCUAGGACCUUGAGGGAGUUAAUGUGUAAUAUUCUAGGAUAUAAGCUUGACCACGAGUUGAGACCCUGAGCACAGGCCUCCAGGAGCCGCUGGGAGCUGCCGCCAGGAGCUGUCACCAUGACGGGGGAACUUGAGGUUAAGAACAUGGACAUGAAGCCGGGGUCAACCCUGAAGAUCACAGGCAGCAUCGCCGAUGGCACUGAUGGCUUUGUAAUUAAUCUGGGCCAGGGGACAGACAAGCUGAACCUGCAUUUCAACCCUCGCUUCAGCGAAUCCACCAUUGUCUGCAACUCAUUGGACGGCAGCAACUGGGGGCAAGAACAACGGGAAGAUCACCUGUGCUUCAGCCCAGGGUCAGAGGUCAAGUUCACAGUGACCUUUGAGAGUGACAAAUUCAAGGUGAAGCUGCCAGAUGGGCACGAGCUGACUUUUCCCAACAGGCUGGGUCACAGCCACCUGAGCUACCUGAGCGUAAGGGGCGGGUUCAACAUGUCCUCUUUCAAGUUAAAAGAAUAAAAGACUUCCAGCCGA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 3957)
galectin 2
strand -
HL14
NCBI CDS gene sequence (399 bp)
5'-ATGACGGGGGAACTTGAGGTTAAGAACATGGACATGAAGCCGGGGTCAACCCTGAAGATCACAGGCAGCATCGCCGATGGCACTGATGGCTTTGTAATTAATCTGGGCCAGGGGACAGACAAGCTGAACCTGCATTTCAACCCTCGCTTCAGCGAATCCACCATTGTCTGCAACTCATTGGACGGCAGCAACTGGGGGCAAGAACAACGGGAAGATCACCTGTGCTTCAGCCCAGGGTCAGAGGTCAAGTTCACAGTGACCTTTGAGAGTGACAAATTCAAGGTGAAGCTGCCAGATGGGCACGAGCTGACTTTTCCCAACAGGCTGGGTCACAGCCACCTGAGCTACCTGAGCGTAAGGGGCGGGTTCAACATGTCCTCTTTCAAGTTAAAAGAATAA-3'
NCBI CDS gene sequence with introns (location: 37570263.. 37579905) (9643 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 37570248.. 37580087) (9840 bp)Download
NCBI gene sequence (location: [37570248.. 37580087 + 1000]) (10840 bp)Download
Cite How to cite