NCBI Summary
This gene encodes a member of the family of neuronal petraxins, synaptic proteins that are related to C-reactive protein. This protein is involved in excitatory synapse formation. It also plays a role in clustering of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)-type glutamate receptors at established synapses, resulting in non-apoptotic cell death of dopaminergic nerve cells. Up-regulation of this gene in Parkinson disease (PD) tissues suggests that the protein may be involved in the pathology of PD. [provided by RefSeq, Feb 2009].
Protein
Protein (NP_002514)
Neuronal pentraxin 2
Neuronal pentraxin-2 (NP2) (Neuronal pentraxin II) (NP-II)
NPTX2
neuronal pentraxin 2
Undefined
Very low evidence
Pentraxin
L-Type Lectins
b-sandwich / ConA-like
Uncharacterised
0.382
Undefined
Protein sequence and protein families (fasta) (431 amino acids) Download
MLALLAASVALAVAAGAQDSPAPGSRFVCTALPPEAVHAGCPLPAMPMQGGAQSPEEELRAAVLQLRETVVQQKETLGAQREAIRELTGKLARCEGLAGGKARGAGATGKDTMGDLPRDPGHVVEQLSRSLQTLKDRLESLEHQLRANVSNAGLPGDFREVLQQRLGELERQLLRKVAELEDEKSLLHNETSAHRQKTESTLNALLQRVTELERGNSAFKSPDAFKVSLPLRTNYLYGKIKKTLPELYAFTICLWLRSSASPGIGTPFSYAVPGQANEIVLIEWGNNPIELLINDKVAQLPLFVSDGKWHHICVTWTTRDGMWEAFQDGEKLGTGENLAPWHPIKPGGVLILGQEQDTVGGRFDATQAFVGELSQFNIWDRVLRAQEIVNIANCSTNMPGNIIPWVDNNVDVFGGASKWPVETCEERLLDL
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.54, 1.98] ÅDownload
The location of the lectin domain structural model is: 223-424
We infer [1.54, 1.98] Å as the interval of error of this structural model.
Template 1: 3PVN chain: A, P02741, NP_000558.2, sequence identity: 29.2%, coverage: 95.5%, location in sequence: 19-224, (1-206 in PDB).
Template 2: 1HAS chain: A, P07629, NP_0NO0REFSEQ0.0, sequence identity: 27.7%, coverage: 98.0%, location in sequence: 23-234, (1-212 in PDB).
Template 3: 1GYK chain: A, P02743, NP_001630.1, sequence identity: 26.7%, coverage: 98.0%, location in sequence: 20-223, (1-204 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Neuronal pentraxin II (NPTX2) hypermethylation promotes cell proliferation but inhibits cell cycle arrest and apoptosis in gastric cancer cells by suppressing the p53 signaling pathway. [33896384]
  • Diagnostic value of neuronal pentraxin II methylation in patients with pancreatic cancer: Meta-analysis. [34105851]
  • Cerebrospinal fluid profile of NPTX2 supports role of Alzheimer's disease-related inhibitory circuit dysfunction in adults with Down syndrome. [32807227]
  • Neuronal pentraxin 2: a synapse-derived CSF biomarker in genetic frontotemporal dementia. [32273328]
  • Frontal cortex chitinase and pentraxin neuroinflammatory alterations during the progression of Alzheimer's disease. [32066474]
  • No association between the neuronal pentraxin II gene polymorphism and autism. [17408830]
  • Specific sensitivity of small cell lung cancer cell lines to the snake venom toxin taipoxin. [16115696]
  • Biochemical interactions of the neuronal pentraxins. Neuronal pentraxin (NP) receptor binds to taipoxin and taipoxin-associated calcium-binding protein 49 via NP1 and NP2. [10748068]
  • Neuronal pentraxin receptor, a novel putative integral membrane pentraxin that interacts with neuronal pentraxin 1 and 2 and taipoxin-associated calcium-binding protein 49. [9261167]
  • Human neuronal pentraxin II (NPTX2): conservation, genomic structure, and chromosomal localization. [8530029]
UniProt Main References (3 PubMed Identifiers)
  • Human chromosome 7: DNA sequence and biology. [12690205]
  • The DNA sequence of human chromosome 7. [12853948]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
RNA
RNA (Transcript ID: NM_002523.3)
neuronal pentraxin 2
m7G-5')ppp(5'-AGAGUGCCGAGCAGCGCGGUGGGUGCGGCUGUGAGACGGCAGGAGACUUCUGCCCCGCGGUGCACGCGACCCUCGAGACGACAGCGCGGCUACUGCCAGCAGCGAAGGCGCCUCCCGCGGAGCGCCCCGACGGCGCCCGCUCGCCCAUGCCGAGCUGAGCGCGGCAGCGGCGGCGGGAUGCUGGCGCUGCUGGCCGCCAGCGUGGCGCUCGCCGUGGCCGCUGGGGCCCAGGACAGCCCGGCGCCCGGUAGCCGCUUCGUGUGCACGGCACUGCCCCCAGAGGCGGUGCACGCCGGCUGCCCGCUGCCCGCGAUGCCCAUGCAGGGCGGCGCGCAGAGUCCCGAGGAGGAGCUGAGGGCCGCGGUGCUGCAGCUGCGCGAGACCGUCGUGCAGCAGAAGGAGACGCUGGGCGCGCAGCGCGAGGCCAUCCGCGAGCUCACGGGCAAGCUAGCGCGCUGCGAGGGGCUGGCGGGCGGCAAGGCGCGCGGCGCGGGGGCCACGGGCAAGGACACUAUGGGCGACCUGCCGCGGGACCCCGGCCACGUCGUGGAGCAGCUCAGCCGCUCGCUGCAGACCCUCAAGGACCGCCUGGAGAGCCUCGAGCACCAGCUCAGAGCAAACGUGUCCAAUGCUGGGCUGCCCGGCGACUUCCGCGAGGUGCUCCAGCAGCGGCUGGGGGAGCUGGAGAGGCAGCUUCUGCGCAAGGUGGCAGAGCUGGAGGACGAGAAGUCCCUGCUGCACAAUGAGACCUCGGCUCACCGGCAGAAGACCGAGAGCACCCUGAACGCGCUGCUGCAGAGGGUCACCGAGCUGGAGCGAGGCAAUAGCGCCUUUAAGUCACCAGAUGCGUUCAAGGUGUCCCUCCCACUCCGCACAAACUACCUAUACGGCAAGAUCAAGAAGACGCUGCCUGAGCUGUACGCCUUCACCAUCUGCCUGUGGCUGCGGUCCAGCGCCUCACCAGGCAUUGGCACCCCCUUCUCCUAUGCGGUGCCAGGGCAGGCCAACGAGAUCGUGCUGAUCGAGUGGGGCAACAACCCCAUCGAGCUGCUCAUCAACGACAAGGUUGCGCAGCUGCCCCUGUUUGUCAGUGACGGCAAGUGGCACCACAUCUGUGUCACCUGGACGACACGGGAUGGCAUGUGGGAGGCAUUCCAGGACGGAGAGAAGCUGGGCACUGGGGAGAACCUGGCCCCCUGGCACCCCAUCAAGCCCGGGGGCGUGCUGAUCCUUGGACAAGAGCAGGACACCGUGGGGGGUAGGUUUGAUGCCACUCAGGCAUUUGUCGGGGAGCUCAGCCAGUUCAACAUAUGGGACCGCGUCCUUCGCGCACAAGAAAUUGUCAACAUCGCCAACUGCUCCACAAACAUGCCGGGCAACAUCAUCCCGUGGGUGGACAAUAACGUCGAUGUGUUCGGAGGGGCCUCCAAGUGGCCCGUGGAGACGUGUGAGGAGCGUCUCCUUGACUUGUAGCCGCCUUCUCCUCUGUCCAGGAGGCCGGGAUCAGGCUGUUGCCAUGGAAGUUCAGGGCCAUAGACUGCCCCACUUAAACUCUUGUCAGUCUGGGCUCAGGGUUCCCAGAGCUCAUUCCCCAGGAAUCUCUAAGACCAGGGCUGGGGCAGUGUCUGUCACUGGCUUGUUUGUUCCCUACCAAUAUUCUGUUGCUGUUUGAAGUAGUGCCAGGGUCCCCUGGGAAGAUGCCCCCAAGACACCUGCCCCAAGUGGGUGGAUAUCUGCCUUCCUGCUGCAAGUGGAGGCAGGUCCAGCAGCCCCUCUUCAGAGCCCCUGUAAAUGCUAUCGCAGCCUGAGUCCUGCCGCCUUCCAGUUCCUUGGUGUCCCGUGCACCCCUUCUGUCUGUCCCCUUUCAUGGCUGUGCAGCCGUCCCGCUGGAGUGGCCAUGUCCCUUGUGCAUUGAGUGCAUCCCCGCUGGUGACUAAGCUCGCAGCAAGCGGCUACCCCCCGAUCUGCAAAAGGGCCUCUCCCUUUGUGUUCUAUACAUUGUGAAUCUUCCCGUCUGAAGAACGCCCAGCCUGCCCAGACAAAGCCCCGCCUUCCCCAAAGCAGAGGGGCUGUCUGUGUCUCCAGAAAGGGGACAUCGGGGGGGAGGGGGGCUCAGAAAGGAGAAGGGCUGUGAUCUCCGGUCCCUUCCCCCAUCAUCCUUCCUUAGACUGAUGCUUUGACUGAAUCAUCACUAGCUAUGGCAUUAAAAGGCCUCUCUUCUCAUCUGGUGCCAAAGGUUCCGUUGCAGCUUUUUACAACCAUCCGGUGUGGUUUGGAGGAUUUGUUUUUUUUUUUUCCCAACAGAAAAGAACAGCCAUUAGAAGAAGGCUCCCAUUUUCUGAUGUUCCGCCCCACUGUGAAGAGUGUGCUCGUUUUAAAUUCAUGUUGAUUCUUGUAAGCACUGGACUGUCUUCAUCAAGUAUUUCCCUACAGAACUCCUCAAGAAAACAGAGAUCAUUUGGCUAGAGAUUGUCUGAGUGACUCCAAGCUACUCACUGUAUUGGACGGGAGUAGUAAUUUAUUUUAAAGAUAAAGUGACUAAGUGGGGAAAUUUAUAAAGCUAAAUAUUAUAUAUUUUAUUUUUCAUACAUGUUUGAAGUGCAAAUCUGUGGAUAUUCCAUUUGUAGGACCAAGUCGACAUGCCCAUCCUGACAUUGUAUGCUACGAGAACUCUUCUGAUGAUGGAAUUUCGAUUAAAGUGCACUGAAAGAUG-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 4885)
neuronal pentraxin 2
strand +
NCBI CDS gene sequence (1296 bp)
5'-ATGCTGGCGCTGCTGGCCGCCAGCGTGGCGCTCGCCGTGGCCGCTGGGGCCCAGGACAGCCCGGCGCCCGGTAGCCGCTTCGTGTGCACGGCACTGCCCCCAGAGGCGGTGCACGCCGGCTGCCCGCTGCCCGCGATGCCCATGCAGGGCGGCGCGCAGAGTCCCGAGGAGGAGCTGAGGGCCGCGGTGCTGCAGCTGCGCGAGACCGTCGTGCAGCAGAAGGAGACGCTGGGCGCGCAGCGCGAGGCCATCCGCGAGCTCACGGGCAAGCTAGCGCGCTGCGAGGGGCTGGCGGGCGGCAAGGCGCGCGGCGCGGGGGCCACGGGCAAGGACACTATGGGCGACCTGCCGCGGGACCCCGGCCACGTCGTGGAGCAGCTCAGCCGCTCGCTGCAGACCCTCAAGGACCGCCTGGAGAGCCTCGAGCACCAGCTCAGAGCAAACGTGTCCAATGCTGGGCTGCCCGGCGACTTCCGCGAGGTGCTCCAGCAGCGGCTGGGGGAGCTGGAGAGGCAGCTTCTGCGCAAGGTGGCAGAGCTGGAGGACGAGAAGTCCCTGCTGCACAATGAGACCTCGGCTCACCGGCAGAAGACCGAGAGCACCCTGAACGCGCTGCTGCAGAGGGTCACCGAGCTGGAGCGAGGCAATAGCGCCTTTAAGTCACCAGATGCGTTCAAGGTGTCCCTCCCACTCCGCACAAACTACCTATACGGCAAGATCAAGAAGACGCTGCCTGAGCTGTACGCCTTCACCATCTGCCTGTGGCTGCGGTCCAGCGCCTCACCAGGCATTGGCACCCCCTTCTCCTATGCGGTGCCAGGGCAGGCCAACGAGATCGTGCTGATCGAGTGGGGCAACAACCCCATCGAGCTGCTCATCAACGACAAGGTTGCGCAGCTGCCCCTGTTTGTCAGTGACGGCAAGTGGCACCACATCTGTGTCACCTGGACGACACGGGATGGCATGTGGGAGGCATTCCAGGACGGAGAGAAGCTGGGCACTGGGGAGAACCTGGCCCCCTGGCACCCCATCAAGCCCGGGGGCGTGCTGATCCTTGGACAAGAGCAGGACACCGTGGGGGGTAGGTTTGATGCCACTCAGGCATTTGTCGGGGAGCTCAGCCAGTTCAACATATGGGACCGCGTCCTTCGCGCACAAGAAATTGTCAACATCGCCAACTGCTCCACAAACATGCCGGGCAACATCATCCCGTGGGTGGACAATAACGTCGATGTGTTCGGAGGGGCCTCCAAGTGGCCCGTGGAGACGTGTGAGGAGCGTCTCCTTGACTTGTAG-3'
NCBI CDS gene sequence with introns (location: 98617462.. 98628629) (11168 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 98617285.. 98629869) (12585 bp)Download
NCBI gene sequence (location: [98617285 - 1000].. 98629869) (13585 bp)Download
Cite How to cite