NCBI Summary
This gene encodes a member of the P-type lectin family. P-type lectins play a critical role in lysosome function through the specific transport of mannose-6-phosphate-containing acid hydrolases from the Golgi complex to lysosomes. The encoded protein functions as a homodimer and requires divalent cations for ligand binding. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome X. [provided by RefSeq, May 2011].
Protein
Protein (NP_002346)
CD-MPR - Cation-dependent mannose-6-phosphate receptor
Cation-dependent mannose-6-phosphate receptor (CD Man-6-P receptor) (CD-MPR) (46 kDa mannose 6-phosphate receptor) (MPR 46)
M6PR
mannose-6-phosphate receptor, cation dependent
Undefined
Curated
P-type lectin
P-Type Lectins
b-barrel
Mannose 6-phosphate
0.378
MFPFYSCWRTGLLLLLLAVAVRESWQTEEKTCDLVGEKGKESEKELALVKRLKPLFNKSFESTVGQGSDTYIYIFRVCREAGNHTSGAGLVQINKSNGKETVVGRLNETHIFNGSNWIMLIYKGGDEYDNHCGKEQRRAVVMISCNRHTLADNFNPVSEERGKVQDCFYLFEMDSSLACSPEISHLSVGSILLVTFASLVAVYVVGGFLYQRLVVGAKGMEQFPHLAFWQDLGNLVADGCDFVCRSKPRNVPAAYRGVGDDQLGEESEERDDHLLPM
Mol* PDB structure viewer
Either no PDB or existing PDB of non-glycosylated form
Structural models
SWISS-MODEL structural models
The location of the lectin domain structural model is: 25-181
We infer [0.42, 0.85] Å as the interval of error of this structural model.
Template 1: 2RL8 chain: A, P11456, NP_786973.1, sequence identity: 89.2%, coverage: 96.2%, location in sequence: 32-182, (4-154 in PDB).
Template 2: 1Q25 chain: A, P08169, NP_776777.1, sequence identity: 22.9%, coverage: 91.7%, location in sequence: 49-476, (5-432 in PDB).
Template 3: 6Z30 chain: A, P11717, NP_000867.3, sequence identity: 21.0%, coverage: 83.4%, location in sequence: 1225-1364, (1225-1364 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
We infer [0.42, 0.85] Å as the interval of error of this structural model.
Template 1: 2RL8 chain: A, P11456, NP_786973.1, sequence identity: 89.2%, coverage: 96.2%, location in sequence: 32-182, (4-154 in PDB).
Template 2: 1Q25 chain: A, P08169, NP_776777.1, sequence identity: 22.9%, coverage: 91.7%, location in sequence: 49-476, (5-432 in PDB).
Template 3: 6Z30 chain: A, P11717, NP_000867.3, sequence identity: 21.0%, coverage: 83.4%, location in sequence: 1225-1364, (1225-1364 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
- Golgi-58K can re-localize to late endosomes upon cellular uptake of PS-ASOs and facilitates endosomal release of ASOs. [34244781]
- Monochorionic twins with selective fetal growth restriction: insight from placental whole-transcriptome analysis. [32437666]
- Interactome Mapping Provides a Network of Neurodegenerative Disease Proteins and Uncovers Widespread Protein Aggregation in Affected Brains. [32814053]
- A reference map of the human binary protein interactome. [32296183]
- Mannose 6-phosphate receptors in sorting and transport of lysosomal enzymes. [7640295]
- Differences in the endosomal distributions of the two mannose 6-phosphate receptors. [8099077]
- Isolation and analysis of the human 46-kDa mannose 6-phosphate receptor gene. [1849818]
- The overexpressed human 46-kDa mannose 6-phosphate receptor mediates endocytosis and sorting of beta-glucuronidase. [2172972]
- Renin, a secretory glycoprotein, acquires phosphomannosyl residues. [2960682]
- Cloning of a cDNA encoding the human cation-dependent mannose 6-phosphate-specific receptor. [2441386]
UniProt Main References (9 PubMed Identifiers)
- Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
- Sorting of mannose 6-phosphate receptors mediated by the GGAs. [11387475]
- Interaction of the cation-dependent mannose 6-phosphate receptor with GGA proteins. [11886874]
- A quantitative atlas of mitotic phosphorylation. [18669648]
- Glycoproteomics analysis of human liver tissue by combination of multiple enzyme digestion and hydrazide chemistry. [19159218]
- Initial characterization of the human central proteome. [21269460]
- An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. [24275569]
- N-terminome analysis of the human mitochondrial proteome. [25944712]
All isoforms of this gene containing a lectin domain
RNA
RNA (Transcript ID: NM_002355.4)
mannose-6-phosphate receptor, cation dependent, transcript variant 1
m7G-5')ppp(5'-AGAGUGGGGCACAGCGAGGCGCUAGGGGGAACGCUGGCCUCUGAAACUAGCUCUGGGACCGGGGUCUGCGGCCGGCCCCUAGCUGGCCCCGUCUCCCAUCCCCAGAAGGGUAUUCACUGGGGAUUCUGAGCUUUGGCUACUCCAGUUUCCCACGACACGAUGUUCCCUUUCUACAGCUGCUGGAGGACUGGACUGCUACUACUACUCCUGGCUGUGGCAGUGAGAGAAUCCUGGCAGACAGAAGAAAAAACUUGCGACUUGGUAGGAGAAAAGGGUAAAGAGUCAGAGAAAGAGUUGGCUCUAGUGAAGAGGCUGAAACCACUGUUUAAUAAAAGCUUUGAGAGCACUGUGGGCCAGGGUUCAGACACAUACAUCUACAUCUUCAGGGUGUGCCGGGAAGCUGGCAACCACACUUCUGGGGCAGGCCUGGUGCAAAUCAACAAAAGUAAUGGGAAGGAGACAGUGGUAGGGAGACUCAACGAGACUCACAUCUUCAACGGAAGUAAUUGGAUCAUGCUGAUCUAUAAAGGGGGUGAUGAAUAUGACAACCACUGUGGCAAGGAGCAGCGUCGUGCAGUGGUGAUGAUCUCCUGCAAUCGACACACCCUAGCGGACAAUUUUAACCCUGUGUCUGAGGAGCGUGGCAAAGUCCAAGAUUGUUUCUACCUCUUUGAGAUGGAUAGCAGCCUGGCCUGUUCACCAGAGAUCUCCCACCUCAGUGUGGGUUCCAUCUUACUUGUCACGUUUGCAUCACUGGUUGCUGUUUAUGUUGUUGGGGGGUUCCUAUACCAGCGACUGGUAGUGGGAGCCAAAGGAAUGGAGCAGUUUCCCCACUUAGCCUUCUGGCAGGAUCUUGGCAACCUGGUAGCAGAUGGCUGUGACUUUGUCUGCCGUUCUAAACCUCGAAAUGUGCCUGCAGCAUAUCGUGGUGUGGGGGAUGACCAGCUGGGGGAGGAGUCAGAAGAAAGGGAUGACCAUUUAUUACCAAUGUAGAUUGCACUUUAUAUGUCCAGCCUCUUCCUCAGUCCCCCAAACCAAAGCUACACAGCCAGAUUUCUCAAGCAGUCUCAACUCCAGUCCCUCAUCUCACCCUUACUAUUGCUCUUGCUUUCCAGUUUGCUUUUGAUUUGCAUCUUCUCACUAGUAAAACUGCCUUCCCUUUGUUCCUUAUUUUCUGUUUUUUCUCUAGAGAGGUACAGUUGUAAGUCAGAGUUAAUAUAAUAGGGCCUGUGAAAACAGAGGCUUUUGCAUUGUCUCUUGACAUCAGAAGUUACAAUAGGCAUAUGGGCAAAAUGGUGUAGCAGGCUCACUGGCCGUUUGUUUUUUAAACACAUUUUCACAAGUUUUUGAGACACUGGAUUUCUUUAAUUAAAAAAAAAAUGCCAAGAAACAUUAUUUAUACAGGGUUGAUUGCUUUCAUGUUGUUAUUCUGUACCCUAUAGUAGCCUCCAUGAGAAUCUGGUAUUUCUUGCUGCUUGGAACUACUUUGCAGUGAUUACUUGGUUGCAGUCCAAGUACUCUCGUUUAGUCUGAGCCUGGAGAUGUUCUAGACUUGCUUCUCCCACCUCUGAGAUUAGGACAGGAAAAAUGUGAAAUUUCCCAAUUACAGGAUUAUACGGUACCAUCACAUCAUUUGUGGAAAUUGGGGUGACUGUAUAGCUGGGAUUGGGCUAAGGACUGUGGUCUUAUCUGUCCACAUACAGCCAAAAUGCCUAUCCAGAAAUCCAGUUCGUUGGAAAGGAAAAUUGGUACUCCUGUGCCACAGGGGUUCCAGAAAAGGGAAGUCACUUUACCUUGCGGUGGUGGGAUCCUGAUGUCUUUCAUCCAUUUGUAGUAAAAGCUGGUAAAGCUUUUCUUACUCCUGGUUCCCUACCAGUAUUUCUAAACAUGUCGCACUUUCUCCACAGGCAUGUGGUUUUGACCUUUUUUUCAAUCUUCUAGAAAGGGAACGGAAGCAGAAGUGGGACAUCGAGGGCUCUGCUGUCCUCUGCGCUGGGUGUGGAAUGCUGCUGCACCUGUCCCUUCUGCUGGCUCAGGGAAGUGUCUUCUUGCCCACAUUUCUGUGGGGAAAGGUUUUUAAUCCUCUGAUGCUUCCAUCUUCCUGUUUAGGCCAUGUGCCCAGAAACCUGGACUGAUCUUUCUUUAAUAGUGAACCCCUGGGCCACUGAAGAGUAACAUGGCUCCACUGGACACAAAAGAGGGAUGGAAUCAACAGGCAGGGGGCCUUUUAUAAGCCUUAGGAAAAGAAAAUGAAACUAUUUCAUCUUUGGACUUUUCAAUACUAUUGGAGUGAUUUUUUUCUUUCUAAACAGGGAAAAUAAUGUUACAAAAGCAUCUUUUUUGUUAUUUGUUUGCAUCCCUCCCCCACACCCUGGUGUUUUAAAAUGAAGAAAAAAAACCAUCACCUUUUGUACAAAAACUCUUAAUGAUUAAAAAACAAACAAAACAUA-3'- Poly-A tail
- Coding region
DNA
DNA (Gene ID: 4074)
mannose-6-phosphate receptor, cation dependent
strand -
NCBI CDS gene sequence (834 bp)
5'-ATGTTCCCTTTCTACAGCTGCTGGAGGACTGGACTGCTACTACTACTCCTGGCTGTGGCAGTGAGAGAATCCTGGCAGACAGAAGAAAAAACTTGCGACTTGGTAGGAGAAAAGGGTAAAGAGTCAGAGAAAGAGTTGGCTCTAGTGAAGAGGCTGAAACCACTGTTTAATAAAAGCTTTGAGAGCACTGTGGGCCAGGGTTCAGACACATACATCTACATCTTCAGGGTGTGCCGGGAAGCTGGCAACCACACTTCTGGGGCAGGCCTGGTGCAAATCAACAAAAGTAATGGGAAGGAGACAGTGGTAGGGAGACTCAACGAGACTCACATCTTCAACGGAAGTAATTGGATCATGCTGATCTATAAAGGGGGTGATGAATATGACAACCACTGTGGCAAGGAGCAGCGTCGTGCAGTGGTGATGATCTCCTGCAATCGACACACCCTAGCGGACAATTTTAACCCTGTGTCTGAGGAGCGTGGCAAAGTCCAAGATTGTTTCTACCTCTTTGAGATGGATAGCAGCCTGGCCTGTTCACCAGAGATCTCCCACCTCAGTGTGGGTTCCATCTTACTTGTCACGTTTGCATCACTGGTTGCTGTTTATGTTGTTGGGGGGTTCCTATACCAGCGACTGGTAGTGGGAGCCAAAGGAATGGAGCAGTTTCCCCACTTAGCCTTCTGGCAGGATCTTGGCAACCTGGTAGCAGATGGCTGTGACTTTGTCTGCCGTTCTAAACCTCGAAATGTGCCTGCAGCATATCGTGGTGTGGGGGATGACCAGCTGGGGGAGGAGTCAGAAGAAAGGGATGACCATTTATTACCAATGTAG-3'
By using this site you agree to our privacy policy.
Please confirm you agree with the privacy policy before using the site.