NCBI Summary
The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. This gene product may act as an autocrine negative growth factor that regulates cell proliferation. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_002296)
Galectin 1
Galectin-1 (Gal-1) (14 kDa laminin-binding protein) (HLBP14) (14 kDa lectin) (Beta-galactoside-binding lectin L-14-I) (Galaptin) (HBL) (HPL) (Lactose-binding lectin 1) (Lectin galactoside-binding soluble 1) (Putative MAPK-activating protein PM12) (S-Lac lectin 1)
LGALS1
galectin 1
Undefined
Curated
galectin-like
S-Type Lectins - Prototypical
b-sandwich / ConA-like
MACGLVASNLNLKPGECLRVRGEVAPDAKSFVLNLGKDSNNLCLHFNPRFNAHGDANTIVCNSKDGGAWGTEQREAVFPFQPGSVAEVCITFDQANLTVKLPDGYEFKFPNRLNLEAINYMAADGDFKIKCVAFD
Mol* PDB structure viewerUniLectin3D
Ligand
Glycan ligands from structural data
![](../templates/png/Gal(b1-4)Fruf.png)
![](../templates/png/Gal.png)
![](../templates/png/Gal(b1-4)GlcNAc.png)
![](../templates/png/Gal(b1-3)GlcNAc.png)
![](../templates/png/NeuAc(a2-3)Gal(b1-4)Glc.png)
![](../templates/png/Tal.png)
References
NCBI References (10 PubMed Identifiers)
- Characterizing ligand-induced conformational changes in clinically relevant galectin-1 by HN/H2O (D2O) exchange. [34022292]
- A novel miR1983-TLR7-IFNbeta circuit licenses NK cells to kill glioma cells, and is under the control of galectin-1. [34249474]
- Cross-Linking Effects Dictate the Preference of Galectins to Bind LacNAc-Decorated HPMA Copolymers. [34206141]
- Degraded Arabinogalactans and Their Binding Properties to Cancer-Associated Human Galectins. [33920014]
- Hypoxia Induces Galectin-1 Expression Via Autoinduction of Placental Growth Factor in Retinal Pigment Epithelium Cells. [33599733]
- Treatment of Haemophilus aphrophilus endocarditis with ciprofloxacin. [1602151]
- Isolation of a cDNA clone, encoding a human beta-galactoside binding protein, overexpressed during glucocorticoid-induced cell death. [1713454]
- Genomic sequence and organization of two members of a human lectin gene family. [1988031]
- Localization of endogenous beta-galactoside-binding lectin in human cells and tissues. [1996404]
- Human splenic galaptin: physicochemical characterization. [2383549]
UniProt Main References (33 PubMed Identifiers)
- Cloning and nucleotide sequence of a full-length cDNA for human 14 kDa beta-galactoside-binding lectin. [2719964]
- Molecular cloning, characterization, and expression of a human 14-kDa lectin. [2910856]
- Evidence that the 14 kDa soluble beta-galactoside-binding lectin in man is encoded by a single gene. [2719646]
- Emergence of hormonal and redox regulation of galectin-1 in placental mammals: implication in maternal-fetal immune tolerance. [18824694]
- Large-scale identification and characterization of human genes that activate NF-kappaB and MAPK signaling pathways. [12761501]
- A genome annotation-driven approach to cloning the human ORFeome. [15461802]
- Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
- The DNA sequence of human chromosome 22. [10591208]
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
- Complete amino acid sequence of a beta-galactoside-binding lectin from human placenta. [3065332] Show more
RNA
RNA (Transcript ID: NM_002305.4)
m7G-5')ppp(5'-AUCUCUCUCGGGUGGAGUCUUCUGACAGCUGGUGCGCCUGCCCGGGAACAUCCUCCUGGACUCAAUCAUGGCUUGUGGUCUGGUCGCCAGCAACCUGAAUCUCAAACCUGGAGAGUGCCUUCGAGUGCGAGGCGAGGUGGCUCCUGACGCUAAGAGCUUCGUGCUGAACCUGGGCAAAGACAGCAACAACCUGUGCCUGCACUUCAACCCUCGCUUCAACGCCCACGGCGACGCCAACACCAUCGUGUGCAACAGCAAGGACGGCGGGGCCUGGGGGACCGAGCAGCGGGAGGCUGUCUUUCCCUUCCAGCCUGGAAGUGUUGCAGAGGUGUGCAUCACCUUCGACCAGGCCAACCUGACCGUCAAGCUGCCAGAUGGAUACGAAUUCAAGUUCCCCAACCGCCUCAACCUGGAGGCCAUCAACUACAUGGCAGCUGACGGUGACUUCAAGAUCAAAUGUGUGGCCUUUGACUGAAAUCAGCCAGCCCAUGGCCCCCAAUAAAGGCAGCUGCCUCUGCUCCCUCUGAA-3'- Poly-A tail
- Coding region
DNA
DNA (Gene ID: 3956)
galectin 1
strand +
NCBI CDS gene sequence (408 bp)
5'-ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGA-3'
By using this site you agree to our privacy policy.
Please confirm you agree with the privacy policy before using the site.