NCBI Summary
Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. KLRC3 is a member of the NKG2 group which are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_002252)
Killer cell lectin-like receptor C member 3
NKG2-E type II integral membrane protein (NK cell receptor E) (NKG2-E-activating NK receptor)
KLRC3
killer cell lectin like receptor C3
Undefined
Very low evidence
C-type lectin
Undefined
C-type - Natural Killer NK
a/b mixed / C-type lectin-like
Uncharacterised
NP_002252
3823
Q07444
ENSP00000379716.3
Q07444
0.262
Undefined
neXtProt, PFAM, InterPro
Protein sequence and protein families (fasta) (240 amino acids) Download
MSKQRGTFSEVSLAQDPKWQQRKPKGNKSSISGTEQEIFQVELNLQNASLNHQGIDKIYDCQGLLPPPEKLTAEVLGIICIVLMATVLKTIVLIPFLEQNNSSPNARTQKARHCGHCPEEWITYSNSCYYIGKERRTWEESLQACASKNSSSLLCIDNEEEMKFLASILPSSWIGVFRNSSHHPWVTINGLAFKHEIKDSDHAERNCAMLHVRGLISDQCGSSRIIRRGFIMLTRLVLNS
No structure currently available in the PDB RCSB Databank.
Structural models
AlphaFold v2: AF-Q07444-F1Download
  Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.

SWISS-MODEL structural models
SWISS-MODEL structural model
Modeller structural model (Homology modelling pipeline), Error: [1.58, 2.05] ÅDownload
The location of the lectin domain structural model is: 105-230
We infer [1.58, 2.05] Å as the interval of error of this structural model.
Template 1: 2BPE chain: A, Q6QLQ4, NP_0NO0REFSEQ0.0, sequence identity: 26.2%, coverage: 91.3%, location in sequence: 117-244, (117-244 in PDB).
Template 2: 5M62 chain: A, Q8VBX4, NP_659192.2, sequence identity: 23.8%, coverage: 94.4%, location in sequence: 192-327, (192-327 in PDB).
Template 3: 1SL4 chain: A, Q9NNX6, NP_066978.1, sequence identity: 22.2%, coverage: 90.5%, location in sequence: 255-382, (255-382 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
Expression
Human Protein Atlas
GeneCards
mRNA expression in normal human tissues for KLRC3 Gene
References
NCBI References (10 PubMed Identifiers)
  • Adenylosuccinate lyase enhances aggressiveness of endometrial cancer by increasing killer cell lectin-like receptor C3 expression by fumarate. [29467457]
  • NKG2H-Expressing T Cells Negatively Regulate Immune Responses. [29545803]
  • KLRC3, a Natural Killer receptor gene, is a key factor involved in glioblastoma tumourigenesis and aggressiveness. [27641066]
  • Human NKG2E is expressed and forms an intracytoplasmic complex with CD94 and DAP12. [24935923]
  • Low gene expression levels of activating receptors of natural killer cells (NKG2E and CD94) in patients with fulminant type 1 diabetes. [24177169]
  • Triggering of effector functions on a CD8+ T cell clone upon the aggregation of an activatory CD94/kp39 heterodimer. [10201920]
  • The genomic organization of NKG2C, E, F, and D receptor genes in the human natural killer gene complex. [9683661]
  • Sequence analysis of a 62-kb region overlapping the human KLRC cluster of genes. [9598306]
  • Human natural killer cell receptors involved in MHC class I recognition are disulfide-linked heterodimers of CD94 and NKG2 subunits. [8943374]
  • Natural killer lectin-like receptors have divergent carboxy-termini, distinct from C-type lectins. [8276468]
UniProt Main References (2 PubMed Identifiers)
  • Conservation and variation in human and common chimpanzee CD94 and NKG2 genes. [11751968]
  • The finished DNA sequence of human chromosome 12. [16541075]
All isoforms of this gene containing a lectin domain
NP_031359.2, NP_002252.2
RNA
RNA (Transcript ID: NM_002261.3)
NM_002261.3
killer cell lectin like receptor C3, transcript variant 1
All isoforms of KLRC3 containing a lectin domain
ENST00000396439.7
46..768 (or 10412572.. 10420550)
10412315.. 10420595
NCBI Matured mRNA sequence 1025 NTPDownload 
m7G-5')ppp(5'-GCAGUUAUCAUAGAGCACAGUCCCUCACAUCACACAGCUGCAGAGAUGAGUAAACAAAGAGGAACCUUCUCAGAAGUGAGUCUGGCCCAGGACCCAAAGUGGCAGCAAAGGAAACCUAAAGGCAAUAAAAGCUCCAUUUCAGGAACCGAACAGGAAAUAUUCCAAGUAGAAUUAAACCUUCAAAAUGCUUCUCUGAAUCAUCAAGGGAUUGAUAAAAUAUAUGACUGCCAAGGUUUACUGCCACCUCCAGAAAAGCUCACUGCCGAGGUCCUAGGAAUCAUUUGCAUUGUCCUGAUGGCCACUGUGUUAAAAACAAUAGUUCUUAUUCCUUUCCUGGAGCAGAACAAUUCUUCCCCGAAUGCAAGAACCCAGAAAGCACGUCAUUGUGGCCAUUGUCCUGAGGAGUGGAUUACAUAUUCCAACAGUUGUUAUUACAUUGGUAAGGAAAGAAGAACUUGGGAAGAGAGUUUGCAGGCCUGUGCUUCAAAGAACUCUUCUAGUCUGCUUUGUAUAGAUAAUGAAGAAGAAAUGAAAUUUCUGGCCAGCAUUUUACCUUCCUCAUGGAUUGGUGUGUUUCGUAACAGCAGUCAUCAUCCAUGGGUGACAAUAAAUGGUUUGGCUUUCAAACAUGAGAUAAAAGACUCAGAUCAUGCUGAACGUAACUGUGCAAUGCUACAUGUACGUGGACUUAUAUCAGACCAGUGUGGAUCUUCAAGAAUCAUUAGACGGGGUUUCAUCAUGUUGACCAGGCUGGUCUUGAACUCCUGAGCUCAAGAAAUCAACACAUCUUGGCCUCCCAAGUUGCUGGGAUUACUGACACAAGCCACCGCCCCUGAGUGCUCAUGUACCAUUUAGCUUGUGUUUUAAAAAUCUACUUUUUCUGCCCUCCCUAUUUUUAACUAGAUGAUGUUUUAAAAAUUACUUUUCCCUCUCUAUAUAGUUUGAUUUAAGCAUUAGUCAUUUACAACAAAUAUUAAUAUUAAAAUGCAGACCGUUAUGAUUGGAAAAUAAAUCAAUGAACAAUA-3'- Poly-A tail
  • Coding region
NCBI Matured mRNA sequence viewer
;
More about the NCBI sViewer.
DNA
DNA (Gene ID: 3823)
KLRC3
killer cell lectin like receptor C3
NC_000012.12
12  10412572.. 10420550
10412572.. 10420550
strand -
CCDS41755.1
MGI:1929720
ClinVar, dbVar
ENSG00000205810
NKG2-E
uc001qyi.2
INSDC: L14542
6376
602892
OTTHUMG00000167149
ENA, DDBJ, Monarch
NCBI CDS Gene viewer
More about the NCBI sViewer.
NCBI CDS gene sequence (723 bp)
5'-ATGAGTAAACAAAGAGGAACCTTCTCAGAAGTGAGTCTGGCCCAGGACCCAAAGTGGCAGCAAAGGAAACCTAAAGGCAATAAAAGCTCCATTTCAGGAACCGAACAGGAAATATTCCAAGTAGAATTAAACCTTCAAAATGCTTCTCTGAATCATCAAGGGATTGATAAAATATATGACTGCCAAGGTTTACTGCCACCTCCAGAAAAGCTCACTGCCGAGGTCCTAGGAATCATTTGCATTGTCCTGATGGCCACTGTGTTAAAAACAATAGTTCTTATTCCTTTCCTGGAGCAGAACAATTCTTCCCCGAATGCAAGAACCCAGAAAGCACGTCATTGTGGCCATTGTCCTGAGGAGTGGATTACATATTCCAACAGTTGTTATTACATTGGTAAGGAAAGAAGAACTTGGGAAGAGAGTTTGCAGGCCTGTGCTTCAAAGAACTCTTCTAGTCTGCTTTGTATAGATAATGAAGAAGAAATGAAATTTCTGGCCAGCATTTTACCTTCCTCATGGATTGGTGTGTTTCGTAACAGCAGTCATCATCCATGGGTGACAATAAATGGTTTGGCTTTCAAACATGAGATAAAAGACTCAGATCATGCTGAACGTAACTGTGCAATGCTACATGTACGTGGACTTATATCAGACCAGTGTGGATCTTCAAGAATCATTAGACGGGGTTTCATCATGTTGACCAGGCTGGTCTTGAACTCCTGA-3'
NCBI CDS gene sequence with introns (location: 10412572.. 10420550) (7979 bp)Download
NCBI Gene Viewer (CDS + introns)
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 10412315.. 10420595) (8281 bp)Download
NCBI Gene Viewer (CDS + introns + Untranslated regions)
NCBI gene sequence (location: [10412315.. 10420595 + 1000]) (9281 bp)Download
NCBI Gene Viewer (CDS + introns + Untranslated regions + 1000 dNTP to potentially reach the promotor)
Cite How to cite