NCBI Summary
Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. KLRC3 is a member of the NKG2 group which are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_002252)
Killer cell lectin-like receptor C member 3
NKG2-E type II integral membrane protein (NK cell receptor E) (NKG2-E-activating NK receptor)
KLRC3
killer cell lectin like receptor C3
Undefined
Very low evidence
C-type lectin
Undefined
C-type - Natural Killer NK
a/b mixed / C-type lectin-like
MSKQRGTFSEVSLAQDPKWQQRKPKGNKSSISGTEQEIFQVELNLQNASLNHQGIDKIYDCQGLLPPPEKLTAEVLGIICIVLMATVLKTIVLIPFLEQNNSSPNARTQKARHCGHCPEEWITYSNSCYYIGKERRTWEESLQACASKNSSSLLCIDNEEEMKFLASILPSSWIGVFRNSSHHPWVTINGLAFKHEIKDSDHAERNCAMLHVRGLISDQCGSSRIIRRGFIMLTRLVLNS
No structure currently available in the PDB RCSB Databank.
Structural models
SWISS-MODEL structural models
The location of the lectin domain structural model is: 105-230
We infer [1.58, 2.05] Å as the interval of error of this structural model.
Template 1: 2BPE chain: A, Q6QLQ4, NP_0NO0REFSEQ0.0, sequence identity: 26.2%, coverage: 91.3%, location in sequence: 117-244, (117-244 in PDB).
Template 2: 5M62 chain: A, Q8VBX4, NP_659192.2, sequence identity: 23.8%, coverage: 94.4%, location in sequence: 192-327, (192-327 in PDB).
Template 3: 1SL4 chain: A, Q9NNX6, NP_066978.1, sequence identity: 22.2%, coverage: 90.5%, location in sequence: 255-382, (255-382 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
We infer [1.58, 2.05] Å as the interval of error of this structural model.
Template 1: 2BPE chain: A, Q6QLQ4, NP_0NO0REFSEQ0.0, sequence identity: 26.2%, coverage: 91.3%, location in sequence: 117-244, (117-244 in PDB).
Template 2: 5M62 chain: A, Q8VBX4, NP_659192.2, sequence identity: 23.8%, coverage: 94.4%, location in sequence: 192-327, (192-327 in PDB).
Template 3: 1SL4 chain: A, Q9NNX6, NP_066978.1, sequence identity: 22.2%, coverage: 90.5%, location in sequence: 255-382, (255-382 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Oligomerization and Known Interactions
Can form disulfide-bonded heterodimer with CD94
Annotation
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
- Adenylosuccinate lyase enhances aggressiveness of endometrial cancer by increasing killer cell lectin-like receptor C3 expression by fumarate. [29467457]
- NKG2H-Expressing T Cells Negatively Regulate Immune Responses. [29545803]
- KLRC3, a Natural Killer receptor gene, is a key factor involved in glioblastoma tumourigenesis and aggressiveness. [27641066]
- Human NKG2E is expressed and forms an intracytoplasmic complex with CD94 and DAP12. [24935923]
- Low gene expression levels of activating receptors of natural killer cells (NKG2E and CD94) in patients with fulminant type 1 diabetes. [24177169]
- Triggering of effector functions on a CD8+ T cell clone upon the aggregation of an activatory CD94/kp39 heterodimer. [10201920]
- The genomic organization of NKG2C, E, F, and D receptor genes in the human natural killer gene complex. [9683661]
- Sequence analysis of a 62-kb region overlapping the human KLRC cluster of genes. [9598306]
- Human natural killer cell receptors involved in MHC class I recognition are disulfide-linked heterodimers of CD94 and NKG2 subunits. [8943374]
- Natural killer lectin-like receptors have divergent carboxy-termini, distinct from C-type lectins. [8276468]
UniProt Main References (2 PubMed Identifiers)
- Conservation and variation in human and common chimpanzee CD94 and NKG2 genes. [11751968]
- The finished DNA sequence of human chromosome 12. [16541075]
All isoforms of this gene containing a lectin domain
RNA
RNA (Transcript ID: NM_002261.3)
killer cell lectin like receptor C3, transcript variant 1
m7G-5')ppp(5'-GCAGUUAUCAUAGAGCACAGUCCCUCACAUCACACAGCUGCAGAGAUGAGUAAACAAAGAGGAACCUUCUCAGAAGUGAGUCUGGCCCAGGACCCAAAGUGGCAGCAAAGGAAACCUAAAGGCAAUAAAAGCUCCAUUUCAGGAACCGAACAGGAAAUAUUCCAAGUAGAAUUAAACCUUCAAAAUGCUUCUCUGAAUCAUCAAGGGAUUGAUAAAAUAUAUGACUGCCAAGGUUUACUGCCACCUCCAGAAAAGCUCACUGCCGAGGUCCUAGGAAUCAUUUGCAUUGUCCUGAUGGCCACUGUGUUAAAAACAAUAGUUCUUAUUCCUUUCCUGGAGCAGAACAAUUCUUCCCCGAAUGCAAGAACCCAGAAAGCACGUCAUUGUGGCCAUUGUCCUGAGGAGUGGAUUACAUAUUCCAACAGUUGUUAUUACAUUGGUAAGGAAAGAAGAACUUGGGAAGAGAGUUUGCAGGCCUGUGCUUCAAAGAACUCUUCUAGUCUGCUUUGUAUAGAUAAUGAAGAAGAAAUGAAAUUUCUGGCCAGCAUUUUACCUUCCUCAUGGAUUGGUGUGUUUCGUAACAGCAGUCAUCAUCCAUGGGUGACAAUAAAUGGUUUGGCUUUCAAACAUGAGAUAAAAGACUCAGAUCAUGCUGAACGUAACUGUGCAAUGCUACAUGUACGUGGACUUAUAUCAGACCAGUGUGGAUCUUCAAGAAUCAUUAGACGGGGUUUCAUCAUGUUGACCAGGCUGGUCUUGAACUCCUGAGCUCAAGAAAUCAACACAUCUUGGCCUCCCAAGUUGCUGGGAUUACUGACACAAGCCACCGCCCCUGAGUGCUCAUGUACCAUUUAGCUUGUGUUUUAAAAAUCUACUUUUUCUGCCCUCCCUAUUUUUAACUAGAUGAUGUUUUAAAAAUUACUUUUCCCUCUCUAUAUAGUUUGAUUUAAGCAUUAGUCAUUUACAACAAAUAUUAAUAUUAAAAUGCAGACCGUUAUGAUUGGAAAAUAAAUCAAUGAACAAUA-3'- Poly-A tail - Coding region
DNA
DNA (Gene ID: 3823)
killer cell lectin like receptor C3
strand -
NCBI CDS gene sequence (723 bp)
5'-ATGAGTAAACAAAGAGGAACCTTCTCAGAAGTGAGTCTGGCCCAGGACCCAAAGTGGCAGCAAAGGAAACCTAAAGGCAATAAAAGCTCCATTTCAGGAACCGAACAGGAAATATTCCAAGTAGAATTAAACCTTCAAAATGCTTCTCTGAATCATCAAGGGATTGATAAAATATATGACTGCCAAGGTTTACTGCCACCTCCAGAAAAGCTCACTGCCGAGGTCCTAGGAATCATTTGCATTGTCCTGATGGCCACTGTGTTAAAAACAATAGTTCTTATTCCTTTCCTGGAGCAGAACAATTCTTCCCCGAATGCAAGAACCCAGAAAGCACGTCATTGTGGCCATTGTCCTGAGGAGTGGATTACATATTCCAACAGTTGTTATTACATTGGTAAGGAAAGAAGAACTTGGGAAGAGAGTTTGCAGGCCTGTGCTTCAAAGAACTCTTCTAGTCTGCTTTGTATAGATAATGAAGAAGAAATGAAATTTCTGGCCAGCATTTTACCTTCCTCATGGATTGGTGTGTTTCGTAACAGCAGTCATCATCCATGGGTGACAATAAATGGTTTGGCTTTCAAACATGAGATAAAAGACTCAGATCATGCTGAACGTAACTGTGCAATGCTACATGTACGTGGACTTATATCAGACCAGTGTGGATCTTCAAGAATCATTAGACGGGGTTTCATCATGTTGACCAGGCTGGTCTTGAACTCCTGA-3'
By using this site you agree to our privacy policy.
Please confirm you agree with the privacy policy before using the site.