NCBI Summary
Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. The protein encoded by this gene belongs to the killer cell lectin-like receptor family, also called NKG2 family, which is a group of transmembrane proteins preferentially expressed in NK cells. This family of proteins is characterized by the type II membrane orientation and the presence of a C-type lectin domain. This protein forms a complex with another family member, KLRD1/CD94, and has been implicated in the recognition of the MHC class I HLA-E molecules in NK cells. The genes of NKG2 family members form a killer cell lectin-like receptor gene cluster on chromosome 12. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jan 2015].
Protein
Protein (NP_002250)
Killer cell lectin-like receptor C member 1
NKG2-A/NKG2-B type II integral membrane protein (CD159 antigen-like family member A) (NK cell receptor A) (NKG2-A/B-activating NK receptor) (CD antigen CD159a)
KLRC1
killer cell lectin like receptor C1
Very low evidence
C-type lectin
Undefined
C-type - Natural Killer NK
a/b mixed / C-type lectin-like
MDNQGVIYSDLNLPPNPKRQQRKPKGNKNSILATEQEITYAELNLQKASQDFQGNDKTYHCKDLPSAPEKLIVGILGIICLILMASVVTIVVIPSTLIQRHNNSSLNTRTQKARHCGHCPEEWITYSNSCYYIGKERRTWEESLLACTSKNSSLLSIDNEEEMKFLSIISPSSWIGVFRNSSHHPWVTMNGLAFKHEIKDSDNAELNCAVLQVNRLKSAQCGSSIIYHCKHKL
Mol* PDB structure viewerUniLectin3D
Oligomerization and Known Interactions
Heterodimer with KLRD1; disulfide-linked (PubMed:18083576, PubMed:18332182, PubMed:18448674). KLRD1-KLRC1 heterodimer interacts with peptide-bound HLA-E-B2M heterotrimeric complex (PubMed:18083576). Competes with KLRC2 for its interaction with HLA-E (PubMed:18083576). Interacts (via ITIM) with INPP5D/SHIP-1 and INPPL1/SHIP-2 (via SH2 domain)
Annotation
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
- The CD94/NKG2A inhibitory receptor educates uterine NK cells to optimize pregnancy outcomes in humans and mice. [33887202]
- Potential prognostic value of PD-L1 and NKG2A expression in Indonesian patients with skin nodular melanoma. [34049578]
- Epstein-Barr virus peptides derived from latent cycle proteins alter NKG2A + NK cell effector function. [33203899]
- Interactome Mapping Provides a Network of Neurodegenerative Disease Proteins and Uncovers Widespread Protein Aggregation in Affected Brains. [32814053]
- NKG2A/CD94 Is a New Immune Receptor for HLA-G and Distinguishes Amino Acid Differences in the HLA-G Heavy Chain. [32575403]
- NKG2A complexed with CD94 defines a novel inhibitory natural killer cell receptor. [9034158]
- Human natural killer cell receptors involved in MHC class I recognition are disulfide-linked heterodimers of CD94 and NKG2 subunits. [8943374]
- Genomic structure, chromosome location, and alternative splicing of the human NKG2A gene. [8753859]
- A multigene family on human chromosome 12 encodes natural killer-cell lectins. [8436421]
- DNA sequence analysis of NKG2, a family of related cDNA clones encoding type II integral membrane proteins on human natural killer cells. [2007850]
UniProt Main References (20 PubMed Identifiers)
- Sequence analysis of a 62-kb region overlapping the human KLRC cluster of genes. [9598306]
- The finished DNA sequence of human chromosome 12. [16541075]
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
- Functionally and structurally distinct NK cell receptor repertoires in the peripheral blood of two human donors. [9430220]
- Inhibition of antigen-induced T cell response and antibody-induced NK cell cytotoxicity by NKG2A: association of NKG2A with SHP-1 and SHP-2 protein-tyrosine phosphatases. [9485206]
- HLA-E binds to natural killer cell receptors CD94/NKG2A, B and C. [9486650]
- Surface expression of HLA-E, an inhibitor of natural killer cells, enhanced by human cytomegalovirus gpUL40. [10669413]
- TCR specificity dictates CD94/NKG2A expression by human CTL. [12387742]
- Role that each NKG2A immunoreceptor tyrosine-based inhibitory motif plays in mediating the human CD94/NKG2A inhibitory signal. [12165520]
- HIV-1 infection leads to increased HLA-E expression resulting in impaired function of natural killer cells. [15751767] Show more
All isoforms of this gene containing a lectin domain
RNA
RNA (Transcript ID: NM_002259.5)
killer cell lectin like receptor C1, transcript variant 1
m7G-5')ppp(5'-CCACUCUUGACUCACUCUGAGCCUUCACAGGGCAGUCUGCGAAGAUUGCAGGCAUUGUUUGUUCUUGUCUUGGAUUUAUGCCUUUAAAUUUCACCUUUUAUUACACAGCUAUAGCAGGCCUUUUUAUGAGACUAACCUGGCCUCUCCACUAAAGGAUGUGUGACUUUCUGGGGACAGAAGAGUACAGUCCCUGACAUCACACACUGCAGAGAUGGAUAACCAAGGAGUAAUCUACUCAGACCUGAAUCUGCCCCCAAACCCAAAGAGGCAGCAACGAAAACCUAAAGGCAAUAAAAACUCCAUUUUAGCAACUGAACAGGAAAUAACCUAUGCGGAAUUAAACCUUCAAAAAGCUUCUCAGGAUUUUCAAGGGAAUGACAAAACCUAUCACUGCAAAGAUUUACCAUCAGCUCCAGAGAAGCUCAUUGUUGGGAUCCUGGGAAUUAUCUGUCUUAUCUUAAUGGCCUCUGUGGUAACGAUAGUUGUUAUUCCCUCUACAUUAAUACAGAGGCACAACAAUUCUUCCCUGAAUACAAGAACUCAGAAAGCACGUCAUUGUGGCCAUUGUCCUGAGGAGUGGAUUACAUAUUCCAACAGUUGUUACUACAUUGGUAAGGAAAGAAGAACUUGGGAAGAGAGUUUGCUGGCCUGUACUUCGAAGAACUCCAGUCUGCUUUCUAUAGAUAAUGAAGAAGAAAUGAAAUUUCUGUCCAUCAUUUCACCAUCCUCAUGGAUUGGUGUGUUUCGUAACAGCAGUCAUCAUCCAUGGGUGACAAUGAAUGGUUUGGCUUUCAAACAUGAGAUAAAAGACUCAGAUAAUGCUGAACUUAACUGUGCAGUGCUACAAGUAAAUCGACUUAAAUCAGCCCAGUGUGGAUCUUCAAUAAUAUAUCAUUGUAAGCAUAAGCUUUAGAGGUAAAGCGUUUGCAUUUGCAGUGCAUCAGAUAAAUUGUAUAUUUCUUAAAAUAGAAAUAUAUUAUGAUUGCAUAAAUCUUAAAAUGAAUUAUGUUAUUUGCUCUAAUAAGAAAAUUCUAAAUCAAUUAUUGAAACAGGAUACACACAAUUACUAAAGUACAGACAUCCUAGCAUUUGUGUCGGGCUCAUUUUGCUCAACAUGGUAUUUGUGGUUUUCAGCCUUUCUAAAAGUUGCAUGUUAUGUGAGUCAGCUUAUAGGAAGUACCAAGAACAGUCAAACCCAUGGAGACAGAAAGUAGAAUAGUGGUUGCCAAUGUCUGAGGGAGGUUGAAAUAGGAGAUGACCUCUAACUGAUAGAACGUUACUUUGUGUCGUGAUGAAAACUUUCUAAAUUUCAGUAGUGGUGAUGGUUGUAACUCUGCGAAUAUACUAAACAUCAUUGAUUUUUAAUCAUUUUAAGUGCAUGAAAUGUAUGCUUUGUACACGACACUUCAAUAAAGCUAUCCAGAAAAAAAAAAAAA-3'- Poly-A tail - Coding region
DNA
DNA (Gene ID: 3821)
killer cell lectin like receptor C1
strand -
NKG2-A, NKG2-B, CD159a
NCBI CDS gene sequence (702 bp)
5'-ATGGATAACCAAGGAGTAATCTACTCAGACCTGAATCTGCCCCCAAACCCAAAGAGGCAGCAACGAAAACCTAAAGGCAATAAAAACTCCATTTTAGCAACTGAACAGGAAATAACCTATGCGGAATTAAACCTTCAAAAAGCTTCTCAGGATTTTCAAGGGAATGACAAAACCTATCACTGCAAAGATTTACCATCAGCTCCAGAGAAGCTCATTGTTGGGATCCTGGGAATTATCTGTCTTATCTTAATGGCCTCTGTGGTAACGATAGTTGTTATTCCCTCTACATTAATACAGAGGCACAACAATTCTTCCCTGAATACAAGAACTCAGAAAGCACGTCATTGTGGCCATTGTCCTGAGGAGTGGATTACATATTCCAACAGTTGTTACTACATTGGTAAGGAAAGAAGAACTTGGGAAGAGAGTTTGCTGGCCTGTACTTCGAAGAACTCCAGTCTGCTTTCTATAGATAATGAAGAAGAAATGAAATTTCTGTCCATCATTTCACCATCCTCATGGATTGGTGTGTTTCGTAACAGCAGTCATCATCCATGGGTGACAATGAATGGTTTGGCTTTCAAACATGAGATAAAAGACTCAGATAATGCTGAACTTAACTGTGCAGTGCTACAAGTAAATCGACTTAAATCAGCCCAGTGTGGATCTTCAATAATATATCATTGTAAGCATAAGCTTTAG-3'
By using this site you agree to our privacy policy.
Please confirm you agree with the privacy policy before using the site.