NCBI Summary
Natural killer (NK) cells are lymphocytes that mediate cytotoxicity and secrete cytokines after immune stimulation. Several genes of the C-type lectin superfamily, including the rodent NKRP1 family of glycoproteins, are expressed by NK cells and may be involved in the regulation of NK cell function. The KLRB1 protein contains an extracellular domain with several motifs characteristic of C-type lectins, a transmembrane domain, and a cytoplasmic domain. The KLRB1 protein is classified as a type II membrane protein because it has an external C terminus. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_002249)
Killer cell lectin-like receptor B1
Killer cell lectin-like receptor subfamily B member 1 (C-type lectin domain family 5 member B) (HNKR-P1a) (NKR-P1A) (Natural killer cell surface protein P1A) (CD antigen CD161)
KLRB1
killer cell lectin like receptor B1
Curated
C-type lectin
Undefined
C-type - Natural Killer NK
a/b mixed / C-type lectin-like
Gal / Gal(a1-3)Gal
0.343
Protein sequence and protein families (fasta) (225 amino acids) Download
MDQQAIYAELNLPTDSGPESSSPSSLPRDVCQGSPWHQFALKLSCAGIILLVLVVTGLSVSVTSLIQKSSIEKCSVDIQQSRNKTTERPGLLNCPIYWQQLREKCLLFSHTVNPWNNSLADCSTKESSLLLIRDKDELIHTQNLIRDKAILFWIGLNFSLSEKNWKWINGSFLNSNDLEIRGDAKENSCISISQTSVYSEYCSTEIRWICQKELTPVRNKVYPDS
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • A Pan-Cancer Analysis of CD161, a Potential New Immune Checkpoint. [34305920]
  • C-type lectin-like CD161 is not a co-signalling receptor in gluten-reactive CD4 + T cells. [33368526]
  • Inhibitory CD161 receptor identified in glioma-infiltrating T cells by single-cell analysis. [33592174]
  • Purinergic signaling, DAMPs, and inflammation. [32159362]
  • Transcription/Expression of KLRB1 Gene as A Prognostic Indicator in Human Esophageal Squamous Cell Carcinoma. [32416673]
  • Expression and function of NKRP1A molecule on human monocytes and dendritic cells. [9394825]
  • Phenotypic and functional analysis of CD4+ NKRP1A+ human T lymphocytes. Direct evidence that the NKRP1A molecule is involved in transendothelial migration. [9341779]
  • The human natural killer gene complex is located on chromosome 12p12-p13. [9218532]
  • Expression of human NKRP1A by CD34+ immature thymocytes: NKRP1A-mediated regulation of proliferation and cytolytic activity. [8647203]
  • Human NKR-P1A. A disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. [8077657]
UniProt Main References (8 PubMed Identifiers)
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • IL-12-induced up-regulation of NKRP1A expression in human NK cells and consequent NKRP1A-mediated down-regulation of NK cell activation. [9603467]
  • CD161+ T (NT) cells exist predominantly in human intestinal epithelium as well as in liver. [12100027]
  • Cutting edge: lectin-like transcript 1 is a ligand for the CD161 receptor. [16339512]
  • Cutting edge: lectin-like transcript-1 is a ligand for the inhibitory human NKR-P1A receptor. [16339513]
  • CD161 (human NKR-P1A) signaling in NK cells involves the activation of acid sphingomyelinase. [16455998]
  • Recognition of a carbohydrate xenoepitope by human NKRP1A (CD161). [16925668]
  • Characterization of alternatively spliced transcript variants of CLEC2D gene. [20843815]
RNA
RNA (Transcript ID: NM_002258.3)
killer cell lectin like receptor B1
m7G-5')ppp(5'-CCUUUUGCUGAUUUUGCCUCACAGAAUUGAGAGUUUGUUCUUACACACAAGUUUAAUGCCACCUUCCUCUGUCUGCCAUGGACCAACAAGCAAUAUAUGCUGAGUUAAACUUACCCACAGACUCAGGCCCAGAAAGUUCUUCACCUUCAUCUCUUCCUCGGGAUGUCUGUCAGGGUUCACCUUGGCAUCAAUUUGCCCUGAAACUUAGCUGUGCUGGGAUUAUUCUCCUUGUCUUGGUUGUUACUGGGUUGAGUGUUUCAGUGACAUCCUUAAUACAGAAAUCAUCAAUAGAAAAAUGCAGUGUGGACAUUCAACAGAGCAGGAAUAAAACAACAGAGAGACCGGGUCUCUUAAACUGCCCAAUAUAUUGGCAGCAACUCCGAGAGAAAUGCUUGUUAUUUUCUCACACUGUCAACCCUUGGAAUAACAGUCUAGCUGAUUGUUCCACCAAAGAAUCCAGCCUGCUGCUUAUUCGAGAUAAGGAUGAAUUGAUACACACACAGAACCUGAUACGUGACAAAGCAAUUCUGUUUUGGAUUGGAUUAAAUUUUUCAUUAUCAGAAAAGAACUGGAAGUGGAUAAACGGCUCUUUUUUAAAUUCUAAUGACUUAGAAAUUAGAGGUGAUGCUAAAGAAAACAGCUGUAUUUCCAUCUCACAGACAUCUGUGUAUUCUGAGUACUGUAGUACAGAAAUCAGAUGGAUCUGCCAAAAAGAACUAACACCUGUGAGAAAUAAAGUGUAUCCUGACUCUUGACUAUGAAUCCCAUCUCAAUUUAUUUGCUUCCCAUUACUGAUCUCUGUACUUGUAGCUGCACAUACUAUUGGUACUACCUAAUAGUGCCACAUUUAGUGGCACAAAGUGAACAAUUCUGAGAAUUGACAACUGUUAUGAAUCUUACAGAAGUUCAUGUUUAUCAUAUUCAUUCUAUUAAAUGAGGAAACAGAGACAUAGAGAAAAACGUGCAUCGUUUUAAAGAAACAGUGAUAUUCUAUGGUGAAGGAGUGAAGGAUGUCCCCGAAUAUGCCAGAUUGGUAUAUGAUUGUUUUGUGUUUAAAACAGUGGAGAAAUUGUAGAUUCAGAAAGGGAGAGCUGACCUGUCUCUUCCCGCACGCGGCAAGCCGUGAAGAUUCCUCUGGGAGGGCUAUCCGAGUCAUACAAGGGCAAGAAAAUAGCUCUUAUCGCCAGAGACCUGGAAUUGGAUGCUGCAAUGAACCUGAAUAAAGAUACUUAAUAAACACCUAUCUUUCACCUAUUUUACAGCCCCCCGCAACCAAUAUAUCUCCUAGUGACUCCUCUAGAAAAUUUAUUGCCCCUAGCCAGCUUUUCUUCAUCCUGUCAUUUCUUUUCAAAUUUAUCAUUCUUGGUCUAAAAAGCAUAAAAGCAUCUUGCUUAGGCCACUUCUAUGGAUUUCACUCUCUUGCGAGUUCCUCAUGUACAUGCAAAACGAAUAAAAUGUGUAUACUUUUAUUUUGUUCA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 3820)
killer cell lectin like receptor B1
strand -
CD161, NKR-P1, NKR-P1A, hNKR-P1A, CLEC5B
NCBI CDS gene sequence (678 bp)
5'-ATGGACCAACAAGCAATATATGCTGAGTTAAACTTACCCACAGACTCAGGCCCAGAAAGTTCTTCACCTTCATCTCTTCCTCGGGATGTCTGTCAGGGTTCACCTTGGCATCAATTTGCCCTGAAACTTAGCTGTGCTGGGATTATTCTCCTTGTCTTGGTTGTTACTGGGTTGAGTGTTTCAGTGACATCCTTAATACAGAAATCATCAATAGAAAAATGCAGTGTGGACATTCAACAGAGCAGGAATAAAACAACAGAGAGACCGGGTCTCTTAAACTGCCCAATATATTGGCAGCAACTCCGAGAGAAATGCTTGTTATTTTCTCACACTGTCAACCCTTGGAATAACAGTCTAGCTGATTGTTCCACCAAAGAATCCAGCCTGCTGCTTATTCGAGATAAGGATGAATTGATACACACACAGAACCTGATACGTGACAAAGCAATTCTGTTTTGGATTGGATTAAATTTTTCATTATCAGAAAAGAACTGGAAGTGGATAAACGGCTCTTTTTTAAATTCTAATGACTTAGAAATTAGAGGTGATGCTAAAGAAAACAGCTGTATTTCCATCTCACAGACATCTGTGTATTCTGAGTACTGTAGTACAGAAATCAGATGGATCTGCCAAAAAGAACTAACACCTGTGAGAAATAAAGTGTATCCTGACTCTTGA-3'
NCBI CDS gene sequence with introns (location: 9595274.. 9607839) (12566 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 9594551.. 9607916) (13366 bp)Download
NCBI gene sequence (location: [9594551.. 9607916 + 1000]) (14366 bp)Download
How to cite: Schnider B., M'Rad Y., el Ahmadie J., de Brevern AG., Imberty A., Lisacek F., HumanLectome, an update of UniLectin for the annotation and prediction of human lectins, Nucleic Acids Reasearch doi.org/10.1093/nar/gkad905