NCBI Summary
This gene encodes a member of the calcium dependent lectin superfamily of type II transmembrane receptors. Expression of the encoded protein is induced upon activation of T lymphocytes, and may play a role in proliferation. Furthermore, the protein may act to transmit signals in natural killer cells and platelets. [provided by RefSeq, Aug 2011].
Protein
Protein (NP_001772)
CD69
Early activation antigen CD69 (Activation inducer molecule) (AIM) (BL-AC/P26) (C-type lectin domain family 2 member C) (EA1) (Early T-cell activation antigen p60) (GP32/28) (Leukocyte surface antigen Leu-23) (MLR-3) (CD antigen CD69)
CD69
CD69 molecule
Very low evidence
C-type lectin
Undefined
C-type - Natural Killer NK
a/b mixed / C-type lectin-like
MSSENCFVAENSSLHPESGQENDATSPHFSTRHEGSFQVPVLCAVMNVVFITILIIALIALSVGQYNCPGQYTFSMPSDSHVSSCSEDWVGYQRKCYFISTVKRSWTSAQNACSEHGATLAVIDSEKDMNFLKRYAGREEHWVGLKKEPGHPWKWSNGKEFNNWFNVTGSDKCVFLKNTEVSSMECEKNLYWICNKPYK
Mol* PDB structure viewerUniLectin3D
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
- Prognostic Relevance of Concordant Expression CD69 and CD56 in Response to Bortezomib Combination Therapy in Multiple Myeloma Patients. [34344244]
- T cells selectively filter oscillatory signals on the minutes timescale. [33627405]
- A reference map of the human binary protein interactome. [32296183]
- Increased CD69 expression on activated eosinophils in eosinophilic chronic rhinosinusitis correlates with clinical findings. [31928947]
- Transcriptional regulation of the gene encoding the human C-type lectin leukocyte receptor AIM/CD69 and functional characterization of its tumor necrosis factor-alpha-responsive elements. [7665567]
- CD 69 antigen of human lymphocytes is a calcium-dependent carbohydrate-binding protein. [7887967]
- Structure of the gene coding for the human early lymphocyte activation antigen CD69: a C-type lectin receptor evolutionarily related with the gene families of natural killer cell-specific receptors. [8026529]
- Molecular cloning, expression, and chromosomal localization of the human earliest lymphocyte activation antigen AIM/CD69, a new member of the C-type animal lectin superfamily of signal-transmitting receptors. [8340758]
- Molecular characterization of the early activation antigen CD69: a type II membrane glycoprotein related to a family of natural killer cell activation antigens. [8100776]
- Constitutive expression of CD69 in interspecies T-cell hybrids and locus assignment to human chromosome 12. [1612643]
UniProt Main References (6 PubMed Identifiers)
- Expression cloning of the early activation antigen CD69, a type II integral membrane protein with a C-type lectin domain. [8496594]
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
- Toward a comprehensive characterization of a human cancer cell phosphoproteome. [23186163]
- Crystal structure of human CD69: a C-type lectin-like activation marker of hematopoietic cells. [11101293]
- Crystal structure of the C-type lectin-like domain from the human hematopoietic cell receptor CD69. [11036086]
- Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice. [18959746]
RNA
RNA (Transcript ID: NM_001781.2)
m7G-5')ppp(5'-AGACUCAACAAGAGCUCCAGCAAAGACUUUCACUGUAGCUUGACUUGACCUGAGAUUAACUAGGGAAUCUUGAGAAUAAAGAUGAGCUCUGAAAAUUGUUUCGUAGCAGAGAACAGCUCUUUGCAUCCGGAGAGUGGACAAGAAAAUGAUGCCACCAGUCCCCAUUUCUCAACACGUCAUGAAGGGUCCUUCCAAGUUCCUGUCCUGUGUGCUGUAAUGAAUGUGGUCUUCAUCACCAUUUUAAUCAUAGCUCUCAUUGCCUUAUCAGUGGGCCAAUACAAUUGUCCAGGCCAAUACACAUUCUCAAUGCCAUCAGACAGCCAUGUUUCUUCAUGCUCUGAGGACUGGGUUGGCUACCAGAGGAAAUGCUACUUUAUUUCUACUGUGAAGAGGAGCUGGACUUCAGCCCAAAAUGCUUGUUCUGAACAUGGUGCUACUCUUGCUGUCAUUGAUUCUGAAAAGGACAUGAACUUUCUAAAACGAUACGCAGGUAGAGAGGAACACUGGGUUGGACUGAAAAAGGAACCUGGUCACCCAUGGAAGUGGUCAAAUGGCAAAGAAUUUAACAACUGGUUCAACGUUACAGGGUCUGACAAGUGUGUUUUUCUGAAAAACACAGAGGUCAGCAGCAUGGAAUGUGAGAAGAAUUUAUACUGGAUAUGUAACAAACCUUACAAAUAAUAAGGAAACAUGUUCACUUAUUGACUAUUAUAGAAUGGAACUCAAGGAAAUCUGUGUCAGUGGAUGCUGCUCUGUGGUCCGAAGUCUUCCAUAGAGACUUUGUGAAAAAAAAUUUUAUAGUGUCUUGGGAAUUUUCUUCCAAACAGAACUAUGGAAAAAAAGGAAGAAAUUCCAGGAAAAUCUGCACUGUGGGCUUUUAUUGCCAUGAGCUAGAAGCAUCACAGGUUGACCAAUAACCAUGCCCAAGAAUGAGAAGAAUGACUAUGCAACCUUUGGAUGCACUUUAUAUUAUUUUGAAUCCAGAAAUAAUGAAAUAACUAGGCGUGGACUUACUAUUUAUUGCUGAAUGACUACCAACAGUGAGAGCCCUUCAUGCAUUUGCACUAUUGGAAGGAGUUAGAUGUUGGUACUAGAUACUGAAUGUAAACAAAGGAAUUAUGGCUGGUAACAUAGGUUUUUAGUCUAAUUGAAUCCCUUAAACUCAGGGAGCAUUUAUAAAUGGACAAAUGCUUAUGAAACUAAGAUUUGUAAUAUUUCUCUCUUUUUAGAGAAAUUUGCCAAUUUACUUUGUUAUUUUUCCCCAAAAAGAAUGGGAUGAUCAUGUAUUUAUUUUUUUACUUCCUCAGCUGUAGACAGGUCCUUUUCGAUGGUACAUAUUUCUUUGCCUUUAUAAUCUUUUAUACAGUGUCUUACAGAGAAAAGACAUAAGCAAAGACUAUGAGGAAUAUUUGCAAGACAUAGAAUAGUGUUGGAAAAUGUGCAAUAUGUGAUGUGGCAAAUCUCUAUUAGGAAAUAUUCUGUAAUCUUCAGACCUAGAAUAAUACUAGUCUUAUAAUAGGUUUGUGACUUUCCUAAAUCAAUUCUAUUACGUGCAAUACUUCAAUACUUCAUUUAAAAUAUUUUUAUGUGCAAUAAAAUGUAUUUGUUUGUAUUUUGUGUUCAGUACAAUUAUAAGCUGUUUUUAUAUAUGUGAAAUAAAAGUAGAAUAAACACAA-3'- Poly-A tail
- Coding region
DNA
DNA (Gene ID: 969)
CD69 molecule
strand -
NCBI CDS gene sequence (600 bp)
5'-ATGAGCTCTGAAAATTGTTTCGTAGCAGAGAACAGCTCTTTGCATCCGGAGAGTGGACAAGAAAATGATGCCACCAGTCCCCATTTCTCAACACGTCATGAAGGGTCCTTCCAAGTTCCTGTCCTGTGTGCTGTAATGAATGTGGTCTTCATCACCATTTTAATCATAGCTCTCATTGCCTTATCAGTGGGCCAATACAATTGTCCAGGCCAATACACATTCTCAATGCCATCAGACAGCCATGTTTCTTCATGCTCTGAGGACTGGGTTGGCTACCAGAGGAAATGCTACTTTATTTCTACTGTGAAGAGGAGCTGGACTTCAGCCCAAAATGCTTGTTCTGAACATGGTGCTACTCTTGCTGTCATTGATTCTGAAAAGGACATGAACTTTCTAAAACGATACGCAGGTAGAGAGGAACACTGGGTTGGACTGAAAAAGGAACCTGGTCACCCATGGAAGTGGTCAAATGGCAAAGAATTTAACAACTGGTTCAACGTTACAGGGTCTGACAAGTGTGTTTTTCTGAAAAACACAGAGGTCAGCAGCATGGAATGTGAGAAGAATTTATACTGGATATGTAACAAACCTTACAAATAA-3'
By using this site you agree to our privacy policy.
Please confirm you agree with the privacy policy before using the site.