NCBI Summary
This gene encodes a member of the calcium dependent lectin superfamily of type II transmembrane receptors. Expression of the encoded protein is induced upon activation of T lymphocytes, and may play a role in proliferation. Furthermore, the protein may act to transmit signals in natural killer cells and platelets. [provided by RefSeq, Aug 2011].
Protein
Protein (NP_001772)
CD69
Early activation antigen CD69 (Activation inducer molecule) (AIM) (BL-AC/P26) (C-type lectin domain family 2 member C) (EA1) (Early T-cell activation antigen p60) (GP32/28) (Leukocyte surface antigen Leu-23) (MLR-3) (CD antigen CD69)
CD69
CD69 molecule
Very low evidence
C-type lectin
Undefined
C-type - Natural Killer NK
a/b mixed / C-type lectin-like
Uncharacterised
0.344
Undefined
Protein sequence and protein families (fasta) (199 amino acids) Download
MSSENCFVAENSSLHPESGQENDATSPHFSTRHEGSFQVPVLCAVMNVVFITILIIALIALSVGQYNCPGQYTFSMPSDSHVSSCSEDWVGYQRKCYFISTVKRSWTSAQNACSEHGATLAVIDSEKDMNFLKRYAGREEHWVGLKKEPGHPWKWSNGKEFNNWFNVTGSDKCVFLKNTEVSSMECEKNLYWICNKPYK
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.

Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Prognostic Relevance of Concordant Expression CD69 and CD56 in Response to Bortezomib Combination Therapy in Multiple Myeloma Patients. [34344244]
  • T cells selectively filter oscillatory signals on the minutes timescale. [33627405]
  • A reference map of the human binary protein interactome. [32296183]
  • Increased CD69 expression on activated eosinophils in eosinophilic chronic rhinosinusitis correlates with clinical findings. [31928947]
  • Transcriptional regulation of the gene encoding the human C-type lectin leukocyte receptor AIM/CD69 and functional characterization of its tumor necrosis factor-alpha-responsive elements. [7665567]
  • CD 69 antigen of human lymphocytes is a calcium-dependent carbohydrate-binding protein. [7887967]
  • Structure of the gene coding for the human early lymphocyte activation antigen CD69: a C-type lectin receptor evolutionarily related with the gene families of natural killer cell-specific receptors. [8026529]
  • Molecular cloning, expression, and chromosomal localization of the human earliest lymphocyte activation antigen AIM/CD69, a new member of the C-type animal lectin superfamily of signal-transmitting receptors. [8340758]
  • Molecular characterization of the early activation antigen CD69: a type II membrane glycoprotein related to a family of natural killer cell activation antigens. [8100776]
  • Constitutive expression of CD69 in interspecies T-cell hybrids and locus assignment to human chromosome 12. [1612643]
UniProt Main References (6 PubMed Identifiers)
  • Expression cloning of the early activation antigen CD69, a type II integral membrane protein with a C-type lectin domain. [8496594]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Toward a comprehensive characterization of a human cancer cell phosphoproteome. [23186163]
  • Crystal structure of human CD69: a C-type lectin-like activation marker of hematopoietic cells. [11101293]
  • Crystal structure of the C-type lectin-like domain from the human hematopoietic cell receptor CD69. [11036086]
  • Soluble recombinant CD69 receptors optimized to have an exceptional physical and chemical stability display prolonged circulation and remain intact in the blood of mice. [18959746]
RNA
RNA (Transcript ID: NM_001781.2)
CD69 molecule
m7G-5')ppp(5'-AGACUCAACAAGAGCUCCAGCAAAGACUUUCACUGUAGCUUGACUUGACCUGAGAUUAACUAGGGAAUCUUGAGAAUAAAGAUGAGCUCUGAAAAUUGUUUCGUAGCAGAGAACAGCUCUUUGCAUCCGGAGAGUGGACAAGAAAAUGAUGCCACCAGUCCCCAUUUCUCAACACGUCAUGAAGGGUCCUUCCAAGUUCCUGUCCUGUGUGCUGUAAUGAAUGUGGUCUUCAUCACCAUUUUAAUCAUAGCUCUCAUUGCCUUAUCAGUGGGCCAAUACAAUUGUCCAGGCCAAUACACAUUCUCAAUGCCAUCAGACAGCCAUGUUUCUUCAUGCUCUGAGGACUGGGUUGGCUACCAGAGGAAAUGCUACUUUAUUUCUACUGUGAAGAGGAGCUGGACUUCAGCCCAAAAUGCUUGUUCUGAACAUGGUGCUACUCUUGCUGUCAUUGAUUCUGAAAAGGACAUGAACUUUCUAAAACGAUACGCAGGUAGAGAGGAACACUGGGUUGGACUGAAAAAGGAACCUGGUCACCCAUGGAAGUGGUCAAAUGGCAAAGAAUUUAACAACUGGUUCAACGUUACAGGGUCUGACAAGUGUGUUUUUCUGAAAAACACAGAGGUCAGCAGCAUGGAAUGUGAGAAGAAUUUAUACUGGAUAUGUAACAAACCUUACAAAUAAUAAGGAAACAUGUUCACUUAUUGACUAUUAUAGAAUGGAACUCAAGGAAAUCUGUGUCAGUGGAUGCUGCUCUGUGGUCCGAAGUCUUCCAUAGAGACUUUGUGAAAAAAAAUUUUAUAGUGUCUUGGGAAUUUUCUUCCAAACAGAACUAUGGAAAAAAAGGAAGAAAUUCCAGGAAAAUCUGCACUGUGGGCUUUUAUUGCCAUGAGCUAGAAGCAUCACAGGUUGACCAAUAACCAUGCCCAAGAAUGAGAAGAAUGACUAUGCAACCUUUGGAUGCACUUUAUAUUAUUUUGAAUCCAGAAAUAAUGAAAUAACUAGGCGUGGACUUACUAUUUAUUGCUGAAUGACUACCAACAGUGAGAGCCCUUCAUGCAUUUGCACUAUUGGAAGGAGUUAGAUGUUGGUACUAGAUACUGAAUGUAAACAAAGGAAUUAUGGCUGGUAACAUAGGUUUUUAGUCUAAUUGAAUCCCUUAAACUCAGGGAGCAUUUAUAAAUGGACAAAUGCUUAUGAAACUAAGAUUUGUAAUAUUUCUCUCUUUUUAGAGAAAUUUGCCAAUUUACUUUGUUAUUUUUCCCCAAAAAGAAUGGGAUGAUCAUGUAUUUAUUUUUUUACUUCCUCAGCUGUAGACAGGUCCUUUUCGAUGGUACAUAUUUCUUUGCCUUUAUAAUCUUUUAUACAGUGUCUUACAGAGAAAAGACAUAAGCAAAGACUAUGAGGAAUAUUUGCAAGACAUAGAAUAGUGUUGGAAAAUGUGCAAUAUGUGAUGUGGCAAAUCUCUAUUAGGAAAUAUUCUGUAAUCUUCAGACCUAGAAUAAUACUAGUCUUAUAAUAGGUUUGUGACUUUCCUAAAUCAAUUCUAUUACGUGCAAUACUUCAAUACUUCAUUUAAAAUAUUUUUAUGUGCAAUAAAAUGUAUUUGUUUGUAUUUUGUGUUCAGUACAAUUAUAAGCUGUUUUUAUAUAUGUGAAAUAAAAGUAGAAUAAACACAA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 969)
CD69 molecule
strand -
CLEC2C
NCBI CDS gene sequence (600 bp)
5'-ATGAGCTCTGAAAATTGTTTCGTAGCAGAGAACAGCTCTTTGCATCCGGAGAGTGGACAAGAAAATGATGCCACCAGTCCCCATTTCTCAACACGTCATGAAGGGTCCTTCCAAGTTCCTGTCCTGTGTGCTGTAATGAATGTGGTCTTCATCACCATTTTAATCATAGCTCTCATTGCCTTATCAGTGGGCCAATACAATTGTCCAGGCCAATACACATTCTCAATGCCATCAGACAGCCATGTTTCTTCATGCTCTGAGGACTGGGTTGGCTACCAGAGGAAATGCTACTTTATTTCTACTGTGAAGAGGAGCTGGACTTCAGCCCAAAATGCTTGTTCTGAACATGGTGCTACTCTTGCTGTCATTGATTCTGAAAAGGACATGAACTTTCTAAAACGATACGCAGGTAGAGAGGAACACTGGGTTGGACTGAAAAAGGAACCTGGTCACCCATGGAAGTGGTCAAATGGCAAAGAATTTAACAACTGGTTCAACGTTACAGGGTCTGACAAGTGTGTTTTTCTGAAAAACACAGAGGTCAGCAGCATGGAATGTGAGAAGAATTTATACTGGATATGTAACAAACCTTACAAATAA-3'
NCBI CDS gene sequence with introns (location: 9753481.. 9760820) (7340 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 9752486.. 9760901) (8416 bp)Download
NCBI gene sequence (location: [9752486.. 9760901 + 1000]) (9416 bp)Download
Cite How to cite