Protein
Protein (NP_001763)
SIGLEC-3
Myeloid cell surface antigen CD33 (Sialic acid-binding Ig-like lectin 3) (Siglec-3) (gp67) (CD antigen CD33)
CD33
CD33 molecule
Curated
I-type lectin
I-Type Lectins - CD33-related Siglecs
b-sandwich / Ig-like
0.398
Protein sequence and protein families (fasta) (364 amino acids) Download
MPLLLLLPLLWAGALAMDPNFWLQVQESVTVQEGLCVLVPCTFFHPIPYYDKNSPVHGYWFREGAIISRDSPVATNKLDQEVQEETQGRFRLLGDPSRNNCSLSIVDARRRDNGSYFFRMERGSTKYSYKSPQLSVHVTDLTHRPKILIPGTLEPGHSKNLTCSVSWACEQGTPPIFSWLSAAPTSLGPRTTHSSVLIITPRPQDHGTNLTCQVKFAGAGVTTERTIQLNVTYVPQNPTTGIFPGDGSGKQETRAGVVHGAIGGAGVTALLALCLCLIFFIVKTHRRKAARTAVGRNDTHPTTGSASPKHQKKSKLHGPTETSSCSGAAPTVEMDEELHYASLNFHGMNPSKDTSTEYSEVRTQ
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
aNeuAc26Gal
NeuAc(a2-6)Gal
aNeuAc23Gal
NeuAc(a2-3)Gal
P22 ligand analog of 6-sialyllactose
NeuAc(a2-6)Gal(b1-4)Glc
References
NCBI References (10 PubMed Identifiers)
  • Quantitative analyses of CD7, CD33, CD34, CD56, and CD123 within the FLT3-ITD/NPM1-MUT myeloblastic/monocytic bulk AML blastic populations. [34034609]
  • CD33M inhibits microglial phagocytosis, migration and proliferation, but the Alzheimer's disease-protective variant CD33m stimulates phagocytosis and proliferation, and inhibits adhesion. [33720433]
  • Reporter cell assay for human CD33 validated by specific antibodies and human iPSC-derived microglia. [34188106]
  • SIGLEC-3 (CD33) serves as an immune checkpoint receptor for HBV infection. [34060491]
  • CD33 rs3865444 as a risk factor for Parkinson's disease. [33582190]
  • Characterization of CD33 as a new member of the sialoadhesin family of cellular interaction molecules. [7718872]
  • Expression of an early myelopoietic antigen (CD33) on a subset of human umbilical cord blood-derived natural killer cells. [7505004]
  • Identification of potent mixed leukocyte reaction-stimulatory cells in human bone marrow. Putative differentiation stage of human blood dendritic cells. [8454872]
  • Expression of the myeloid differentiation antigen CD33 depends on the presence of human chromosome 19 in human-mouse hybrids. [1696442]
  • Isolation of a cDNA encoding CD33, a differentiation antigen of myeloid progenitor cells. [3139766]
UniProt Main References (14 PubMed Identifiers)
  • Genomic organization of the siglec gene locus on chromosome 19q13.4 and cloning of two new siglec pseudogenes. [11943481]
  • A study of CD33 (SIGLEC-3) antigen expression and function on activated human T and NK cells: two isoforms of CD33 are generated by alternative splicing. [16380601]
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The DNA sequence and biology of human chromosome 19. [15057824]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • A single N-linked glycosylation site is implicated in the regulation of ligand recognition by the I-type lectins CD22 and CD33. [8702538]
  • The sialoadhesin CD33 is a myeloid-specific inhibitory receptor. [10556798]
  • The myeloid-specific sialic acid-binding receptor, CD33, associates with the protein-tyrosine phosphatases, SHP-1 and SHP-2. [10206955]
  • Engagement of p75/AIRM1 or CD33 inhibits the proliferation of normal or leukemic myeloid cells. [10611343]
  • Myeloid specific human CD33 is an inhibitory receptor with differential ITIM function in recruiting the phosphatases SHP-1 and SHP-2. [10887109]
  • Show more
All isoforms of this gene containing a lectin domain
NP_001171079.1, NP_001763.3, XP_011525834.1, XP_011525833.1, XP_016882997.1, XP_016882998.1, NP_001076087.1, XP_016882999.1
RNA
RNA (Transcript ID: NM_001772.4)
CD33 molecule, transcript variant 1
m7G-5')ppp(5'-CUGCUCACACAGGAAGCCCUGGAAGCUGCUUCCUCAGACAUGCCGCUGCUGCUACUGCUGCCCCUGCUGUGGGCAGGGGCCCUGGCUAUGGAUCCAAAUUUCUGGCUGCAAGUGCAGGAGUCAGUGACGGUACAGGAGGGUUUGUGCGUCCUCGUGCCCUGCACUUUCUUCCAUCCCAUACCCUACUACGACAAGAACUCCCCAGUUCAUGGUUACUGGUUCCGGGAAGGAGCCAUUAUAUCCAGGGACUCUCCAGUGGCCACAAACAAGCUAGAUCAAGAAGUACAGGAGGAGACUCAGGGCAGAUUCCGCCUCCUUGGGGAUCCCAGUAGGAACAACUGCUCCCUGAGCAUCGUAGACGCCAGGAGGAGGGAUAAUGGUUCAUACUUCUUUCGGAUGGAGAGAGGAAGUACCAAAUACAGUUACAAAUCUCCCCAGCUCUCUGUGCAUGUGACAGACUUGACCCACAGGCCCAAAAUCCUCAUCCCUGGCACUCUAGAACCCGGCCACUCCAAAAACCUGACCUGCUCUGUGUCCUGGGCCUGUGAGCAGGGAACACCCCCGAUCUUCUCCUGGUUGUCAGCUGCCCCCACCUCCCUGGGCCCCAGGACUACUCACUCCUCGGUGCUCAUAAUCACCCCACGGCCCCAGGACCACGGCACCAACCUGACCUGUCAGGUGAAGUUCGCUGGAGCUGGUGUGACUACGGAGAGAACCAUCCAGCUCAACGUCACCUAUGUUCCACAGAACCCAACAACUGGUAUCUUUCCAGGAGAUGGCUCAGGGAAACAAGAGACCAGAGCAGGAGUGGUUCAUGGGGCCAUUGGAGGAGCUGGUGUUACAGCCCUGCUCGCUCUUUGUCUCUGCCUCAUCUUCUUCAUAGUGAAGACCCACAGGAGGAAAGCAGCCAGGACAGCAGUGGGCAGGAAUGACACCCACCCUACCACAGGGUCAGCCUCCCCGAAACACCAGAAGAAGUCCAAGUUACAUGGCCCCACUGAAACCUCAAGCUGUUCAGGUGCCGCCCCUACUGUGGAGAUGGAUGAGGAGCUGCAUUAUGCUUCCCUCAACUUUCAUGGGAUGAAUCCUUCCAAGGACACCUCCACCGAAUACUCAGAGGUCAGGACCCAGUGAGGAACCCACAAGAGCAUCAGGCUCAGCUAGAAGAUCCACAUCCUCUACAGGUCGGGGACCAAAGGCUGAUUCUUGGAGAUUUAACACCCCACAGGCAAUGGGUUUAUAGACAUUAUGUGAGUUUCCUGCUAUAUUAACAUCAUCUUAGACUUUGCAAGCAGAGAGUCGUGGAAUCAAAUCUGUGCUCUUUCAUUUGCUAAGUGUAUGAUGUCACACAAGCUCCUUAACCUUCCAUGUCUCCAUUUUCUUCUCUGUGAAGUAGGUAUAAGAAGUCCUAUCUCAUAGGGAUGCUGUGAGCAUUAAAUAAAGGUACACAUGGAAAACACCA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 945)
CD33 molecule
strand +
SIGLEC3, SIGLEC-3, p67, FLJ00391
NCBI CDS gene sequence (1095 bp)
5'-ATGCCGCTGCTGCTACTGCTGCCCCTGCTGTGGGCAGGGGCCCTGGCTATGGATCCAAATTTCTGGCTGCAAGTGCAGGAGTCAGTGACGGTACAGGAGGGTTTGTGCGTCCTCGTGCCCTGCACTTTCTTCCATCCCATACCCTACTACGACAAGAACTCCCCAGTTCATGGTTACTGGTTCCGGGAAGGAGCCATTATATCCAGGGACTCTCCAGTGGCCACAAACAAGCTAGATCAAGAAGTACAGGAGGAGACTCAGGGCAGATTCCGCCTCCTTGGGGATCCCAGTAGGAACAACTGCTCCCTGAGCATCGTAGACGCCAGGAGGAGGGATAATGGTTCATACTTCTTTCGGATGGAGAGAGGAAGTACCAAATACAGTTACAAATCTCCCCAGCTCTCTGTGCATGTGACAGACTTGACCCACAGGCCCAAAATCCTCATCCCTGGCACTCTAGAACCCGGCCACTCCAAAAACCTGACCTGCTCTGTGTCCTGGGCCTGTGAGCAGGGAACACCCCCGATCTTCTCCTGGTTGTCAGCTGCCCCCACCTCCCTGGGCCCCAGGACTACTCACTCCTCGGTGCTCATAATCACCCCACGGCCCCAGGACCACGGCACCAACCTGACCTGTCAGGTGAAGTTCGCTGGAGCTGGTGTGACTACGGAGAGAACCATCCAGCTCAACGTCACCTATGTTCCACAGAACCCAACAACTGGTATCTTTCCAGGAGATGGCTCAGGGAAACAAGAGACCAGAGCAGGAGTGGTTCATGGGGCCATTGGAGGAGCTGGTGTTACAGCCCTGCTCGCTCTTTGTCTCTGCCTCATCTTCTTCATAGTGAAGACCCACAGGAGGAAAGCAGCCAGGACAGCAGTGGGCAGGAATGACACCCACCCTACCACAGGGTCAGCCTCCCCGAAACACCAGAAGAAGTCCAAGTTACATGGCCCCACTGAAACCTCAAGCTGTTCAGGTGCCGCCCCTACTGTGGAGATGGATGAGGAGCTGCATTATGCTTCCCTCAACTTTCATGGGATGAATCCTTCCAAGGACACCTCCACCGAATACTCAGAGGTCAGGACCCAGTGA-3'
NCBI CDS gene sequence with introns (location: 51225119.. 51239688) (14570 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 51225080.. 51240016) (14937 bp)Download
NCBI gene sequence (location: [51225080 - 1000].. 51240016) (15937 bp)Download
Cite How to cite