NCBI Summary
This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the more abundant major subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011].
Protein
Protein (NP_001662)
Hepatic asialoglycoprotein receptor 1
Asialoglycoprotein receptor 1 (ASGP-R 1) (ASGPR 1) (C-type lectin domain family 4 member H1) (Hepatic lectin H1) (HL-1)
ASGR1
asialoglycoprotein receptor 1
Undefined
Curated
C-type lectin
CLEC4H1
C-type - Type II transmembrane receptors
a/b mixed / C-type lectin-like
MTKEYQDLQHLDNEESDHHQLRKGPPPPQPLLQRLCSGPRLLLLSLGLSLLLLVVVCVIGSQNSQLQEELRGLRETFSNFTASTEAQVKGLSTQGGNVGRKMKSLESQLEKQQKDLSEDHSSLLLHVKQFVSDLRSLSCQMAALQGNGSERTCCPVNWVEHERSCYWFSRSGKAWADADNYCRLEDAHLVVVTSWEEQKFVQHHIGPVNTWMGLHDQNGPWKWVDGTDYETGFKNWRPEQPDDWYGHGLGGGEDCAHFTDDGRWNDDVCQRPYRWVCETELDKASQEPPLL
Mol* PDB structure viewerUniLectin3D
Oligomerization and Known Interactions
Interacts with LASS2
(Microbial infection) Interacts with hepatitis E virus capsid protein ORF2
(Microbial infection) Interacts with SARS-CoV-2 virus spike glycoprotein. Source: UniProt
(Microbial infection) Interacts with hepatitis E virus capsid protein ORF2
(Microbial infection) Interacts with SARS-CoV-2 virus spike glycoprotein. Source: UniProt
Annotation
Ligand
Glycan ligands from structural data
Glc.png)

References
NCBI References (10 PubMed Identifiers)
- Common gene variants in ASGR1 gene locus associate with reduced cardiovascular risk in absence of pleiotropic effects. [32679274]
- A reference map of the human binary protein interactome. [32296183]
- Clec10a regulates mite-induced dermatitis. [31811054]
- Establishment of a functional cell line expressing both subunits of H1a and H2c of human hepatocyte surface molecule ASGPR. [21063834]
- A new splice variant of the major subunit of human asialoglycoprotein receptor encodes a secreted form in hepatocytes. [20886072]
- In vitro binding of the asialoglycoprotein receptor to the beta adaptin of plasma membrane coated vesicles. [1935897]
- Assignment of human asialoglycoprotein receptor gene (ASGR1) to chromosome 17p11-13. [1774077]
- Endocytosis by the asialoglycoprotein receptor is independent of cytoplasmic serine residues. [1924301]
- The H1 and H2 polypeptides associate to form the asialoglycoprotein receptor in human hepatoma cells. [2834401]
- Sequence of human asialoglycoprotein receptor cDNA. An internal signal sequence for membrane insertion. [2982798]
UniProt Main References (10 PubMed Identifiers)
- An internal signal sequence: the asialoglycoprotein receptor membrane anchor. [3753585]
- DNA sequence of human chromosome 17 and analysis of rearrangement in the human lineage. [16625196]
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
- Fatty acylation of the rat and human asialoglycoprotein receptors. A conserved cytoplasmic cysteine residue is acylated in all receptor subunits. [8943311]
- Cloning, mapping, and characterization of a human homologue of the yeast longevity assurance gene LAG1. [11543633]
- Glycoproteomics analysis of human liver tissue by combination of multiple enzyme digestion and hydrazide chemistry. [19159218]
- Initial characterization of the human central proteome. [21269460]
- An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. [24275569]
- Asialoglycoprotein receptor facilitates infection of PLC/PRF/5 cells by HEV through interaction with ORF2. [27155063]
- Crystal structure of the carbohydrate recognition domain of the H1 subunit of the asialoglycoprotein receptor. [10891274]
All isoforms of this gene containing a lectin domain
RNA
RNA (Transcript ID: NM_001671.5)
asialoglycoprotein receptor 1, transcript variant 1
m7G-5')ppp(5'-ACACAGACACGCAGACACAGAGACACCGGGGCCCAGGGCCCUCCUAUGGACCCUGCCCGCUCCCCUCCCAUUGUCCACGGCUGUCCGCCCACCCCCAUUCUCCAAGCUUCAGCCCCCUCCUUAGUUCGGCAUCUGCACAGCACUGAAGAACCUGGGAAUCAGACCCUGAGACCCUGAGCAAUCCCAGGUCCAGCGCCAGCCCUAUCAUGACCAAGGAGUAUCAAGACCUUCAGCAUCUGGACAAUGAGGAGAGUGACCACCAUCAGCUCAGAAAAGGGCCACCUCCUCCCCAGCCCCUCCUGCAGCGUCUCUGCUCCGGACCUCGCCUCCUCCUGCUCUCCCUGGGCCUCAGCCUCCUGCUGCUUGUGGUUGUCUGUGUGAUCGGAUCCCAAAACUCCCAGCUGCAGGAGGAGCUGCGGGGCCUGAGAGAGACGUUCAGCAACUUCACAGCGAGCACGGAGGCCCAGGUCAAGGGCUUGAGCACCCAGGGAGGCAAUGUGGGAAGAAAGAUGAAGUCGCUAGAGUCCCAGCUGGAGAAACAGCAGAAGGACCUGAGUGAAGAUCACUCCAGCCUGCUGCUCCACGUGAAGCAGUUCGUGUCUGACCUGCGGAGCCUGAGCUGUCAGAUGGCGGCGCUCCAGGGCAAUGGCUCAGAAAGGACCUGCUGCCCGGUCAACUGGGUGGAGCACGAGCGCAGCUGCUACUGGUUCUCUCGCUCCGGGAAGGCCUGGGCUGACGCCGACAACUACUGCCGGCUGGAGGACGCGCACCUGGUGGUGGUCACGUCCUGGGAGGAGCAGAAAUUUGUCCAGCACCACAUAGGCCCUGUGAACACCUGGAUGGGCCUCCACGACCAAAACGGGCCCUGGAAGUGGGUGGACGGGACGGACUACGAGACGGGCUUCAAGAACUGGAGGCCGGAGCAGCCGGACGACUGGUACGGCCACGGGCUCGGAGGAGGCGAGGACUGUGCCCACUUCACCGACGACGGCCGCUGGAACGACGACGUCUGCCAGAGGCCCUACCGCUGGGUCUGCGAGACAGAGCUGGACAAGGCCAGCCAGGAGCCACCUCUCCUUUAAUUUAUUUCUUCAAUGCCUCGACCUGCCGCAGGGGUCCGGGAUUGGGAAUCCGCCCAUCUGGGGGCCUCUUCUGCUUUCUCGGGAAUUUUCAUCUAGGAUUUUAAGGGAAGGGGAAGGAUAGGGUGAUGUUCCGAAGGUGAGGAGCUUGAAACCCGUGGCGCUUUCUGCAGUUUGCAGGUUAUCAUUGUGAACUUUUUUUUUUUAAGAGUAAAAAGAAAUAUACCUAAA-3'- Poly-A tail - Coding region
DNA
DNA (Gene ID: 432)
asialoglycoprotein receptor 1
strand -
NCBI CDS gene sequence (876 bp)
5'-ATGACCAAGGAGTATCAAGACCTTCAGCATCTGGACAATGAGGAGAGTGACCACCATCAGCTCAGAAAAGGGCCACCTCCTCCCCAGCCCCTCCTGCAGCGTCTCTGCTCCGGACCTCGCCTCCTCCTGCTCTCCCTGGGCCTCAGCCTCCTGCTGCTTGTGGTTGTCTGTGTGATCGGATCCCAAAACTCCCAGCTGCAGGAGGAGCTGCGGGGCCTGAGAGAGACGTTCAGCAACTTCACAGCGAGCACGGAGGCCCAGGTCAAGGGCTTGAGCACCCAGGGAGGCAATGTGGGAAGAAAGATGAAGTCGCTAGAGTCCCAGCTGGAGAAACAGCAGAAGGACCTGAGTGAAGATCACTCCAGCCTGCTGCTCCACGTGAAGCAGTTCGTGTCTGACCTGCGGAGCCTGAGCTGTCAGATGGCGGCGCTCCAGGGCAATGGCTCAGAAAGGACCTGCTGCCCGGTCAACTGGGTGGAGCACGAGCGCAGCTGCTACTGGTTCTCTCGCTCCGGGAAGGCCTGGGCTGACGCCGACAACTACTGCCGGCTGGAGGACGCGCACCTGGTGGTGGTCACGTCCTGGGAGGAGCAGAAATTTGTCCAGCACCACATAGGCCCTGTGAACACCTGGATGGGCCTCCACGACCAAAACGGGCCCTGGAAGTGGGTGGACGGGACGGACTACGAGACGGGCTTCAAGAACTGGAGGCCGGAGCAGCCGGACGACTGGTACGGCCACGGGCTCGGAGGAGGCGAGGACTGTGCCCACTTCACCGACGACGGCCGCTGGAACGACGACGTCTGCCAGAGGCCCTACCGCTGGGTCTGCGAGACAGAGCTGGACAAGGCCAGCCAGGAGCCACCTCTCCTTTAA-3'
By using this site you agree to our privacy policy.
Please confirm you agree with the privacy policy before using the site.