NCBI Summary
The protein encoded by this gene is a glycoprotein, belonging to the pentraxin family of proteins, which has a characteristic pentameric organization. These family members have considerable sequence homology which is thought to be the result of gene duplication. The binding of the encoded protein to proteins in the pathological amyloid cross-beta fold suggests its possible role as a chaperone. This protein is also thought to control the degradation of chromatin. It has been demonstrated that this protein binds to apoptotic cells at an early stage, which raises the possibility that it is involved in dealing with apoptotic cells in vivo. [provided by RefSeq, Sep 2008].
Protein
Protein (NP_001630)
SAP - Serum amyloid P-component
Serum amyloid P-component (SAP) (9.5S alpha-1-glycoprotein) [Cleaved into: Serum amyloid P-component(1-203)]
APCS
amyloid P component, serum
Undefined
Curated
Pentraxin
L-Type Lectins
b-sandwich / ConA-like
0.835
Protein sequence and protein families (fasta) (223 amino acids) Download
MNKPLLWISVLTSLLEAFAHTDLSGKVFVFPRESVTDHVNLITPLEKPLQNFTLCFRAYSDLSRAYSLFSYNTQGRDNELLVYKERVGEYSLYIGRHKVTSKVIEKFPAPVHICVSWESSSGIAEFWINGTPLVKKGLRQGYFVEAQPKIVLGQEQDSYGGKFDRSQSFVGEIGDLYMWDSVLPPENILSAYQGTPLPANILDWQALNYEIRGYVIIKPLVWV
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.

Oligomerization and Known Interactions
Homopentamer. Pentraxin (or pentaxin) have a discoid arrangement of 5 non-covalently bound subunits. Source: UniProt
Annotation
Ligand
Glycan ligands from structural data
4
Gal
Expression
Functionality temporarily unavailable.
References
NCBI References (10 PubMed Identifiers)
  • Interactome Mapping Provides a Network of Neurodegenerative Disease Proteins and Uncovers Widespread Protein Aggregation in Affected Brains. [32814053]
  • A reference map of the human binary protein interactome. [32296183]
  • Serum Amyloid P Component Binds Fungal Surface Amyloid and Decreases Human Macrophage Phagocytosis and Secretion of Inflammatory Cytokines. [30862745]
  • Antiamyloidogenic and proamyloidogenic chaperone effects of C-reactive protein and serum amyloid P component. [28434325]
  • Serum Amyloid P Component (SAP) Interactome in Human Plasma Containing Physiological Calcium Levels. [28098450]
  • Human serum amyloid P-component (SAP) selectively binds to immobilized or bound forms of C-reactive protein (CRP). [1477104]
  • Treatment of Haemophilus aphrophilus endocarditis with ciprofloxacin. [1602151]
  • Isolation and characterization of the complete complementary and genomic DNA sequences of human serum amyloid P component. [3029048]
  • Human serum amyloid P component. cDNA isolation, complete sequence of pre-serum amyloid P component, and localization of the gene to chromosome 1. [2987268]
  • Human plasma P component: isolation and characterization. [81686]
UniProt Main References (12 PubMed Identifiers)
  • The DNA sequence and biological annotation of human chromosome 1. [16710414]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • The primary structure of human tissue amyloid P component from a patient with primary idiopathic amyloidosis. [4055725]
  • Human serum amyloid P component is an invariant constituent of amyloid deposits and has a uniquely homogeneous glycostructure. [8202534]
  • Proteomic characterization of novel serum amyloid P component variants from human plasma and urine. [15174148]
  • Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry. [16335952]
  • Glycoproteomics analysis of human liver tissue by combination of multiple enzyme digestion and hydrazide chemistry. [19159218]
  • Initial characterization of the human central proteome. [21269460]
  • An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. [24275569]
  • Structure of pentameric human serum amyloid P component. [8114934]
  • Show more
RNA
RNA (Transcript ID: NM_001639.4)
amyloid P component, serum
m7G-5')ppp(5'-GGGCAUGAAUAUCAGACGCUAGGGGGACAGCCACUGUGUUGUCUGCUACCCUCAUCCUGGUCACUGCUUCUGCUAUAACAGCCCUAGGCCAGGAAUAUGAACAAGCCGCUGCUUUGGAUCUCUGUCCUCACCAGCCUCCUGGAAGCCUUUGCUCACACAGACCUCAGUGGGAAGGUGUUUGUAUUUCCUAGAGAAUCUGUUACUGAUCAUGUAAACUUGAUCACACCGCUGGAGAAGCCUCUACAGAACUUUACCUUGUGUUUUCGAGCCUAUAGUGAUCUCUCUCGUGCCUACAGCCUCUUCUCCUACAAUACCCAAGGCAGGGAUAAUGAGCUACUAGUUUAUAAAGAAAGAGUUGGAGAGUAUAGUCUAUACAUUGGAAGACACAAAGUUACAUCCAAAGUUAUCGAAAAGUUCCCGGCUCCAGUGCACAUCUGUGUGAGCUGGGAGUCCUCAUCAGGUAUUGCUGAAUUUUGGAUCAAUGGGACACCUUUGGUGAAAAAGGGUCUGCGACAGGGUUACUUUGUAGAAGCUCAGCCCAAGAUUGUCCUGGGGCAGGAACAGGAUUCCUAUGGGGGCAAGUUUGAUAGGAGCCAGUCCUUUGUGGGAGAGAUUGGGGAUUUGUACAUGUGGGACUCUGUGCUGCCCCCAGAAAAUAUCCUGUCUGCCUAUCAGGGUACCCCUCUCCCUGCCAAUAUCCUGGACUGGCAGGCUCUGAACUAUGAAAUCAGAGGAUAUGUCAUCAUCAAACCCUUGGUGUGGGUCUGAGGUCUUGACUCAACGAGAGCACUUGAAAAUGAAAUGACUGUCUAAGAGAUCUGGUCAAAGCAACUGGAUACUAGAUCUUACAUCUGCAGCUCUUUCUUCUUUGAAUUUCCUAUCUGUAUGUCUGCCUAAUUAAAAAAAUAUAUAUUGUAUUAUGCUA-3'- Poly-A tail
  • Coding region
DNA
DNA (Gene ID: 325)
amyloid P component, serum
strand +
SAP, PTX2, MGC88159
584
NCBI CDS gene sequence (672 bp)
5'-ATGAACAAGCCGCTGCTTTGGATCTCTGTCCTCACCAGCCTCCTGGAAGCCTTTGCTCACACAGACCTCAGTGGGAAGGTGTTTGTATTTCCTAGAGAATCTGTTACTGATCATGTAAACTTGATCACACCGCTGGAGAAGCCTCTACAGAACTTTACCTTGTGTTTTCGAGCCTATAGTGATCTCTCTCGTGCCTACAGCCTCTTCTCCTACAATACCCAAGGCAGGGATAATGAGCTACTAGTTTATAAAGAAAGAGTTGGAGAGTATAGTCTATACATTGGAAGACACAAAGTTACATCCAAAGTTATCGAAAAGTTCCCGGCTCCAGTGCACATCTGTGTGAGCTGGGAGTCCTCATCAGGTATTGCTGAATTTTGGATCAATGGGACACCTTTGGTGAAAAAGGGTCTGCGACAGGGTTACTTTGTAGAAGCTCAGCCCAAGATTGTCCTGGGGCAGGAACAGGATTCCTATGGGGGCAAGTTTGATAGGAGCCAGTCCTTTGTGGGAGAGATTGGGGATTTGTACATGTGGGACTCTGTGCTGCCCCCAGAAAATATCCTGTCTGCCTATCAGGGTACCCCTCTCCCTGCCAATATCCTGGACTGGCAGGCTCTGAACTATGAAATCAGAGGATATGTCATCATCAAACCCTTGGTGTGGGTCTGA-3'
NCBI CDS gene sequence with introns (location: 159587922.. 159588708) (787 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 159587826.. 159588865) (1040 bp)Download
NCBI gene sequence (location: [159587826 - 1000].. 159588865) (2040 bp)Download
Cite How to cite