NCBI Summary
Cell signaling pathways rely on a dynamic interaction between activating and inhibiting processes. SHP-1-mediated dephosphorylation of protein tyrosine residues is central to the regulation of several cell signaling pathways. Two types of inhibitory receptor superfamily members are immunoreceptor tyrosine-based inhibitory motif (ITIM)-bearing receptors and their non-ITIM-bearing, activating counterparts. Control of cell signaling via SHP-1 is thought to occur through a balance between PILRalpha-mediated inhibition and PILRbeta-mediated activation. These paired immunoglobulin-like receptor genes are located in a tandem head-to-tail orientation on chromosome 7. This particular gene encodes the ITIM-bearing member of the receptor pair, which functions in the inhibitory role. Alternative splicing has been observed at this locus and three variants, each encoding a distinct isoform, are described. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_038467)
Paired immunoglobulin-like type 2 receptor alpha
Paired immunoglobulin-like type 2 receptor alpha (Cell surface receptor FDF03) (Inhibitory receptor PILR-alpha)
PILRA
paired immunoglobin like type 2 receptor alpha
Undefined
Curated
I-type lectin
Undefined
b-sandwich / Ig-like
0.199
Protein sequence and protein families (fasta) (303 amino acids) Download
MGRPLLLPLLPLLLPPAFLQPSGSTGSGPSYLYGVTQPKHLSASMGGSVEIPFSFYYPWELATAPDVRISWRRGHFHRQSFYSTRPPSIHKDYVNRLFLNWTEGQKSGFLRISNLQKQDQSVYFCRVELDTRSSGRQQWQSIEGTKLSITQAVTTTTQRPSSMTTTWRLSSTTTTTGLRVTQGKRRSDSWHISLETAVGVAVAVTVLGIMILGLICLLRWRRRKGQQRTKATTPAREPFQNTEEPYENIRNEGQNTDPKLNPKDDGIVYASLALSSSTSPRAPPSHRPLKSPQNETLYSVLKA
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.

Oligomerization and Known Interactions
Monomer. Interacts with PTPN6/SHP-1 and PTPN11/SHP-2 upon tyrosine phosphorylation

(Microbial infection) Interacts with herpes simplex virus 1 glycoprotein B
Annotation
Ligand
Glycan ligands from structural data
Sialylated T-antigen
NeuAc(a2-6)GalNAc
analog of sialyl Tn glycopeptide
NeuAc(a2-6)GlcNAc
Sialyl Tn analog
NeuAc
Expression
Functionality temporarily unavailable.
References
NCBI References (10 PubMed Identifiers)
  • The PILRA G78R Variant Correlates with Higher HSV-1-Specific IgG Titers in Alzheimer's Disease. [31297637]
  • Paired Immunoglobulin-like Type 2 Receptor Alpha G78R variant alters ligand binding and confers protection to Alzheimer's disease. [30388101]
  • Whole-exome sequencing of the BDR cohort: evidence to support the role of the PILRA gene in Alzheimer's disease. [29181857]
  • Structural and thermodynamic analyses reveal critical features of glycopeptide recognition by the human PILRalpha immune cell receptor. [29046357]
  • Transcriptome-wide association study revealed two novel genes associated with nonobstructive azoospermia in a Chinese population. [29202958]
  • PILRalpha is a herpes simplex virus-1 entry coreceptor that associates with glycoprotein B. [18358807]
  • Expression, crystallization and preliminary X-ray diffraction analysis of human paired Ig-like type 2 receptor alpha (PILRalpha). [18097101]
  • Costimulatory signals mediated by the ITAM motif cooperate with RANKL for bone homeostasis. [15085135]
  • FDF03, a novel inhibitory receptor of the immunoglobulin superfamily, is expressed by human dendritic and myeloid cells. [10903717]
  • PILRalpha, a novel immunoreceptor tyrosine-based inhibitory motif-bearing protein, recruits SHP-1 upon tyrosine phosphorylation and is paired with the truncated counterpart PILRbeta. [10660620]
UniProt Main References (4 PubMed Identifiers)
  • The DNA sequence of human chromosome 7. [12853948]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Glycoproteomics analysis of human liver tissue by combination of multiple enzyme digestion and hydrazide chemistry. [19159218]
  • PANP is a novel O-glycosylated PILRalpha ligand expressed in neural tissues. [21241660]
All isoforms of this gene containing a lectin domain
NP_038467.2, XP_024302507.1, NP_840057.1, NP_840056.1
RNA
RNA (Transcript ID: NM_013439.3)
paired immunoglobin like type 2 receptor alpha, transcript variant 1
m7G-5')ppp(5'-ACCCUGGAGGUGCACUGGUUUGGGGAAGGCUCCUGGCCCCCACAGCCCUCUUCGGAGCCUGAGCCCGGCUCUCCUCACUCACCUCAACCCCCAGGCGGCCCCUCCACAGGGCCCCUCUCCUGCCUGGACGGCUCUGCUGGUCUCCCCGUCCCCUGGAGAAGAACAAGGCCAUGGGUCGGCCCCUGCUGCUGCCCCUACUGCCCUUGCUGCUGCCGCCAGCAUUUCUGCAGCCUAGUGGCUCCACAGGAUCUGGUCCAAGCUACCUUUAUGGGGUCACUCAACCAAAACACCUCUCAGCCUCCAUGGGUGGCUCUGUGGAAAUCCCCUUCUCCUUCUAUUACCCCUGGGAGUUAGCCACAGCUCCCGACGUGAGAAUAUCCUGGAGACGGGGCCACUUCCACAGGCAGUCCUUCUACAGCACAAGGCCGCCUUCCAUUCACAAGGAUUAUGUGAACCGGCUCUUUCUGAACUGGACAGAGGGUCAGAAGAGCGGCUUCCUCAGGAUCUCCAACCUGCAGAAGCAGGACCAGUCUGUGUAUUUCUGCCGAGUUGAGCUGGACACACGGAGCUCAGGGAGGCAGCAGUGGCAGUCCAUCGAGGGGACCAAACUCUCCAUCACCCAGGCUGUCACGACCACCACCCAGAGGCCCAGCAGCAUGACUACCACCUGGAGGCUCAGUAGCACAACCACCACAACCGGCCUCAGGGUCACACAGGGCAAACGACGCUCAGACUCUUGGCACAUAAGUCUGGAGACUGCUGUGGGGGUGGCAGUGGCUGUCACUGUGCUCGGAAUCAUGAUUUUGGGACUGAUCUGCCUCCUCAGGUGGAGGAGAAGGAAAGGUCAGCAGCGGACUAAAGCCACAACCCCAGCCAGGGAACCCUUCCAAAACACAGAGGAGCCAUAUGAGAAUAUCAGGAAUGAAGGACAAAAUACAGAUCCCAAGCUAAAUCCCAAGGAUGACGGCAUCGUCUAUGCUUCCCUUGCCCUCUCCAGCUCCACCUCACCCAGAGCACCUCCCAGCCACCGUCCCCUCAAGAGCCCCCAGAACGAGACCCUGUACUCUGUCUUAAAGGCCUAACCAAUGGACAGCCCUCUCAAGACUGAAUGGUGAGGCCAGGUACAGUGGCGCACACCUGUAAUCCCAGCUACUCUGAAGCCUGAGGCAGAAUCAAGUGAGCCCAGGAGUUCAGGGCCAGCUUUGAUAAUGGAGCGAGAUGCCAUCUCUAGUUAAAAAUAUAUAUUAACAAUAAAGUAACAAAUUUAAAAA-3'- Poly-A tail
  • Coding region
DNA
DNA (Gene ID: 29992)
paired immunoglobin like type 2 receptor alpha
strand +
FDF03
NCBI CDS gene sequence (912 bp)
5'-ATGGGTCGGCCCCTGCTGCTGCCCCTACTGCCCTTGCTGCTGCCGCCAGCATTTCTGCAGCCTAGTGGCTCCACAGGATCTGGTCCAAGCTACCTTTATGGGGTCACTCAACCAAAACACCTCTCAGCCTCCATGGGTGGCTCTGTGGAAATCCCCTTCTCCTTCTATTACCCCTGGGAGTTAGCCACAGCTCCCGACGTGAGAATATCCTGGAGACGGGGCCACTTCCACAGGCAGTCCTTCTACAGCACAAGGCCGCCTTCCATTCACAAGGATTATGTGAACCGGCTCTTTCTGAACTGGACAGAGGGTCAGAAGAGCGGCTTCCTCAGGATCTCCAACCTGCAGAAGCAGGACCAGTCTGTGTATTTCTGCCGAGTTGAGCTGGACACACGGAGCTCAGGGAGGCAGCAGTGGCAGTCCATCGAGGGGACCAAACTCTCCATCACCCAGGCTGTCACGACCACCACCCAGAGGCCCAGCAGCATGACTACCACCTGGAGGCTCAGTAGCACAACCACCACAACCGGCCTCAGGGTCACACAGGGCAAACGACGCTCAGACTCTTGGCACATAAGTCTGGAGACTGCTGTGGGGGTGGCAGTGGCTGTCACTGTGCTCGGAATCATGATTTTGGGACTGATCTGCCTCCTCAGGTGGAGGAGAAGGAAAGGTCAGCAGCGGACTAAAGCCACAACCCCAGCCAGGGAACCCTTCCAAAACACAGAGGAGCCATATGAGAATATCAGGAATGAAGGACAAAATACAGATCCCAAGCTAAATCCCAAGGATGACGGCATCGTCTATGCTTCCCTTGCCCTCTCCAGCTCCACCTCACCCAGAGCACCTCCCAGCCACCGTCCCCTCAAGAGCCCCCAGAACGAGACCCTGTACTCTGTCTTAAAGGCCTAA-3'
NCBI CDS gene sequence with introns (location: 100373657.. 100399907) (26251 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 100373487.. 100400096) (26610 bp)Download
NCBI gene sequence (location: [100373487 - 1000].. 100400096) (27610 bp)Download
Cite How to cite