NCBI Summary
FIBCD1 is a conserved type II transmembrane endocytic receptor that binds chitin and is located primarily in the intestinal brush border (Schlosser et al., 2009 [PubMed 19710473]).[supplied by OMIM, Apr 2010].
Protein
Protein (NP_116232)
Fibrinogen C domain containing 1
Fibrinogen C domain-containing protein 1
FIBCD1
fibrinogen C domain containing 1
Undefined
Curated
Ficolin-like
Undefined
a/b mixed with b-sheet / Fibrinogen C-ter like
0.662
Protein sequence and protein families (fasta) (461 amino acids) Download
MVNDRWKTMGGAAQLEDRPRDKPQRPSCGYVLCTVLLALAVLLAVAVTGAVLFLNHAHAPGTAPPPVVSTGAASANSALVTVERADSSHLSILIDPRCPDLTDSFARLESAQASVLQALTEHQAQPRLVGDQEQELLDTLADQLPRLLARASELQTECMGLRKGHGTLGQGLSALQSEQGRLIQLLSESQGHMAHLVNSVSDILDALQRDRGLGRPRNKADLQRAPARGTRPRGCATGSRPRDCLDVLLSGQQDDGVYSVFPTHYPAGFQVYCDMRTDGGGWTVFQRREDGSVNFFRGWDAYRDGFGRLTGEHWLGLKRIHALTTQAAYELHVDLEDFENGTAYARYGSFGVGLFSVDPEEDGYPLTVADYSGTAGDSLLKHSGMRFTTKDRDSDHSENNCAAFYRGAWWYRNCHTSNLNGQYLRGAHASYADGVEWSSWTGWQYSLKFSEMKIRPVREDR
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
ManNAc
ManNAc
References
NCBI References (9 PubMed Identifiers)
  • A reference map of the human binary protein interactome. [32296183]
  • FIBCD1 Binds Aspergillus fumigatus and Regulates Lung Epithelial Response to Cell Wall Components. [30279687]
  • Overexpression of FIBCD1 Is Predictive of Poor Prognosis in Gastric Cancer. [29659669]
  • Immunohistochemical Localization of Fibrinogen C Domain Containing 1 on Epithelial and Mucosal Surfaces in Human Tissues. [29220632]
  • Crystal structure of the tetrameric fibrinogen-like recognition domain of fibrinogen C domain containing 1 (FIBCD1) protein. [24293368]
  • New genetic associations detected in a host response study to hepatitis B vaccine. [20237496]
  • The recognition unit of FIBCD1 organizes into a noncovalently linked tetrameric structure and uses a hydrophobic funnel (S1) for acetyl group recognition. [19892701]
  • Characterization of FIBCD1 as an acetyl group-binding receptor that binds chitin. [19710473]
  • The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. [12975309]
UniProt Main References (3 PubMed Identifiers)
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • DNA sequence and analysis of human chromosome 9. [15164053]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
All isoforms of this gene containing a lectin domain
NP_001138578.1, NP_116232.3
RNA
RNA (Transcript ID: NM_032843.5)
fibrinogen C domain containing 1, transcript variant 1
m7G-5')ppp(5'-GCCCUCGGGGCCCGCCCCGCGCAUGGUGACUUGUGUGAGUCCGGUCCGGGAGGAAGUUUGUGCAGAGGCGCCGCCGGGGGGCUCUCAGGCCCCUCCGGGAGCCAGCAGGAGCCGGGCCGCCCGCGGCUGUUUGCUGCCCUCCGGCCGGCCGCGUUAUCUGGGGGCCAGUUCGGCCUCCUUUCCCUAGGUCUUUUCGGAGGCGGAGUUUAGUAUCCAAGUCCGCGGGUGUGAGCGCGCGCGUGUGUGUGAGUGUGUCGGGGGAGGCCGAGGGGAGCAAUAAAAAGCAAAGAGAGUCCGAGACCAGAAAAGAUGCGGAGAUUGAGAAGGAGGGAGGAGGGACGAGGGAGGAGAGAGAGGAGCGCGCCGGGGAGGCGCCGGAGCCGGGAGCGGGGACGGCGCGCAGCGCGAGCGGCGGGCGUUGGGCUGGCGGCUUUCGCGCUCCCGCUCCUGCUCCCGCCCGCACACAGCGGCGCGCUCAUCCUCACACGCCCGCCCGCUCCCGGGCCGCCCCGGCGCGGGGCACAGAGGCGGGGACCCGGCGGACAGAGCGCGCCCCGCGCCCGCGCCCGCGCCCACCCCGUCUCCUUUGCGCUCCGCAGCGGCGCGCCUCGCCCGGCGCCCCCGCCAGUCCUGCCGGAAGAUGGUCAACGACCGGUGGAAGACCAUGGGCGGCGCUGCCCAACUUGAGGACCGGCCGCGCGACAAGCCGCAGCGGCCGAGCUGCGGCUACGUGCUGUGCACCGUGCUGCUGGCCCUGGCUGUGCUGCUGGCUGUAGCUGUCACCGGUGCCGUGCUCUUCCUGAACCACGCCCACGCGCCGGGCACGGCGCCCCCACCUGUCGUCAGCACUGGGGCUGCCAGCGCCAACAGCGCCCUGGUCACUGUGGAAAGGGCGGACAGCUCGCACCUCAGCAUCCUCAUUGACCCGCGCUGCCCCGACCUCACCGACAGCUUCGCACGCCUGGAGAGCGCCCAGGCCUCGGUGCUGCAGGCGCUGACAGAGCACCAGGCCCAGCCACGGCUGGUGGGCGACCAGGAGCAGGAGCUGCUGGACACGCUGGCCGACCAGCUGCCCCGGCUGCUGGCCCGAGCCUCAGAGCUGCAGACGGAGUGCAUGGGGCUGCGGAAGGGGCAUGGCACGCUGGGCCAGGGCCUCAGCGCCCUGCAGAGUGAGCAGGGCCGCCUCAUCCAGCUUCUCUCUGAGAGCCAGGGCCACAUGGCUCACCUGGUGAACUCCGUCAGCGACAUCCUGGAUGCCCUGCAGAGGGACCGGGGGCUGGGCCGGCCCCGCAACAAGGCCGACCUUCAGAGAGCGCCUGCCCGGGGAACCCGGCCCCGGGGCUGUGCCACUGGCUCCCGGCCCCGAGACUGUCUGGACGUCCUCCUAAGCGGACAGCAGGACGAUGGCGUCUACUCUGUCUUUCCCACCCACUACCCGGCCGGCUUCCAGGUGUACUGUGACAUGCGCACGGACGGCGGCGGCUGGACGGUGUUUCAGCGCCGGGAGGACGGCUCCGUGAACUUCUUCCGGGGCUGGGAUGCGUACCGAGACGGCUUUGGCAGGCUCACCGGGGAGCACUGGCUAGGGCUCAAGAGGAUCCACGCCCUGACCACACAGGCUGCCUACGAGCUGCACGUGGACCUGGAGGACUUUGAGAAUGGCACGGCCUAUGCCCGCUACGGGAGCUUCGGCGUGGGCUUGUUCUCCGUGGACCCUGAGGAAGACGGGUACCCGCUCACCGUGGCUGACUAUUCCGGCACUGCAGGCGACUCCCUCCUGAAGCACAGCGGCAUGAGGUUCACCACCAAGGACCGUGACAGCGACCAUUCAGAGAACAACUGUGCCGCCUUCUACCGCGGUGCCUGGUGGUACCGCAACUGCCACACGUCCAACCUCAAUGGGCAGUACCUGCGCGGUGCGCACGCCUCCUAUGCCGACGGCGUGGAGUGGUCCUCCUGGACCGGCUGGCAGUACUCACUCAAGUUCUCUGAGAUGAAGAUCCGGCCGGUCCGGGAGGACCGCUAGACUGGUGCACCUUGUCCUUGGCCCUGCUGGUCCCUGUCGCCCCAUCCCCGACCCCACCUCACUCUUUCGUGAAUGUUCUCCACCCACCUGUGCCUGGCGGACCCACUCUCCAGUAGGGAGGGGCCGGGCCAUCCCUGACACGAAGCUCCCUGGGCCGGUGAAGUCACACAUCGCCUUCUCGCCGUCCCCACCCCCUCCAUUUGGCAGCUCACUGAUCUCUUGCCUCUGCUGAUGGGGGCUGGCAAACUUGACGACCCCAACUCCUGCCUGCCCCCACUGUGACUCCGGUGCUGUUUGCCGUCCCCUGGCCAGGAUGGUGGAGUCUGCCCCAGGCACCCUCUGCCCUGCCCGGCCAAAUACCCGGCAUUAUGGGGACAGAGAGCAGGGGGCAGACAGCACCCCUGGAGUCCUCCUAGCAGAUCGUGGGGAACGUCAGGUCUCUCUGAGGUCAGGUCUGAGGCCAGUAUCCUCCAGCCCUCCCAAUGCCAACCCCCACCCCGUUUCCCUGGUGCCCAGAGAACCCACCUCUCCCCCAAGGGCCUCAGCCUGGCUGUGGGCUGGGUGGCCCCAUCCUACCAGGCCCUGAGGUCAGGAUGGGGAGCUGCUGCCUUUGGGGACCCACGCUCCAAGGCUGAGACCAGUUCCCUGGAGGCCACCCACCCUGUGCCCCGGCAGGCCUGGGGUCUGCAGUCCUCUUACCUGCUGUGCCCACCUGCUCUCUGUCUCAAAUGAGGCCCAACCCAUCCCCCACCCAGCUCCCGGCCGUCCUCCUACCUGGGGCAGCUGGGGCUGCCAUCCCAUUUCUCCUGCCUCUGGAAGGUGGGUGGGGCCCUGCACCGUGGGGCUGGACUGCGCUAAUGGGAAGCUCUUGGUUUUCUGGGCUGGGGCCUAGGCAGGGCUGGGAUGAGGCUUGUACAACCCCCACCACCAAUUUCCCAGGGACUCCAGGGUCCUGAGGCCUCCCAGGAGGGCCUUGGGGGUGAUGACCCCUUCCCUGAGGUGGCUGUCUCCAUGAGGAGGCCAACCCUUGCCAUUGACCGUGGCCACCUGGACCCAGGCCAGGCCCGGCCCGGCGAGUGGUCAAGGGACAGGGACCACCUCACCGGGCAAAUGGGGUCGGGGGGACUGGGGCACCAGACCAGGCACCACCUGGACACUUUCUUGUUGAAUCCUCCCAACACCCAGCACGCUGUCAUCCCCACUCCUUGUGUGCACACAUGCAGAGGUGAGACCCGCAGGCUCCCAGGACCAGCAGCCACAAGGGCAGGGCUGGAGCCGGGUCCUCAGCUGUCUGCUCAGCAGCCCUGGACCCGCGUGCGUUACGUCAGGCCCAGAUGCAGGGCGGCUUUUCCAAGGCCUCCUGAUGGGGGGCCUCCGAAAGGGCUGGAGUCAGCCUUGGGGAGCUGCCUAGCAGCCUCUCCUCGGGCAGGAGGGGAGGUGGCUUCCUCCAAAGGACACCCGAUGGCAGGUGCCUAGGGGGUGUGGGGUUCCGUUCUCCCUUCCCCUCCCACUGAAGUUUGUGCUUAAAAAACAAUAAAUUUGACUUGGCACCACUGGGGGUUGGUGGGAGAGGCCGUGUGACCUGGCUCUCUGUCCCAGUGCCACCAGGUCAUCCACAUGCGCA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 84929)
fibrinogen C domain containing 1
strand -
FLJ14810
NCBI CDS gene sequence (1386 bp)
5'-ATGGTCAACGACCGGTGGAAGACCATGGGCGGCGCTGCCCAACTTGAGGACCGGCCGCGCGACAAGCCGCAGCGGCCGAGCTGCGGCTACGTGCTGTGCACCGTGCTGCTGGCCCTGGCTGTGCTGCTGGCTGTAGCTGTCACCGGTGCCGTGCTCTTCCTGAACCACGCCCACGCGCCGGGCACGGCGCCCCCACCTGTCGTCAGCACTGGGGCTGCCAGCGCCAACAGCGCCCTGGTCACTGTGGAAAGGGCGGACAGCTCGCACCTCAGCATCCTCATTGACCCGCGCTGCCCCGACCTCACCGACAGCTTCGCACGCCTGGAGAGCGCCCAGGCCTCGGTGCTGCAGGCGCTGACAGAGCACCAGGCCCAGCCACGGCTGGTGGGCGACCAGGAGCAGGAGCTGCTGGACACGCTGGCCGACCAGCTGCCCCGGCTGCTGGCCCGAGCCTCAGAGCTGCAGACGGAGTGCATGGGGCTGCGGAAGGGGCATGGCACGCTGGGCCAGGGCCTCAGCGCCCTGCAGAGTGAGCAGGGCCGCCTCATCCAGCTTCTCTCTGAGAGCCAGGGCCACATGGCTCACCTGGTGAACTCCGTCAGCGACATCCTGGATGCCCTGCAGAGGGACCGGGGGCTGGGCCGGCCCCGCAACAAGGCCGACCTTCAGAGAGCGCCTGCCCGGGGAACCCGGCCCCGGGGCTGTGCCACTGGCTCCCGGCCCCGAGACTGTCTGGACGTCCTCCTAAGCGGACAGCAGGACGATGGCGTCTACTCTGTCTTTCCCACCCACTACCCGGCCGGCTTCCAGGTGTACTGTGACATGCGCACGGACGGCGGCGGCTGGACGGTGTTTCAGCGCCGGGAGGACGGCTCCGTGAACTTCTTCCGGGGCTGGGATGCGTACCGAGACGGCTTTGGCAGGCTCACCGGGGAGCACTGGCTAGGGCTCAAGAGGATCCACGCCCTGACCACACAGGCTGCCTACGAGCTGCACGTGGACCTGGAGGACTTTGAGAATGGCACGGCCTATGCCCGCTACGGGAGCTTCGGCGTGGGCTTGTTCTCCGTGGACCCTGAGGAAGACGGGTACCCGCTCACCGTGGCTGACTATTCCGGCACTGCAGGCGACTCCCTCCTGAAGCACAGCGGCATGAGGTTCACCACCAAGGACCGTGACAGCGACCATTCAGAGAACAACTGTGCCGCCTTCTACCGCGGTGCCTGGTGGTACCGCAACTGCCACACGTCCAACCTCAATGGGCAGTACCTGCGCGGTGCGCACGCCTCCTATGCCGACGGCGTGGAGTGGTCCTCCTGGACCGGCTGGCAGTACTCACTCAAGTTCTCTGAGATGAAGATCCGGCCGGTCCGGGAGGACCGCTAG-3'
NCBI CDS gene sequence with introns (location: 130904064.. 130938607) (34544 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 130902440.. 130939247) (36808 bp)Download
NCBI gene sequence (location: [130902440.. 130939247 + 1000]) (37808 bp)Download
How to cite: Schnider B., M'Rad Y., el Ahmadie J., de Brevern AG., Imberty A., Lisacek F., HumanLectome, an update of UniLectin for the annotation and prediction of human lectins, Nucleic Acids Reasearch doi.org/10.1093/nar/gkad905