NCBI Summary
The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Protein
Protein (NP_114123)
Angiopoietin-related protein 6
Angiopoietin-related protein 6 (Angiopoietin-like protein 6) (Angiopoietin-related growth factor) (Angiopoietin-related protein 5)
ANGPTL6
angiopoietin like 6
Undefined
Very low evidence
Ficolin-like
Undefined
a/b mixed with b-sheet / Fibrinogen C-ter like
Uncharacterised
0.566
Undefined
Protein sequence and protein families (fasta) (470 amino acids) Download
MGKPWLRALQLLLLLGASWARAGAPRCTYTFVLPPQKFTGAVCWSGPASTRATPEAANASELAALRMRVGRHEELLRELQRLAAADGAVAGEVRALRKESRGLSARLGQLRAQLQHEAGPGAGPGADLGAEPAAALALLGERVLNASAEAQRAAARFHQLDVKFRELAQLVTQQSSLIARLERLCPGGAGGQQQVLPPPPLVPVVPVRLVGSTSDTSRMLDPAPEPQRDQTQRQQEPMASPMPAGHPAVPTKPVGPWQDCAEARQAGHEQSGVYELRVGRHVVSVWCEQQLEGGGWTVIQRRQDGSVNFFTTWQHYKAGFGRPDGEYWLGLEPVYQLTSRGDHELLVLLEDWGGRGARAHYDGFSLEPESDHYRLRLGQYHGDAGDSLSWHNDKPFSTVDRDRDSYSGNCALYQRGGWWYHACAHSNLNGVWHHGGHYRSRYQDGVYWAEFRGGAYSLRKAAMLIRPLKL
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Use of proteomics to identify mechanisms of hepatocellular carcinoma with the CYP2D6*10 polymorphism and identification of ANGPTL6 as a new diagnostic and prognostic biomarker. [34412629]
  • Angiopoietin-Like Growth Factor Involved in Leptin Signaling in the Hypothalamus. [33810547]
  • ANGPTL6 Genetic Variants Are an Underlying Cause of Familial Intracranial Aneurysms. [33106390]
  • Investigating the Role of Myeloperoxidase and Angiopoietin-like Protein 6 in Obesity and Diabetes. [32277104]
  • ANGPTL6-mediated angiogenesis promotes alpha fetoprotein-producing gastric cancer progression. [31146977]
  • Angiopoietin-related growth factor (AGF) supports adhesion, spreading, and migration of keratinocytes, fibroblasts, and endothelial cells through interaction with RGD-binding integrins. [16806062]
  • Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry. [16335952]
  • Angiopoietin-related growth factor (AGF) promotes angiogenesis. [14764539]
  • The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. [12975309]
  • Angiopoietin-related growth factor (AGF) promotes epidermal proliferation, remodeling, and regeneration. [12871997]
UniProt Main References (3 PubMed Identifiers)
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Glycoproteomics analysis of human liver tissue by combination of multiple enzyme digestion and hydrazide chemistry. [19159218]
  • A strategy for precise and large scale identification of core fucosylated glycoproteins. [19139490]
All isoforms of this gene containing a lectin domain
NP_001308340.1, NP_001374276.1, NP_001374277.1, NP_114123.2, XP_016882836.1, XP_011526650.1, XP_011526651.1
RNA
RNA (Transcript ID: NM_031917.3)
angiopoietin like 6, transcript variant 1
m7G-5')ppp(5'-ACUGCCCUCUCCCCGUCUCUAGCUCAGAGGCCCCACUGGACCCUCGGCUCUUCCUUGGACUUCUUGUGUGUUCUGUGAGCUUCGCUGGAUUCAGGGUCUUGGGCAUCAGAGGUCCGCCGCGAUGGGGAAGCCCUGGCUGCGUGCGCUACAGCUGCUGCUCCUGCUGGGCGCGUCGUGGGCGCGGGCGGGCGCCCCGCGCUGCACCUACACCUUCGUGCUGCCCCCGCAGAAGUUCACGGGCGCUGUGUGCUGGAGCGGCCCCGCAUCCACGCGGGCGACGCCCGAGGCCGCCAACGCCAGCGAGCUGGCGGCGCUGCGCAUGCGCGUCGGCCGCCACGAGGAGCUGUUACGCGAGCUGCAGAGGCUGGCGGCGGCCGACGGCGCCGUGGCCGGCGAGGUGCGCGCGCUGCGCAAGGAGAGCCGCGGCCUGAGCGCGCGCCUGGGCCAGUUGCGCGCGCAGCUGCAGCACGAGGCGGGGCCCGGGGCGGGCCCGGGGGCGGAUCUGGGGGCGGAGCCUGCCGCGGCGCUGGCGCUGCUCGGGGAGCGCGUGCUCAACGCGUCCGCCGAGGCUCAGCGCGCAGCCGCCCGGUUCCACCAGCUGGACGUCAAGUUCCGCGAGCUGGCGCAGCUCGUCACCCAGCAGAGCAGUCUCAUCGCCCGCCUGGAGCGCCUGUGCCCGGGAGGCGCGGGCGGGCAGCAGCAGGUCCUGCCGCCACCCCCACUGGUGCCUGUGGUUCCGGUCCGUCUUGUGGGUAGCACCAGUGACACCAGUAGGAUGCUGGACCCAGCCCCAGAGCCCCAGAGAGACCAGACCCAGAGACAGCAGGAGCCCAUGGCUUCUCCCAUGCCUGCAGGUCACCCUGCGGUCCCCACCAAGCCUGUGGGCCCGUGGCAGGAUUGUGCAGAGGCCCGCCAGGCAGGCCAUGAACAGAGUGGAGUGUAUGAACUGCGAGUGGGCCGUCACGUAGUGUCAGUAUGGUGUGAGCAGCAACUGGAGGGUGGAGGCUGGACUGUGAUCCAGCGGAGGCAAGAUGGUUCAGUCAACUUCUUCACUACCUGGCAGCACUAUAAGGCGGGCUUUGGGCGGCCAGACGGAGAAUACUGGCUGGGCCUUGAACCCGUGUAUCAGCUGACCAGCCGUGGGGACCAUGAGCUGCUGGUUCUCCUGGAGGACUGGGGGGGCCGUGGAGCACGUGCCCACUAUGAUGGCUUCUCCCUGGAACCCGAGAGCGACCACUACCGCCUGCGGCUUGGCCAGUACCAUGGUGAUGCUGGAGACUCUCUUUCCUGGCACAAUGACAAGCCCUUCAGCACCGUGGAUAGGGACCGAGACUCCUAUUCUGGUAACUGUGCCCUGUACCAGCGGGGAGGCUGGUGGUACCAUGCCUGUGCCCACUCCAACCUCAACGGUGUGUGGCACCACGGCGGCCACUACCGAAGCCGCUACCAGGAUGGUGUCUACUGGGCUGAGUUUCGUGGUGGGGCAUAUUCUCUCAGGAAGGCCGCCAUGCUCAUUCGGCCCCUGAAGCUGUGACUCUGUGUUCCUCUGUCCCCUAGGCCCUAGAGGACAUUGGUCAGCAGGAGCCCAAGUUGUUCUGGCCACACCUUCUUUGUGGCUCAGUGCCAAUGUGUCCCACAGAACUUCCCACUGUGGAUCUGUGACCCUGGGCGCUGAAAAUGGGACCCAGGAAUCCCCCCCGUCAAUAUCUUGGCCUCAGAUGGCUCCCCAAGGUCAUUCAUAUCUCGGUUUGAGCUCAUAUCUUAUAAUAACACAAAGUAGCCACA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 83854)
angiopoietin like 6
strand -
ARP5, AGF
NCBI CDS gene sequence (1413 bp)
5'-ATGGGGAAGCCCTGGCTGCGTGCGCTACAGCTGCTGCTCCTGCTGGGCGCGTCGTGGGCGCGGGCGGGCGCCCCGCGCTGCACCTACACCTTCGTGCTGCCCCCGCAGAAGTTCACGGGCGCTGTGTGCTGGAGCGGCCCCGCATCCACGCGGGCGACGCCCGAGGCCGCCAACGCCAGCGAGCTGGCGGCGCTGCGCATGCGCGTCGGCCGCCACGAGGAGCTGTTACGCGAGCTGCAGAGGCTGGCGGCGGCCGACGGCGCCGTGGCCGGCGAGGTGCGCGCGCTGCGCAAGGAGAGCCGCGGCCTGAGCGCGCGCCTGGGCCAGTTGCGCGCGCAGCTGCAGCACGAGGCGGGGCCCGGGGCGGGCCCGGGGGCGGATCTGGGGGCGGAGCCTGCCGCGGCGCTGGCGCTGCTCGGGGAGCGCGTGCTCAACGCGTCCGCCGAGGCTCAGCGCGCAGCCGCCCGGTTCCACCAGCTGGACGTCAAGTTCCGCGAGCTGGCGCAGCTCGTCACCCAGCAGAGCAGTCTCATCGCCCGCCTGGAGCGCCTGTGCCCGGGAGGCGCGGGCGGGCAGCAGCAGGTCCTGCCGCCACCCCCACTGGTGCCTGTGGTTCCGGTCCGTCTTGTGGGTAGCACCAGTGACACCAGTAGGATGCTGGACCCAGCCCCAGAGCCCCAGAGAGACCAGACCCAGAGACAGCAGGAGCCCATGGCTTCTCCCATGCCTGCAGGTCACCCTGCGGTCCCCACCAAGCCTGTGGGCCCGTGGCAGGATTGTGCAGAGGCCCGCCAGGCAGGCCATGAACAGAGTGGAGTGTATGAACTGCGAGTGGGCCGTCACGTAGTGTCAGTATGGTGTGAGCAGCAACTGGAGGGTGGAGGCTGGACTGTGATCCAGCGGAGGCAAGATGGTTCAGTCAACTTCTTCACTACCTGGCAGCACTATAAGGCGGGCTTTGGGCGGCCAGACGGAGAATACTGGCTGGGCCTTGAACCCGTGTATCAGCTGACCAGCCGTGGGGACCATGAGCTGCTGGTTCTCCTGGAGGACTGGGGGGGCCGTGGAGCACGTGCCCACTATGATGGCTTCTCCCTGGAACCCGAGAGCGACCACTACCGCCTGCGGCTTGGCCAGTACCATGGTGATGCTGGAGACTCTCTTTCCTGGCACAATGACAAGCCCTTCAGCACCGTGGATAGGGACCGAGACTCCTATTCTGGTAACTGTGCCCTGTACCAGCGGGGAGGCTGGTGGTACCATGCCTGTGCCCACTCCAACCTCAACGGTGTGTGGCACCACGGCGGCCACTACCGAAGCCGCTACCAGGATGGTGTCTACTGGGCTGAGTTTCGTGGTGGGGCATATTCTCTCAGGAAGGCCGCCATGCTCATTCGGCCCCTGAAGCTGTGA-3'
NCBI CDS gene sequence with introns (location: 10092589.. 10096563) (3975 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 10092338.. 10102678) (10341 bp)Download
NCBI gene sequence (location: [10092338.. 10102678 + 1000]) (11341 bp)Download
Cite How to cite