HumanLectome - Human Lectin Entry

NCBI Summary

The protein encoded by this gene is the gamma component of fibrinogen, a blood-borne glycoprotein comprised of three pairs of nonidentical polypeptide chains. Following vascular injury, fibrinogen is cleaved by thrombin to form fibrin which is the most abundant component of blood clots. In addition, various cleavage products of fibrinogen and fibrin regulate cell adhesion and spreading, display vasoconstrictor and chemotactic activities, and are mitogens for several cell types. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia and thrombophilia. Alternative splicing results in transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015].

Protein name

Fibrinogen gamma chain

Synonym(s)

Fibrinogen gamma chain

HGNC gene name

FGG

HGNC name

fibrinogen gamma chain

Protein_CD_name

Undefined

Lectin confidence

Very low evidence

UniLectin class

Ficolin-like

Known lectin group

Undefined

Lectin fold

a/b mixed with b-sheet / Fibrinogen C-ter like

Glycan specificity

Uncharacterised

RefSeq accession

Gene ID

UniProt accession

Ensembl protein ID

UniRef cluster ID

LectomeXplore score

0.543

Reference

Undefined

Other links

neXtProt, PFAM, InterPro

Protein sequence and protein families (fasta) (453 amino acids) Download

MSWSLHPRNLILYFYALLFLSSTCVAYVATRDNCCILDERFGSYCPTTCGIADFLSTYQTKVDKDLQSLEDILHQVENKTSEVKQLIKAIQLTYNPDESSKPNMIDAATLKSRKMLEEIMKYEASILTHDSSIRYLQEIYNSNNQKIVNLKEKVAQLEAQCQEPCKDTVQIHDITGKDCQDIANKGAKQSGLYFIKPLKANQQFLVYCEIDGSGNGWTVFQKRLDGSVDFKKNWIQYKEGFGHLSPTGTTEFWLGNEKIHLISTQSAIPYALRVELEDWNGRTSTADYAMFKVGPEADKYRLTYAYFAGGDAGDAFDGFDFGDDPSDKFFTSHNGMQFSTWDNDNDKFEGNCAEQDGSGWWMNKCHAGHLNGVYYQGGTYSKASTPNGYDNGIIWATWKTRWYSMKKTTMKIIPFNRLTIGEGQQHHLGGAKQVRPEHPAETEYDSLYPEDDL

Mol* PDB structure viewerUniLectin3D

Select a PDB entry:

Structural models

AlphaFold v2: AF-P02679-F1 Download

Model Confidence:

Very high (pLDDT > 90)
Confident (90 > pLDDT > 70)
Low (70 > pLDDT > 50)
Very low (pLDDT < 50)

AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.

Expression

Human Protein Atlas

GeneCards

mRNA expression in normal human tissues for FGG Gene

ProteomicsDB

References

NCBI References (10 PubMed Identifiers)

High fibrinogen gamma' levels in patient plasma increase clot formation at arterial and venous shear. [34438442]

Novel variant fibrinogen gammap.C352R produced hypodysfibrinogenemia leading to a bleeding episode and failure of infertility treatment. [34117991]

Recombinant gammaY278H Fibrinogen Showed Normal Secretion from CHO Cells, but a Corresponding Heterozygous Patient Showed Hypofibrinogenemia. [34069309]

Changes and significance of plasma fibrinogen gamma-chain concentration in preeclampsia patients. [33682960]

A Mendelian randomization of gamma' and total fibrinogen levels in relation to venous thromboembolism and ischemic stroke. [33367543]

Assembly and secretion of fibrinogen. Degradation of individual chains. [1429662]

Heterozygous abnormal fibrinogen Osaka III with the replacement of gamma arginine-275 by histidine has an apparently higher molecular weight gamma-chain variant. [1455400]

Gene analyses of abnormal fibrinogens with a mutation in the gamma chain. [1421174]

Polymorphism of the human gamma chain fibrinogen gene. [1685103]

Disulfide bridges in nh2 -terminal part of human fibrinogen. [936108]

UniProt Main References (58 PubMed Identifiers)

Characterization of a complementary deoxyribonucleic acid coding for the gamma chain of human fibrinogen. [6688357]

Nucleotide sequence of the gene for the gamma chain of human fibrinogen. [2990550]

Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]

The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]

Evidence for the selective association of a subpopulation of GPIIb-IIIa with the actin cytoskeletons of thrombin-activated platelets. [8509453]

Isolation and characterisation of cDNA clones for the A alpha- and gamma-chains of human fibrinogen. [6689067]

Structure of the human gamma-fibrinogen gene. Alternate mRNA splicing near the 3' end of the gene produces gamma A and gamma B forms of gamma-fibrinogen. [6092346]

Abnormal polymerization and normal binding of plasminogen and t-PA in three new dysfibrinogenaemias: Barcelona III and IV (gamma Arg 275-->His) and Villajoyosa (gamma Arg 275-->Cys). [7654933]

Carboxy-terminal amino acid sequence of a human fibrinogen gamma-chain variant (gamma'). [7306501]

Covalent structure of fibrinogen. [6575689]

Recombinant human fibrinogen and sulfation of the gamma' chain. [1892842]

The amino acid sequence in fibrin responsible for high affinity thrombin binding. [11307817]

Fibrinogen and fibrin. [6383194]

Localization of a fibrin gamma-chain polymerization site within segment Thr-374 to Glu-396 of human fibrinogen. [6592597]

Localization of a fibrin polymerization site. [6451630]

Platelet receptor recognition site on human fibrinogen. Synthesis and structure-function relationship of peptides corresponding to the carboxy-terminal segment of the gamma chain. [6326808]

Evidence that three adhesive proteins interact with a common recognition site on activated platelets. [6325435]

Localization of a fibrinogen calcium binding site between gamma-subunit positions 311 and 336 by terbium fluorescence. [3160702]

Human plasma fibrinogen heterogeneity: evidence for an extended carboxyl-terminal sequence in a normal gamma chain variant (gamma'). [6933547]

Screening for N-glycosylated proteins by liquid chromatography mass spectrometry. [14760718]

Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry. [16335952]

Elucidation of N-glycosylation sites on human platelet proteins: a glycoproteomic approach. [16263699]

Identification of N-linked glycoproteins in human milk by hydrophilic interaction liquid chromatography and mass spectrometry. [18780401]

Glycoproteomics analysis of human liver tissue by combination of multiple enzyme digestion and hydrazide chemistry. [19159218]

A strategy for precise and large scale identification of core fucosylated glycoproteins. [19139490]

A unique proteolytic fragment of human fibrinogen containing the A alpha COOH-terminal domain of the native molecule. [2143188]

Initial characterization of the human central proteome. [21269460]

An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. [24275569]

A Single Kinase Generates the Majority of the Secreted Phosphoproteome. [26091039]

Crystal structure of a 30 kDa C-terminal fragment from the gamma chain of human fibrinogen. [9016719]

The primary fibrin polymerization pocket: three-dimensional structure of a 30-kDa C-terminal gamma chain fragment complexed with the peptide Gly-Pro-Arg-Pro. [9207064]

Crystal structures of fragment D from human fibrinogen and its crosslinked counterpart from fibrin. [9333233]

Crystal structure of fragment double-D from human fibrin with two different bound ligands. [9628725]

Conformational changes in fragments D and double-D from human fibrin(ogen) upon binding the peptide ligand Gly-His-Arg-Pro-amide. [10074346]

Crystal structure of human fibrinogen. [19296670]

A gamma methionine-310 to threonine substitution and consequent N-glycosylation at gamma asparagine-308 identified in a congenital dysfibrinogenemia associated with posttraumatic bleeding, fibrinogen Asahi. [2496144]

Fibrinogen Baltimore I: polymerization defect associated with a gamma 292Gly----Val (GGC----GTC) mutation. [2257302]

Polymerization defect of fibrinogen Baltimore III due to a gamma Asn308----Ile mutation. [2328317]

Fibrinogen Bern I: substitution gamma 337 Asn-->Lys is responsible for defective fibrin monomer polymerization. [8400260]

Characterization of an apparently lower molecular weight gamma-chain variant in fibrinogen Kyoto I. The replacement of gamma-asparagine 308 by lysine which causes accelerated cleavage of fragment D1 by plasmin and the generation of a new plasmin cleavage site. [2971046]

Fibrinogen Kyoto III: a congenital dysfibrinogen with a gamma aspartic acid-330 to tyrosine substitution manifesting impaired fibrin monomer polymerization. [2819242]

Characterization of fibrinogen Milano I: amino acid exchange gamma 330 Asp----Val impairs fibrin polymerization. [3708159]

Fibrinogen Milano V: a congenital dysfibrinogenaemia with a gamma 275 Arg-->Cys substitution. [7841300]

A new substitution, gamma 358 Ser-->Cys, in fibrinogen Milano VII causes defective fibrin polymerization. [8080993]

Fibrinogen Nagoya, a replacement of glutamine-329 by arginine in the gamma-chain that impairs the polymerization of fibrin monomer. [2738036]

Substitution of gamma Arg-275 by Cys in an abnormal fibrinogen, 'fibrinogen Osaka II'. Evidence for a unique solitary cystine structure at the mutation site. [2971042]

Characterization of an abnormal fibrinogen Osaka V with the replacement of gamma-arginine 375 by glycine. The lack of high affinity calcium binding to D-domains and the lack of protective effect of calcium on fibrinolysis. [1733971]

Paris I dysfibrinogenemia: a point mutation in intron 8 results in insertion of a 15 amino acid sequence in the fibrinogen gamma-chain. [8470043]

An apparently higher molecular weight gamma-chain variant in a new congenital abnormal fibrinogen Tochigi characterized by the replacement of gamma arginine-275 by cysteine. [3337908]

A congenitally abnormal fibrinogen (Vlissingen) with a 6-base deletion in the gamma-chain gene, causing defective calcium binding and impaired fibrin polymerization. [2071611]

Three abnormal fibrinogen variants with the same amino acid substitution (gamma 275 Arg----His): fibrinogens Bergamo II, Essen and Perugia. [3563970]

Normal plasmic cleavage of the gamma-chain variant of 'fibrinogen Saga' with an Arg-275 to His substitution. [2976995]

Fibrinogen Milano XII: a dysfunctional variant containing 2 amino acid substitutions, Aalpha R16C and gamma G165R. [11435303]

Characterization of single-nucleotide polymorphisms in coding regions of human genes. [10391209]

Fibrinogen Hillsborough: a novel gammaGly309Asp dysfibrinogen with impaired clotting. [11986213]

Fibrinogen Philadelphia, a hypodysfibrinogenemia characterized by abnormal polymerization and fibrinogen hypercatabolism due to gamma S378P mutation. [15632207]

Clinical and molecular characterisation of 21 patients affected by quantitative fibrinogen deficiency. [25427968]

All isoforms of this gene containing a lectin domain

NP_000500.2, NP_068656.2

RNA

RNA (Transcript ID: NM_021870.3)

RNA RefSeq ID

NM_021870.3

RNA name

fibrinogen gamma chain, transcript variant gamma-B

Isoforms

All isoforms of FGG containing a lectin domain

RNA Ensembl ID

ENST00000336098.8

Coding region

48..1409 (or 154604834.. 154612609)

mRNA location

154604171.. 154612656

NCBI Matured mRNA sequence 2072 NTP Download

m⁷G-5')ppp(5'-GACAGUGCUGACACUACAAGGCUCGGAGCUCCGGGCACUCAGACAUCAUGAGUUGGUCCUUGCACCCCCGGAAUUUAAUUCUCUACUUCUAUGCUCUUUUAUUUCUCUCUUCAACAUGUGUAGCAUAUGUUGCUACCAGAGACAACUGCUGCAUCUUAGAUGAAAGAUUCGGUAGUUAUUGUCCAACUACCUGUGGCAUUGCAGAUUUCCUGUCUACUUAUCAAACCAAAGUAGACAAGGAUCUACAGUCUUUGGAAGACAUCUUACAUCAAGUUGAAAACAAAACAUCAGAAGUCAAACAGCUGAUAAAAGCAAUCCAACUCACUUAUAAUCCUGAUGAAUCAUCAAAACCAAAUAUGAUAGACGCUGCUACUUUGAAGUCCAGGAAAAUGUUAGAAGAAAUUAUGAAAUAUGAAGCAUCGAUUUUAACACAUGACUCAAGUAUUCGAUAUUUGCAGGAAAUAUAUAAUUCAAAUAAUCAAAAGAUUGUUAACCUGAAAGAGAAGGUAGCCCAGCUUGAAGCACAGUGCCAGGAACCUUGCAAAGACACGGUGCAAAUCCAUGAUAUCACUGGGAAAGAUUGUCAAGACAUUGCCAAUAAGGGAGCUAAACAGAGCGGGCUUUACUUUAUUAAACCUCUGAAAGCUAACCAGCAAUUCUUAGUCUACUGUGAAAUCGAUGGGUCUGGAAAUGGAUGGACUGUGUUUCAGAAGAGACUUGAUGGCAGUGUAGAUUUCAAGAAAAACUGGAUUCAAUAUAAAGAAGGAUUUGGACAUCUGUCUCCUACUGGCACAACAGAAUUUUGGCUGGGAAAUGAGAAGAUUCAUUUGAUAAGCACACAGUCUGCCAUCCCAUAUGCAUUAAGAGUGGAACUGGAAGACUGGAAUGGCAGAACCAGUACUGCAGACUAUGCCAUGUUCAAGGUGGGACCUGAAGCUGACAAGUACCGCCUAACAUAUGCCUACUUCGCUGGUGGGGAUGCUGGAGAUGCCUUUGAUGGCUUUGAUUUUGGCGAUGAUCCUAGUGACAAGUUUUUCACAUCCCAUAAUGGCAUGCAGUUCAGUACCUGGGACAAUGACAAUGAUAAGUUUGAAGGCAACUGUGCUGAACAGGAUGGAUCUGGUUGGUGGAUGAACAAGUGUCACGCUGGCCAUCUCAAUGGAGUUUAUUACCAAGGUGGCACUUACUCAAAAGCAUCUACUCCUAAUGGUUAUGAUAAUGGCAUUAUUUGGGCCACUUGGAAAACCCGGUGGUAUUCCAUGAAGAAAACCACUAUGAAGAUAAUCCCAUUCAACAGACUCACAAUUGGAGAAGGACAGCAACACCACCUGGGGGGAGCCAAACAGGUCAGACCAGAGCACCCUGCGGAAACAGAAUAUGACUCACUUUACCCUGAGGAUGAUUUGUAGAAAAUUAACUGCUAACUUCUAUUGACCCACAAAGUUUCAGAAAUUCUCUGAAAGUUUCUUCCUUUUUUCUCUUACUAUAUUUAUUGAUUUCAAGUCUUCUAUUAAGGACAUUUAGCCUUCAAUGGAAAUUAAAACUCAUUUAGGACUGUAUUUCCAAAUUACUGAUAUCAGAGUUAUUUAAAAAUUGUUUAUUUGAGGAGAUAACAUUUCAACUUUGUUCCUAAAUAUAUAAUAAUAAAAUGAUUGACUUUAUUUGCAUUUUUAUGACCACUUGUCAUUUAUUUUGUCUUCGUAAAUUAUUUUCAUUAUAUCAAAUAUUUUAGUAUGUACUUAAUAAAAUAGGAGAACAUUUUAGAGUUUCAAAUUCCCAGGUAUUUUCCUUGUUUAUUACCCCUAAAUCAUUCCUAUUUAAUUCUUCUUUUUAAAUGGAGAAAAUUAUGUCUUUUUAAUAUGGUUUUUGUUUUGUUAUAUAUUCACAGGCUGGAGACGUUUAAAAGACCGUUUCAAAAGAGAUUUACUUUUUUAAAGGACUUUAUCUGAACAGAGAGAUAUAAUAUUUUUCCUAUUGGACAAUGGACUUGCAAAGCUUCACUUCAUUUUAAGAGCAAAAGACCCCAUGUUGAAAACUCCAUAACAGUUUUAUGCUGAUGAUAAUUUAUCUAC-3'- Poly-A tail

Coding region

NCBI Matured mRNA sequence viewer

;

More about the NCBI sViewer.

DNA

DNA (Gene ID: 2266)

HGNC Gene symbol

FGG

HGNC Gene name

fibrinogen gamma chain

Chr. RefSeq ID

NC_000004.12

Chromosome N°

4 154604834.. 154612609

CDS location

154604834.. 154612609

DNA strand

strand -

CCDS ID

CCDS3788.1

Mouse ortholog gene

MGI:95526

Gene Variant

ClinVar, dbVar

DNA Ensembl ID

ENSG00000171557

HGNC other symbol

UCSC ID

uc003iog.4

GeneBank

INSDC:

GeneCards

3694

MIM

134850

VEGA ID

OTTHUMG00000150329

How to cite: