NCBI Summary
The protein encoded by this gene is the gamma component of fibrinogen, a blood-borne glycoprotein comprised of three pairs of nonidentical polypeptide chains. Following vascular injury, fibrinogen is cleaved by thrombin to form fibrin which is the most abundant component of blood clots. In addition, various cleavage products of fibrinogen and fibrin regulate cell adhesion and spreading, display vasoconstrictor and chemotactic activities, and are mitogens for several cell types. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia and thrombophilia. Alternative splicing results in transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015].
Protein
Protein (NP_068656)
Fibrinogen gamma chain
Fibrinogen gamma chain
FGG
fibrinogen gamma chain
Undefined
Very low evidence
Ficolin-like
Undefined
a/b mixed with b-sheet / Fibrinogen C-ter like
Uncharacterised
0.543
Undefined
Protein sequence and protein families (fasta) (453 amino acids) Download
MSWSLHPRNLILYFYALLFLSSTCVAYVATRDNCCILDERFGSYCPTTCGIADFLSTYQTKVDKDLQSLEDILHQVENKTSEVKQLIKAIQLTYNPDESSKPNMIDAATLKSRKMLEEIMKYEASILTHDSSIRYLQEIYNSNNQKIVNLKEKVAQLEAQCQEPCKDTVQIHDITGKDCQDIANKGAKQSGLYFIKPLKANQQFLVYCEIDGSGNGWTVFQKRLDGSVDFKKNWIQYKEGFGHLSPTGTTEFWLGNEKIHLISTQSAIPYALRVELEDWNGRTSTADYAMFKVGPEADKYRLTYAYFAGGDAGDAFDGFDFGDDPSDKFFTSHNGMQFSTWDNDNDKFEGNCAEQDGSGWWMNKCHAGHLNGVYYQGGTYSKASTPNGYDNGIIWATWKTRWYSMKKTTMKIIPFNRLTIGEGQQHHLGGAKQVRPEHPAETEYDSLYPEDDL
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • High fibrinogen gamma' levels in patient plasma increase clot formation at arterial and venous shear. [34438442]
  • Novel variant fibrinogen gammap.C352R produced hypodysfibrinogenemia leading to a bleeding episode and failure of infertility treatment. [34117991]
  • Recombinant gammaY278H Fibrinogen Showed Normal Secretion from CHO Cells, but a Corresponding Heterozygous Patient Showed Hypofibrinogenemia. [34069309]
  • Changes and significance of plasma fibrinogen gamma-chain concentration in preeclampsia patients. [33682960]
  • A Mendelian randomization of gamma' and total fibrinogen levels in relation to venous thromboembolism and ischemic stroke. [33367543]
  • Assembly and secretion of fibrinogen. Degradation of individual chains. [1429662]
  • Heterozygous abnormal fibrinogen Osaka III with the replacement of gamma arginine-275 by histidine has an apparently higher molecular weight gamma-chain variant. [1455400]
  • Gene analyses of abnormal fibrinogens with a mutation in the gamma chain. [1421174]
  • Polymorphism of the human gamma chain fibrinogen gene. [1685103]
  • Disulfide bridges in nh2 -terminal part of human fibrinogen. [936108]
UniProt Main References (58 PubMed Identifiers)
  • Characterization of a complementary deoxyribonucleic acid coding for the gamma chain of human fibrinogen. [6688357]
  • Nucleotide sequence of the gene for the gamma chain of human fibrinogen. [2990550]
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Evidence for the selective association of a subpopulation of GPIIb-IIIa with the actin cytoskeletons of thrombin-activated platelets. [8509453]
  • Isolation and characterisation of cDNA clones for the A alpha- and gamma-chains of human fibrinogen. [6689067]
  • Structure of the human gamma-fibrinogen gene. Alternate mRNA splicing near the 3' end of the gene produces gamma A and gamma B forms of gamma-fibrinogen. [6092346]
  • Abnormal polymerization and normal binding of plasminogen and t-PA in three new dysfibrinogenaemias: Barcelona III and IV (gamma Arg 275-->His) and Villajoyosa (gamma Arg 275-->Cys). [7654933]
  • Carboxy-terminal amino acid sequence of a human fibrinogen gamma-chain variant (gamma'). [7306501]
  • Covalent structure of fibrinogen. [6575689]
  • Show more
All isoforms of this gene containing a lectin domain
NP_000500.2, NP_068656.2
RNA
RNA (Transcript ID: NM_021870.3)
fibrinogen gamma chain, transcript variant gamma-B
m7G-5')ppp(5'-GACAGUGCUGACACUACAAGGCUCGGAGCUCCGGGCACUCAGACAUCAUGAGUUGGUCCUUGCACCCCCGGAAUUUAAUUCUCUACUUCUAUGCUCUUUUAUUUCUCUCUUCAACAUGUGUAGCAUAUGUUGCUACCAGAGACAACUGCUGCAUCUUAGAUGAAAGAUUCGGUAGUUAUUGUCCAACUACCUGUGGCAUUGCAGAUUUCCUGUCUACUUAUCAAACCAAAGUAGACAAGGAUCUACAGUCUUUGGAAGACAUCUUACAUCAAGUUGAAAACAAAACAUCAGAAGUCAAACAGCUGAUAAAAGCAAUCCAACUCACUUAUAAUCCUGAUGAAUCAUCAAAACCAAAUAUGAUAGACGCUGCUACUUUGAAGUCCAGGAAAAUGUUAGAAGAAAUUAUGAAAUAUGAAGCAUCGAUUUUAACACAUGACUCAAGUAUUCGAUAUUUGCAGGAAAUAUAUAAUUCAAAUAAUCAAAAGAUUGUUAACCUGAAAGAGAAGGUAGCCCAGCUUGAAGCACAGUGCCAGGAACCUUGCAAAGACACGGUGCAAAUCCAUGAUAUCACUGGGAAAGAUUGUCAAGACAUUGCCAAUAAGGGAGCUAAACAGAGCGGGCUUUACUUUAUUAAACCUCUGAAAGCUAACCAGCAAUUCUUAGUCUACUGUGAAAUCGAUGGGUCUGGAAAUGGAUGGACUGUGUUUCAGAAGAGACUUGAUGGCAGUGUAGAUUUCAAGAAAAACUGGAUUCAAUAUAAAGAAGGAUUUGGACAUCUGUCUCCUACUGGCACAACAGAAUUUUGGCUGGGAAAUGAGAAGAUUCAUUUGAUAAGCACACAGUCUGCCAUCCCAUAUGCAUUAAGAGUGGAACUGGAAGACUGGAAUGGCAGAACCAGUACUGCAGACUAUGCCAUGUUCAAGGUGGGACCUGAAGCUGACAAGUACCGCCUAACAUAUGCCUACUUCGCUGGUGGGGAUGCUGGAGAUGCCUUUGAUGGCUUUGAUUUUGGCGAUGAUCCUAGUGACAAGUUUUUCACAUCCCAUAAUGGCAUGCAGUUCAGUACCUGGGACAAUGACAAUGAUAAGUUUGAAGGCAACUGUGCUGAACAGGAUGGAUCUGGUUGGUGGAUGAACAAGUGUCACGCUGGCCAUCUCAAUGGAGUUUAUUACCAAGGUGGCACUUACUCAAAAGCAUCUACUCCUAAUGGUUAUGAUAAUGGCAUUAUUUGGGCCACUUGGAAAACCCGGUGGUAUUCCAUGAAGAAAACCACUAUGAAGAUAAUCCCAUUCAACAGACUCACAAUUGGAGAAGGACAGCAACACCACCUGGGGGGAGCCAAACAGGUCAGACCAGAGCACCCUGCGGAAACAGAAUAUGACUCACUUUACCCUGAGGAUGAUUUGUAGAAAAUUAACUGCUAACUUCUAUUGACCCACAAAGUUUCAGAAAUUCUCUGAAAGUUUCUUCCUUUUUUCUCUUACUAUAUUUAUUGAUUUCAAGUCUUCUAUUAAGGACAUUUAGCCUUCAAUGGAAAUUAAAACUCAUUUAGGACUGUAUUUCCAAAUUACUGAUAUCAGAGUUAUUUAAAAAUUGUUUAUUUGAGGAGAUAACAUUUCAACUUUGUUCCUAAAUAUAUAAUAAUAAAAUGAUUGACUUUAUUUGCAUUUUUAUGACCACUUGUCAUUUAUUUUGUCUUCGUAAAUUAUUUUCAUUAUAUCAAAUAUUUUAGUAUGUACUUAAUAAAAUAGGAGAACAUUUUAGAGUUUCAAAUUCCCAGGUAUUUUCCUUGUUUAUUACCCCUAAAUCAUUCCUAUUUAAUUCUUCUUUUUAAAUGGAGAAAAUUAUGUCUUUUUAAUAUGGUUUUUGUUUUGUUAUAUAUUCACAGGCUGGAGACGUUUAAAAGACCGUUUCAAAAGAGAUUUACUUUUUUAAAGGACUUUAUCUGAACAGAGAGAUAUAAUAUUUUUCCUAUUGGACAAUGGACUUGCAAAGCUUCACUUCAUUUUAAGAGCAAAAGACCCCAUGUUGAAAACUCCAUAACAGUUUUAUGCUGAUGAUAAUUUAUCUAC-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 2266)
FGG
fibrinogen gamma chain
strand -
NCBI CDS gene sequence (1362 bp)
5'-ATGAGTTGGTCCTTGCACCCCCGGAATTTAATTCTCTACTTCTATGCTCTTTTATTTCTCTCTTCAACATGTGTAGCATATGTTGCTACCAGAGACAACTGCTGCATCTTAGATGAAAGATTCGGTAGTTATTGTCCAACTACCTGTGGCATTGCAGATTTCCTGTCTACTTATCAAACCAAAGTAGACAAGGATCTACAGTCTTTGGAAGACATCTTACATCAAGTTGAAAACAAAACATCAGAAGTCAAACAGCTGATAAAAGCAATCCAACTCACTTATAATCCTGATGAATCATCAAAACCAAATATGATAGACGCTGCTACTTTGAAGTCCAGGAAAATGTTAGAAGAAATTATGAAATATGAAGCATCGATTTTAACACATGACTCAAGTATTCGATATTTGCAGGAAATATATAATTCAAATAATCAAAAGATTGTTAACCTGAAAGAGAAGGTAGCCCAGCTTGAAGCACAGTGCCAGGAACCTTGCAAAGACACGGTGCAAATCCATGATATCACTGGGAAAGATTGTCAAGACATTGCCAATAAGGGAGCTAAACAGAGCGGGCTTTACTTTATTAAACCTCTGAAAGCTAACCAGCAATTCTTAGTCTACTGTGAAATCGATGGGTCTGGAAATGGATGGACTGTGTTTCAGAAGAGACTTGATGGCAGTGTAGATTTCAAGAAAAACTGGATTCAATATAAAGAAGGATTTGGACATCTGTCTCCTACTGGCACAACAGAATTTTGGCTGGGAAATGAGAAGATTCATTTGATAAGCACACAGTCTGCCATCCCATATGCATTAAGAGTGGAACTGGAAGACTGGAATGGCAGAACCAGTACTGCAGACTATGCCATGTTCAAGGTGGGACCTGAAGCTGACAAGTACCGCCTAACATATGCCTACTTCGCTGGTGGGGATGCTGGAGATGCCTTTGATGGCTTTGATTTTGGCGATGATCCTAGTGACAAGTTTTTCACATCCCATAATGGCATGCAGTTCAGTACCTGGGACAATGACAATGATAAGTTTGAAGGCAACTGTGCTGAACAGGATGGATCTGGTTGGTGGATGAACAAGTGTCACGCTGGCCATCTCAATGGAGTTTATTACCAAGGTGGCACTTACTCAAAAGCATCTACTCCTAATGGTTATGATAATGGCATTATTTGGGCCACTTGGAAAACCCGGTGGTATTCCATGAAGAAAACCACTATGAAGATAATCCCATTCAACAGACTCACAATTGGAGAAGGACAGCAACACCACCTGGGGGGAGCCAAACAGGTCAGACCAGAGCACCCTGCGGAAACAGAATATGACTCACTTTACCCTGAGGATGATTTGTAG-3'
NCBI CDS gene sequence with introns (location: 154604834.. 154612609) (7776 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 154604171.. 154612656) (8486 bp)Download
NCBI gene sequence (location: [154604171.. 154612656 + 1000]) (9486 bp)Download
Cite How to cite