NCBI Summary
This gene encodes a member of the slit family of secreted glycoproteins, which are ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. Members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Proteolytic processing of this protein gives rise to an N-terminal fragment that contains the four leucine-rich repeats and five epidermal growth factor repeats and a C-terminal fragment that contains four epidermal growth factor repeats and the cysteine knot. Both full length and cleaved proteins are secreted extracellularly and can function in axon repulsion as well as other specific processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015].
Protein
Protein (NP_004778)
Slit homolog 2 protein
Slit homolog 2 protein (Slit-2) [Cleaved into: Slit homolog 2 protein N-product; Slit homolog 2 protein C-product]
SLIT2
slit guidance ligand 2
Undefined
Low evidence
Laminin G-like
Undefined
b-sandwich / ConA-like
GlcA(b1-3)Xyl(a1-4)GlcA / Matriglycan on alpha-dystroglycan
0.183
Protein sequence and protein families (fasta) (1529 amino acids) Download
MRGVGWQMLSLSLGLVLAILNKVAPQACPAQCSCSGSTVDCHGLALRSVPRNIPRNTERLDLNGNNITRITKTDFAGLRHLRVLQLMENKISTIERGAFQDLKELERLRLNRNHLQLFPELLFLGTAKLYRLDLSENQIQAIPRKAFRGAVDIKNLQLDYNQISCIEDGAFRALRDLEVLTLNNNNITRLSVASFNHMPKLRTFRLHSNNLYCDCHLAWLSDWLRQRPRVGLYTQCMGPSHLRGHNVAEVQKREFVCSGHQSFMAPSCSVLHCPAACTCSNNIVDCRGKGLTEIPTNLPETITEIRLEQNTIKVIPPGAFSPYKKLRRIDLSNNQISELAPDAFQGLRSLNSLVLYGNKITELPKSLFEGLFSLQLLLLNANKINCLRVDAFQDLHNLNLLSLYDNKLQTIAKGTFSPLRAIQTMHLAQNPFICDCHLKWLADYLHTNPIETSGARCTSPRRLANKRIGQIKSKKFRCSAKEQYFIPGTEDYRSKLSGDCFADLACPEKCRCEGTTVDCSNQKLNKIPEHIPQYTAELRLNNNEFTVLEATGIFKKLPQLRKINFSNNKITDIEEGAFEGASGVNEILLTSNRLENVQHKMFKGLESLKTLMLRSNRITCVGNDSFIGLSSVRLLSLYDNQITTVAPGAFDTLHSLSTLNLLANPFNCNCYLAWLGEWLRKKRIVTGNPRCQKPYFLKEIPIQDVAIQDFTCDDGNDDNSCSPLSRCPTECTCLDTVVRCSNKGLKVLPKGIPRDVTELYLDGNQFTLVPKELSNYKHLTLIDLSNNRISTLSNQSFSNMTQLLTLILSYNRLRCIPPRTFDGLKSLRLLSLHGNDISVVPEGAFNDLSALSHLAIGANPLYCDCNMQWLSDWVKSEYKEPGIARCAGPGEMADKLLLTTPSKKFTCQGPVDVNILAKCNPCLSNPCKNDGTCNSDPVDFYRCTCPYGFKGQDCDVPIHACISNPCKHGGTCHLKEGEEDGFWCICADGFEGENCEVNVDDCEDNDCENNSTCVDGINNYTCLCPPEYTGELCEEKLDFCAQDLNPCQHDSKCILTPKGFKCDCTPGYVGEHCDIDFDDCQDNKCKNGAHCTDAVNGYTCICPEGYSGLFCEFSPPMVLPRTSPCDNFDCQNGAQCIVRINEPICQCLPGYQGEKCEKLVSVNFINKESYLQIPSAKVRPQTNITLQIATDEDSGILLYKGDKDHIAVELYRGRVRASYDTGSHPASAIYSVETINDGNFHIVELLALDQSLSLSVDGGNPKIITNLSKQSTLNFDSPLYVGGMPGKSNVASLRQAPGQNGTSFHGCIRNLYINSELQDFQKVPMQTGILPGCEPCHKKVCAHGTCQPSSQAGFTCECQEGWMGPLCDQRTNDPCLGNKCVHGTCLPINAFSYSCKCLEGHGGVLCDEEEDLFNPCQAIKCKHGKCRLSGLGQPYCECSSGYTGDSCDREISCRGERIRDYYQKQQGYAACQTTKKVSRLECRGGCAGGQCCGPLRSKRRKYSFECTDGSSFVDEVEKVVKCGCTRCVS
Mol* PDB structure viewer
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.56, 2.0] ÅDownload
The location of the lectin domain structural model is: 1160-1333
We infer [1.56, 2.0] Å as the interval of error of this structural model.
Template: 5IK4 chain: A, Q60675, NP_032507.2, sequence identity: 28.2%, coverage: 96.0%, location in sequence: 2740-3118, (2740-3118 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Expression of the axon guidance factor Slit2 and its receptor Robo1 in patients with Hirschsprung disease: An observational study. [34414975]
  • Exome sequencing identifies SLIT2 variants in primary CNS lymphoma. [33481259]
  • The neurorepellent, Slit2, prevents macrophage lipid loading by inhibiting CD36-dependent binding and internalization of oxidized low-density lipoprotein. [33574432]
  • Structure and functional relevance of the Slit2 homodimerization domain. [19498462]
  • Vertebrate slit, a secreted ligand for the transmembrane protein roundabout, is a repellent for olfactory bulb axons. [10102269]
  • Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance. [10102268]
  • Biochemical purification of a mammalian slit protein as a positive regulator of sensory axon elongation and branching. [10102266]
  • Assignment of the human slit homologue SLIT2 to human chromosome band 4p15.2. [10575218]
  • Cloning and expressions of three mammalian homologues of Drosophila slit suggest possible roles for Slit in the formation and maintenance of the nervous system. [9813312]
  • Isolation of novel and known genes from a human fetal cochlear cDNA library using subtractive hybridization and differential screening. [7829101]
UniProt Main References (12 PubMed Identifiers)
  • Distinct but overlapping expression patterns of two vertebrate slit homologs implies functional roles in CNS development and organogenesis. [10349621]
  • Generation and annotation of the DNA sequences of human chromosomes 2 and 4. [15815621]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Squeezing axons out of the gray matter: a role for slit and semaphorin proteins from midline and ventral spinal cord. [10975526]
  • Slit2 is a repellent for retinal ganglion cell axons. [10864954]
  • The neuronal repellent Slit inhibits leukocyte chemotaxis induced by chemotactic factors. [11309622]
  • The N-terminal leucine-rich regions in Slit are sufficient to repel olfactory bulb axons and subventricular zone neurons. [11222645]
  • Diversity and specificity of actions of Slit2 proteolytic fragments in axon guidance. [11404413]
  • Hierarchical organization of guidance receptors: silencing of netrin attraction by slit through a Robo/DCC receptor complex. [11239147]
  • Slit proteins: molecular guidance cues for cells ranging from neurons to leukocytes. [12200164]
  • Show more
All isoforms of this gene containing a lectin domain
XP_011512212.2, XP_016864334.1, XP_011512211.1, XP_006714049.1, NP_001276065.1, NP_001276064.1, NP_004778.1, XP_005248268.1
RNA
RNA (Transcript ID: NM_004787.4)
slit guidance ligand 2, transcript variant 1
m7G-5')ppp(5'-ACUUGGUGUUAUUUAUUUGGGAAGCGCCCGGACGGCGGAGCUUGGCGGCGGCGGUGGUGGUGGCUGCCGCAGACUGUGGUUAAAAAAAAGAAGGCGGCGGCGGCGGCGGCGGCGGAGGCGGAGGCAGCUGCGAGGCAUGGGAGCGCCGAAGCGCCCAGGCGCAGGCCGAAGCUGCCGCGCUUUCUGGGCACGGCGGGAGUGCUGAGCAGAAAGGGGAGCGCCGGGGGCCCGCAGCCGGCUCCGGAGGCGCGGGCCGGGUUUUUGUUUGGCUACGCUGAGCGCCAGUCAGCCCCAGCGAACAACUCCAGUUACGACAACAACCCACCUUCCUUCCAGACAAGCGAGACUUGGGCUGCUGCGUCCGUCCUAUUGUUUAGACACUUGCCAGGGGCUCCGGAGUCGGCAGAGCCACCGAGUCCCCGCUCUGAGUCGUCGCCCUCCCUCUCCCCGACCUCGCUCCCUGGAGCGGGAGGCCAGGAAAGCAGCGGGAGAGGGGAAGGGGCUAGAAGGAGAAGGACUACCCGGGACUGCGGCCGCCGCGUCAGGUGCAGCGCCAGGAGCCGGGCGGCGUCGCCACGCCGGCAGGGGUACCGCCACUGUGGCCUUGGGGGACGGAAUUCAAAGCCUGGGAAAAGUUGCUGCACUUUGAGAAGGACGAACCACUAGUGGGAGACCGCCGGGGGCCGGCCGUGGCUCUGCGCCCUCCGGAACCCGGCUCUUGUUUCUUCUACCUUUGCCAUCAGGUGUCUGCCGCGGAGCUGCGGCUUAUCUGGGAGACGAGCGGGGUUGACACGCGCGCACACACUACUGCCAUUCAGCUGCCGCCUGGCUCUGCCUGGAGUAGUGGAUCCCACCCGCCCACCUGCCACCGAGCCAUUCUCCAGUACGCCCCAGCAGGACGCUGACACCUCCAACCUUGGCCUUUGCCUUUCCACUCCUUCCGGUCUGCCUGGUUUUUAAGUCCGCCCCCAGUCAGUCCCCACUCAGUCUUCGCAGCAGCUCUCAUCCUCCACUUGGCCUCUUGGAGUUCCUCGCCGGAGUGCUGACUAGUGGAUAUUUCUGCCCGGCUGCGGCGGCCCGACUGCCCUUUUGUCUUUUCUGCGUGACCUCGGGGCAGGUCCUGGUGCAGAGCGUCGCCAAGGACGCCGAGCGGGAGGCGGGAUUGCCCAGACAUCCUUCAGCGAAGUGCAUGUGUGUUUGUAAACCAUCGUUGGCUGUCGGGAGACCGCGAGGACCGGUCCAGGCUGCGGCGGAGUCGAGGGCGAGGGAGAGGCCGCGUGAGUGAGCAGAGUCCAGAGCCGUGCGCCCCCAGAACUGCGCGUCCGCCCCGUGCACCCCCGCGCGCCAUGCCCAGUUGCCCCGCGCGCUCUGCUACGGGCCCGCUGGGCUUCCGCGCCUUCUAGCUUCCGGAGCCCACUUUGAUCGGGGCCAUAAUACCUAUUGAGAUCCCCUCUUCUGUCUUGUACCUUCGCCACUGGCAUCGGAUUUGCAGAAGCGUGCGUGGGAUCAGAGGACCGCCCUCCCCACAACAACCGGCCCCUGCAUCUUAGCAGCCGUUGGAAGCCCCAGCUCUUUUACCGCCAAGUUCAUCCUUGGGAGACAGAAGACGCGUGAUCUCCUCUCCGCUGCUCUUGGGGUCUCCUUGCAGCCCUGGCCAGGCGGAUUCAUCCUCAGGACCUAAAGUUGCCCAAGGAGCUCCUGCUCUGCCAGAGGAGGGUGGAGAGGGCGGUGGGAGGCGUGUGCCUGAGUGGGCUCUACUGCCUUGUUCCAUAUUAUUUGGUGCACAUUUUCCCUGGCACUCUGGGUUGCUAGCCCCGCCGGGCACUGGGCCUCAGACACUGCGCGGUUCCCUCGGAGCAGCAAGCUAAAGAAAGCCCCCAGUGCCGGCGAGGAAGGAGGCGGCGGGGAAAGAUGCGCGGCGUUGGCUGGCAGAUGCUGUCCCUGUCGCUGGGGUUAGUGCUGGCGAUCCUGAACAAGGUGGCACCGCAGGCGUGCCCGGCGCAGUGCUCUUGCUCGGGCAGCACAGUGGACUGUCACGGGCUGGCGCUGCGCAGCGUGCCCAGGAAUAUCCCCCGCAACACCGAGAGACUGGAUUUAAAUGGAAAUAACAUCACAAGAAUUACGAAGACAGAUUUUGCUGGUCUUAGACAUCUAAGAGUUCUUCAGCUUAUGGAGAAUAAGAUUAGCACCAUUGAAAGAGGAGCAUUCCAGGAUCUUAAAGAACUAGAGAGACUGCGUUUAAACAGAAAUCACCUUCAGCUGUUUCCUGAGUUGCUGUUUCUUGGGACUGCGAAGCUAUACAGGCUUGAUCUCAGUGAAAACCAAAUUCAGGCAAUCCCAAGGAAAGCUUUCCGUGGGGCAGUUGACAUAAAAAAUUUGCAACUGGAUUACAACCAGAUCAGCUGUAUUGAAGAUGGGGCAUUCAGGGCUCUCCGGGACCUGGAAGUGCUCACUCUCAACAAUAACAACAUUACUAGACUUUCUGUGGCAAGUUUCAACCAUAUGCCUAAACUUAGGACUUUUCGACUGCAUUCAAACAACCUGUAUUGUGACUGCCACCUGGCCUGGCUCUCCGACUGGCUUCGCCAAAGGCCUCGGGUUGGUCUGUACACUCAGUGUAUGGGCCCCUCCCACCUGAGAGGCCAUAAUGUAGCCGAGGUUCAAAAACGAGAAUUUGUCUGCAGUGGUCACCAGUCAUUUAUGGCUCCUUCUUGUAGUGUUUUGCACUGCCCUGCCGCCUGUACCUGUAGCAACAAUAUCGUAGACUGUCGUGGGAAAGGUCUCACUGAGAUCCCCACAAAUCUUCCAGAGACCAUCACAGAAAUACGUUUGGAACAGAACACAAUCAAAGUCAUCCCUCCUGGAGCUUUCUCACCAUAUAAAAAGCUUAGACGAAUUGACCUGAGCAAUAAUCAGAUCUCUGAACUUGCACCAGAUGCUUUCCAAGGACUACGCUCUCUGAAUUCACUUGUCCUCUAUGGAAAUAAAAUCACAGAACUCCCCAAAAGUUUAUUUGAAGGACUGUUUUCCUUACAGCUCCUAUUAUUGAAUGCCAACAAGAUAAACUGCCUUCGGGUAGAUGCUUUUCAGGAUCUCCACAACUUGAACCUUCUCUCCCUAUAUGACAACAAGCUUCAGACCAUCGCCAAGGGGACCUUUUCACCUCUUCGGGCCAUUCAAACUAUGCAUUUGGCCCAGAACCCCUUUAUUUGUGACUGCCAUCUCAAGUGGCUAGCGGAUUAUCUCCAUACCAACCCGAUUGAGACCAGUGGUGCCCGUUGCACCAGCCCCCGCCGCCUGGCAAACAAAAGAAUUGGACAGAUCAAAAGCAAGAAAUUCCGUUGUUCAGCUAAAGAACAGUAUUUCAUUCCAGGUACAGAAGAUUAUCGAUCAAAAUUAAGUGGAGACUGCUUUGCGGAUCUGGCUUGCCCUGAAAAGUGUCGCUGUGAAGGAACCACAGUAGAUUGCUCUAAUCAAAAGCUCAACAAAAUCCCGGAGCACAUUCCCCAGUACACUGCAGAGUUGCGUCUCAAUAAUAAUGAAUUUACCGUGUUGGAAGCCACAGGAAUCUUUAAGAAACUUCCUCAAUUACGUAAAAUAAACUUUAGCAACAAUAAGAUCACAGAUAUUGAGGAGGGAGCAUUUGAAGGAGCAUCUGGUGUAAAUGAAAUACUUCUUACGAGUAAUCGUUUGGAAAAUGUGCAGCAUAAGAUGUUCAAGGGAUUGGAAAGCCUCAAAACUUUGAUGUUGAGAAGCAAUCGAAUAACCUGUGUGGGGAAUGACAGUUUCAUAGGACUCAGUUCUGUGCGUUUGCUUUCUUUGUAUGAUAAUCAAAUUACUACAGUUGCACCAGGGGCAUUUGAUACUCUCCAUUCUUUAUCUACUCUAAACCUCUUGGCCAAUCCUUUUAACUGUAACUGCUACCUGGCUUGGUUGGGAGAGUGGCUGAGAAAGAAGAGAAUUGUCACGGGAAAUCCUAGAUGUCAAAAACCAUACUUCCUGAAAGAAAUACCCAUCCAGGAUGUGGCCAUUCAGGACUUCACUUGUGAUGACGGAAAUGAUGACAAUAGUUGCUCCCCACUUUCUCGCUGUCCUACUGAAUGUACUUGCUUGGAUACAGUCGUCCGAUGUAGCAACAAGGGUUUGAAGGUCUUGCCGAAAGGUAUUCCAAGAGAUGUCACAGAGUUGUAUCUGGAUGGAAACCAAUUUACACUGGUUCCCAAGGAACUCUCCAACUACAAACAUUUAACACUUAUAGACUUAAGUAACAACAGAAUAAGCACGCUUUCUAAUCAGAGCUUCAGCAACAUGACCCAGCUCCUCACCUUAAUUCUUAGUUACAACCGUCUGAGAUGUAUUCCUCCUCGCACCUUUGAUGGAUUAAAGUCUCUUCGAUUACUUUCUCUACAUGGAAAUGACAUUUCUGUUGUGCCUGAAGGUGCUUUCAAUGAUCUUUCUGCAUUAUCACAUCUAGCAAUUGGAGCCAACCCUCUUUACUGUGAUUGUAACAUGCAGUGGUUAUCCGACUGGGUGAAGUCGGAAUAUAAGGAGCCUGGAAUUGCUCGUUGUGCUGGUCCUGGAGAAAUGGCAGAUAAACUUUUACUCACAACUCCCUCCAAAAAAUUUACCUGUCAAGGUCCUGUGGAUGUCAAUAUUCUAGCUAAGUGUAACCCCUGCCUAUCAAAUCCGUGUAAAAAUGAUGGCACAUGUAAUAGUGAUCCAGUUGACUUUUACCGAUGCACCUGUCCAUAUGGUUUCAAGGGGCAGGACUGUGAUGUCCCAAUUCAUGCCUGCAUCAGUAACCCAUGUAAACAUGGAGGAACUUGCCACUUAAAGGAAGGAGAAGAAGAUGGAUUCUGGUGUAUUUGUGCUGAUGGAUUUGAAGGAGAAAAUUGUGAAGUCAACGUUGAUGAUUGUGAAGAUAAUGACUGUGAAAAUAAUUCUACAUGUGUCGAUGGCAUUAAUAACUACACAUGCCUUUGCCCACCUGAGUAUACAGGUGAGUUGUGUGAGGAGAAGCUGGACUUCUGUGCCCAGGACCUGAACCCCUGCCAGCACGAUUCAAAGUGCAUCCUAACUCCAAAGGGAUUCAAAUGUGACUGCACACCAGGGUACGUAGGUGAACACUGCGACAUCGAUUUUGACGACUGCCAAGACAACAAGUGUAAAAACGGAGCCCACUGCACAGAUGCAGUGAACGGCUAUACGUGCAUAUGCCCCGAAGGUUACAGUGGCUUGUUCUGUGAGUUUUCUCCACCCAUGGUCCUCCCUCGUACCAGCCCCUGUGAUAAUUUUGAUUGUCAGAAUGGAGCUCAGUGUAUCGUCAGAAUAAAUGAGCCAAUAUGUCAGUGUUUGCCUGGCUAUCAGGGAGAAAAGUGUGAAAAAUUGGUUAGUGUGAAUUUUAUAAACAAAGAGUCUUAUCUUCAGAUUCCUUCAGCCAAGGUUCGGCCUCAGACGAACAUAACACUUCAGAUUGCCACAGAUGAAGACAGCGGAAUCCUCCUGUAUAAGGGUGACAAAGACCAUAUCGCGGUAGAACUCUAUCGGGGGCGUGUUCGUGCCAGCUAUGACACCGGCUCUCAUCCAGCUUCUGCCAUUUACAGUGUGGAGACAAUCAAUGAUGGAAACUUCCACAUUGUGGAACUACUUGCCUUGGAUCAGAGUCUCUCUUUGUCCGUGGAUGGUGGGAACCCCAAAAUCAUCACUAACUUGUCAAAGCAGUCCACUCUGAAUUUUGACUCUCCACUCUAUGUAGGAGGCAUGCCAGGGAAGAGUAACGUGGCAUCUCUGCGCCAGGCCCCUGGGCAGAACGGAACCAGCUUCCACGGCUGCAUCCGGAACCUUUACAUCAACAGUGAGCUGCAGGACUUCCAGAAGGUGCCGAUGCAAACAGGCAUUUUGCCUGGCUGUGAGCCAUGCCACAAGAAGGUGUGUGCCCAUGGCACAUGCCAGCCCAGCAGCCAGGCAGGCUUCACCUGCGAGUGCCAGGAAGGAUGGAUGGGGCCCCUCUGUGACCAACGGACCAAUGACCCUUGCCUUGGAAAUAAAUGCGUACAUGGCACCUGCUUGCCCAUCAAUGCGUUCUCCUACAGCUGUAAGUGCUUGGAGGGCCAUGGAGGUGUCCUCUGUGAUGAAGAGGAGGAUCUGUUUAACCCAUGCCAGGCGAUCAAGUGCAAGCAUGGGAAGUGCAGGCUUUCAGGUCUGGGGCAGCCCUACUGUGAAUGCAGCAGUGGAUACACGGGGGACAGCUGUGAUCGAGAAAUCUCUUGUCGAGGGGAAAGGAUAAGAGAUUAUUACCAAAAGCAGCAGGGCUAUGCUGCUUGCCAAACAACCAAGAAGGUGUCCCGAUUAGAGUGCAGAGGUGGGUGUGCAGGAGGGCAGUGCUGUGGACCGCUGAGGAGCAAGCGGCGGAAAUACUCUUUCGAAUGCACUGACGGCUCCUCCUUUGUGGACGAGGUUGAGAAAGUGGUGAAGUGCGGCUGUACGAGGUGUGUGUCCUAAACACACUCCCGGCAGCUCUGUCUUUGGAAAAGGUUGUAUACUUCUUGACCGUGUGGGACUAAUGAAUGCUUCAUAGUGGAAAUAUUUGAAAUAUAUUGUAAAAUACAGAACAGACUUAUUUUUAUUAUGAGAAUAAAGACUUUUUUUCUGCAUUUGGAAAAAAAAAAAAAGAAAUGCUUGAACUAAAGCUUCCCCUAUGCUGGAGAAGUAUGAAGAAAGAUAUACCUGGAGACAUUAGAACAGCGAUGGGAACCAUUGCAACUCGGGUCCAUCUUUGUAACAUGCUGAAGACAAGCAGAAGCACAUGCACGAGGGACAGAGGAGCUACUGUGCACUGCUGUGAAAUUGCCCAGAGCAUAAAACCUGUGUACCCUCCUUCACAUCAACCAAGUUCACUAGGACAUACCAAGCACAUGCGUGUGAAUGAGGAUGCAAGGCAAGAGAAUGGAACUCCAGAAUUCACAGAUAGAACAAAUGGAUGAGAAAUAUUUCAUGCAAAAUAUAAAGUGUCCUGAGGAUCUGGGUUCCAUUUACGAGAGGAAAUGAAAGUGCUAAAAUAAAUUUUAUCUUCCUUUUAAAUGUCAGCAUGUCAGCAGAAGCAGCACACAAAAGUCUUUACCAUUUUCCAGUAUUAAUUUUUUUGUAAUAUAAAUGAUAAAGGAGAUGAUAAAGAACCAAUAGAUUAUUGAUAAAUAAAUUAGUAAUAAUAUGAUUUUUUGUUUCUAUGAGUUCUAAACAGCCCUAUACAGUAUUCAGUUUCCAUGAGAAAUAUUUAUUGUAUCAAAGUACAUUGUACUUAACAUUUUAGGCCAUCCUUUUACUGUUCCUUGAUGCUUUAAUAUAUAUUAAUUUAUAAUUAUCCUGAUAUUUUUGUACAUUUUUCAAACUUAAAAAUCAGGAUUUUUUUUUUUUUUUUUUUGGCAAUAGUACUAACAUAGGGUUUUAUCUUGGGAUACAUAUGUAUUGGUCUGUUUGUUGACCUUGACAUCUGAUCACUGAUGUCAAUGACCUACUGGCCUCAUUCAGGACACCUGCAGAGAGUAUGCAAAGUCCGAGAGAGGAAAACAGAAAUCUGUAUGUGAGAUGGUCAUUGUACAGAAAGAAGUGGCCCCUCUGCAACAUGUCCUCACAGAAACGAAAUGGUGUGUAGCAAUCAACACUAGAAAGUAGACCUUUUGCAAAUUAAUAUGUCCUUGACCUUUUUUGCCCUUUUGUGGGGGUGAGGUGGGGAUAAAAAGACUGUCAUAUCAAGAACUGUGACUUUUCUUUCCCUCAAACAAUAAAACUCCUUUAUUAUCUUAAUGCUCCCAUGUUAACAUGUUUGCUGCUAAAUUACAAUGUAGAAUUGAUAAUGGUUUAUAGUGAACUGUGCUCUUCCCUCAUUAAAAUCCCAGGGUGCCCUGUAAAGAUGCAGAUGUUUCUUCCUGAAAACUUCUUUUUUUACAAAGAAAAUUAGAUGUACAUGUAUAAUUCAGUGUGCUUUGUCUUUCUCCAGAUUAAUAUCGGUUACACUGCUGAUGUUUGUAAAUUAAACAGAUAUUUACUUCAUUAA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 9353)
slit guidance ligand 2
strand +
Slit-2
NCBI CDS gene sequence (4590 bp)
5'-ATGCGCGGCGTTGGCTGGCAGATGCTGTCCCTGTCGCTGGGGTTAGTGCTGGCGATCCTGAACAAGGTGGCACCGCAGGCGTGCCCGGCGCAGTGCTCTTGCTCGGGCAGCACAGTGGACTGTCACGGGCTGGCGCTGCGCAGCGTGCCCAGGAATATCCCCCGCAACACCGAGAGACTGGATTTAAATGGAAATAACATCACAAGAATTACGAAGACAGATTTTGCTGGTCTTAGACATCTAAGAGTTCTTCAGCTTATGGAGAATAAGATTAGCACCATTGAAAGAGGAGCATTCCAGGATCTTAAAGAACTAGAGAGACTGCGTTTAAACAGAAATCACCTTCAGCTGTTTCCTGAGTTGCTGTTTCTTGGGACTGCGAAGCTATACAGGCTTGATCTCAGTGAAAACCAAATTCAGGCAATCCCAAGGAAAGCTTTCCGTGGGGCAGTTGACATAAAAAATTTGCAACTGGATTACAACCAGATCAGCTGTATTGAAGATGGGGCATTCAGGGCTCTCCGGGACCTGGAAGTGCTCACTCTCAACAATAACAACATTACTAGACTTTCTGTGGCAAGTTTCAACCATATGCCTAAACTTAGGACTTTTCGACTGCATTCAAACAACCTGTATTGTGACTGCCACCTGGCCTGGCTCTCCGACTGGCTTCGCCAAAGGCCTCGGGTTGGTCTGTACACTCAGTGTATGGGCCCCTCCCACCTGAGAGGCCATAATGTAGCCGAGGTTCAAAAACGAGAATTTGTCTGCAGTGGTCACCAGTCATTTATGGCTCCTTCTTGTAGTGTTTTGCACTGCCCTGCCGCCTGTACCTGTAGCAACAATATCGTAGACTGTCGTGGGAAAGGTCTCACTGAGATCCCCACAAATCTTCCAGAGACCATCACAGAAATACGTTTGGAACAGAACACAATCAAAGTCATCCCTCCTGGAGCTTTCTCACCATATAAAAAGCTTAGACGAATTGACCTGAGCAATAATCAGATCTCTGAACTTGCACCAGATGCTTTCCAAGGACTACGCTCTCTGAATTCACTTGTCCTCTATGGAAATAAAATCACAGAACTCCCCAAAAGTTTATTTGAAGGACTGTTTTCCTTACAGCTCCTATTATTGAATGCCAACAAGATAAACTGCCTTCGGGTAGATGCTTTTCAGGATCTCCACAACTTGAACCTTCTCTCCCTATATGACAACAAGCTTCAGACCATCGCCAAGGGGACCTTTTCACCTCTTCGGGCCATTCAAACTATGCATTTGGCCCAGAACCCCTTTATTTGTGACTGCCATCTCAAGTGGCTAGCGGATTATCTCCATACCAACCCGATTGAGACCAGTGGTGCCCGTTGCACCAGCCCCCGCCGCCTGGCAAACAAAAGAATTGGACAGATCAAAAGCAAGAAATTCCGTTGTTCAGCTAAAGAACAGTATTTCATTCCAGGTACAGAAGATTATCGATCAAAATTAAGTGGAGACTGCTTTGCGGATCTGGCTTGCCCTGAAAAGTGTCGCTGTGAAGGAACCACAGTAGATTGCTCTAATCAAAAGCTCAACAAAATCCCGGAGCACATTCCCCAGTACACTGCAGAGTTGCGTCTCAATAATAATGAATTTACCGTGTTGGAAGCCACAGGAATCTTTAAGAAACTTCCTCAATTACGTAAAATAAACTTTAGCAACAATAAGATCACAGATATTGAGGAGGGAGCATTTGAAGGAGCATCTGGTGTAAATGAAATACTTCTTACGAGTAATCGTTTGGAAAATGTGCAGCATAAGATGTTCAAGGGATTGGAAAGCCTCAAAACTTTGATGTTGAGAAGCAATCGAATAACCTGTGTGGGGAATGACAGTTTCATAGGACTCAGTTCTGTGCGTTTGCTTTCTTTGTATGATAATCAAATTACTACAGTTGCACCAGGGGCATTTGATACTCTCCATTCTTTATCTACTCTAAACCTCTTGGCCAATCCTTTTAACTGTAACTGCTACCTGGCTTGGTTGGGAGAGTGGCTGAGAAAGAAGAGAATTGTCACGGGAAATCCTAGATGTCAAAAACCATACTTCCTGAAAGAAATACCCATCCAGGATGTGGCCATTCAGGACTTCACTTGTGATGACGGAAATGATGACAATAGTTGCTCCCCACTTTCTCGCTGTCCTACTGAATGTACTTGCTTGGATACAGTCGTCCGATGTAGCAACAAGGGTTTGAAGGTCTTGCCGAAAGGTATTCCAAGAGATGTCACAGAGTTGTATCTGGATGGAAACCAATTTACACTGGTTCCCAAGGAACTCTCCAACTACAAACATTTAACACTTATAGACTTAAGTAACAACAGAATAAGCACGCTTTCTAATCAGAGCTTCAGCAACATGACCCAGCTCCTCACCTTAATTCTTAGTTACAACCGTCTGAGATGTATTCCTCCTCGCACCTTTGATGGATTAAAGTCTCTTCGATTACTTTCTCTACATGGAAATGACATTTCTGTTGTGCCTGAAGGTGCTTTCAATGATCTTTCTGCATTATCACATCTAGCAATTGGAGCCAACCCTCTTTACTGTGATTGTAACATGCAGTGGTTATCCGACTGGGTGAAGTCGGAATATAAGGAGCCTGGAATTGCTCGTTGTGCTGGTCCTGGAGAAATGGCAGATAAACTTTTACTCACAACTCCCTCCAAAAAATTTACCTGTCAAGGTCCTGTGGATGTCAATATTCTAGCTAAGTGTAACCCCTGCCTATCAAATCCGTGTAAAAATGATGGCACATGTAATAGTGATCCAGTTGACTTTTACCGATGCACCTGTCCATATGGTTTCAAGGGGCAGGACTGTGATGTCCCAATTCATGCCTGCATCAGTAACCCATGTAAACATGGAGGAACTTGCCACTTAAAGGAAGGAGAAGAAGATGGATTCTGGTGTATTTGTGCTGATGGATTTGAAGGAGAAAATTGTGAAGTCAACGTTGATGATTGTGAAGATAATGACTGTGAAAATAATTCTACATGTGTCGATGGCATTAATAACTACACATGCCTTTGCCCACCTGAGTATACAGGTGAGTTGTGTGAGGAGAAGCTGGACTTCTGTGCCCAGGACCTGAACCCCTGCCAGCACGATTCAAAGTGCATCCTAACTCCAAAGGGATTCAAATGTGACTGCACACCAGGGTACGTAGGTGAACACTGCGACATCGATTTTGACGACTGCCAAGACAACAAGTGTAAAAACGGAGCCCACTGCACAGATGCAGTGAACGGCTATACGTGCATATGCCCCGAAGGTTACAGTGGCTTGTTCTGTGAGTTTTCTCCACCCATGGTCCTCCCTCGTACCAGCCCCTGTGATAATTTTGATTGTCAGAATGGAGCTCAGTGTATCGTCAGAATAAATGAGCCAATATGTCAGTGTTTGCCTGGCTATCAGGGAGAAAAGTGTGAAAAATTGGTTAGTGTGAATTTTATAAACAAAGAGTCTTATCTTCAGATTCCTTCAGCCAAGGTTCGGCCTCAGACGAACATAACACTTCAGATTGCCACAGATGAAGACAGCGGAATCCTCCTGTATAAGGGTGACAAAGACCATATCGCGGTAGAACTCTATCGGGGGCGTGTTCGTGCCAGCTATGACACCGGCTCTCATCCAGCTTCTGCCATTTACAGTGTGGAGACAATCAATGATGGAAACTTCCACATTGTGGAACTACTTGCCTTGGATCAGAGTCTCTCTTTGTCCGTGGATGGTGGGAACCCCAAAATCATCACTAACTTGTCAAAGCAGTCCACTCTGAATTTTGACTCTCCACTCTATGTAGGAGGCATGCCAGGGAAGAGTAACGTGGCATCTCTGCGCCAGGCCCCTGGGCAGAACGGAACCAGCTTCCACGGCTGCATCCGGAACCTTTACATCAACAGTGAGCTGCAGGACTTCCAGAAGGTGCCGATGCAAACAGGCATTTTGCCTGGCTGTGAGCCATGCCACAAGAAGGTGTGTGCCCATGGCACATGCCAGCCCAGCAGCCAGGCAGGCTTCACCTGCGAGTGCCAGGAAGGATGGATGGGGCCCCTCTGTGACCAACGGACCAATGACCCTTGCCTTGGAAATAAATGCGTACATGGCACCTGCTTGCCCATCAATGCGTTCTCCTACAGCTGTAAGTGCTTGGAGGGCCATGGAGGTGTCCTCTGTGATGAAGAGGAGGATCTGTTTAACCCATGCCAGGCGATCAAGTGCAAGCATGGGAAGTGCAGGCTTTCAGGTCTGGGGCAGCCCTACTGTGAATGCAGCAGTGGATACACGGGGGACAGCTGTGATCGAGAAATCTCTTGTCGAGGGGAAAGGATAAGAGATTATTACCAAAAGCAGCAGGGCTATGCTGCTTGCCAAACAACCAAGAAGGTGTCCCGATTAGAGTGCAGAGGTGGGTGTGCAGGAGGGCAGTGCTGTGGACCGCTGAGGAGCAAGCGGCGGAAATACTCTTTCGAATGCACTGACGGCTCCTCCTTTGTGGACGAGGTTGAGAAAGTGGTGAAGTGCGGCTGTACGAGGTGTGTGTCCTAA-3'
NCBI CDS gene sequence with introns (location: 20253816.. 20619009) (365194 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 20251905.. 20620561) (368657 bp)Download
NCBI gene sequence (location: [20251905 - 1000].. 20620561) (369657 bp)Download
Cite How to cite