NCBI Summary
Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer, and affect healing of the epithelium. This gene, which is expressed in the gastric mucosa, has also been studied because of its expression in human tumors. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_003216)
Trefoil factor 1
Trefoil factor 1 (Breast cancer estrogen-inducible protein) (PNR-2) (Polypeptide P1.A) (hP1.A) (Protein pS2)
TFF1
trefoil factor 1
Undefined
Curated
Trefoil Factor
Undefined
peptide
GlcNAc(a1-4)Gal
0.79
MATMENKVICALVLVSMLALGTLAEAQTETCTVAPRERQNCGFPGVTPSQCANKGCCFDDTVRGVPWCFYPNTIDVPPEEECEF
Mol* PDB structure viewerUniLectin3D
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
- Estrogen-related receptor-gamma influences Helicobacter pylori infection by regulating TFF1 in gastric cancer. [34058470]
- Trefoil factor-1 upregulation in estrogen-receptor positive breast cancer correlates with an increased risk of bone metastasis. [33249323]
- TFF1 Induces Aggregation and Reduces Motility of Helicobacter pylori. [33673347]
- Chemical synthesis of human trefoil factor 1 (TFF1) and its homodimer provides novel insights into their mechanisms of action. [32391824]
- Trefoil factors share a lectin activity that defines their role in mucus. [32404934]
- Antipeptide antibodies against the pNR-2 oestrogen-regulated protein of human breast cancer cells and detection of pNR-2 expression in normal tissues by immunohistochemistry. [1707960]
- Expression of the pS2 gene in human gastric cancer cells derived from poorly differentiated adenocarcinoma. [2311759]
- hSP, the domain-duplicated homolog of pS2 protein, is co-expressed with pS2 in stomach but not in breast carcinoma. [2303034]
- Complete primary structure of the human estrogen-responsive gene (pS2) product. [2185238]
- Breast cancer-associated pS2 protein: synthesis and secretion by normal stomach mucosa. [3041593]
UniProt Main References (18 PubMed Identifiers)
- Sequence of the pS2 mRNA induced by estrogen in the human breast cancer cell line MCF-7. [6324130]
- Cloning of a gene expressed in human breast cancer and regulated by estrogen in MCF-7 cells. [3838275]
- Structure of the human oestrogen-responsive gene pS2. [3822834]
- Refined localization of autosomal recessive nonsyndromic deafness DFNB10 locus using 34 novel microsatellite markers, genomic structure, and exclusion of six known genes in the region. [10950923]
- The DNA sequence of human chromosome 21. [10830953]
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
- [Primary structure of human protein pS2]. [3146413]
- Interaction between TFF1, a gastric tumor suppressor trefoil protein, and TFIZ1, a brichos domain-containing protein with homology to SP-C. [15924415]
- Identification of human urinary trefoil factor 1 as a novel calcium oxalate crystal growth inhibitor. [16308573]
- Identification of a polypeptide secreted by human breast cancer cells (MCF-7) as the human estrogen-responsive gene (pS2) product. [3261981] Show more
RNA
RNA (Transcript ID: NM_003225.3)
m7G-5')ppp(5'-AUCCCUGACUCGGGGUCGCCUUUGGAGCAGAGAGGAGGCAAUGGCCACCAUGGAGAACAAGGUGAUCUGCGCCCUGGUCCUGGUGUCCAUGCUGGCCCUCGGCACCCUGGCCGAGGCCCAGACAGAGACGUGUACAGUGGCCCCCCGUGAAAGACAGAAUUGUGGUUUUCCUGGUGUCACGCCCUCCCAGUGUGCAAAUAAGGGCUGCUGUUUCGACGACACCGUUCGUGGGGUCCCCUGGUGCUUCUAUCCUAAUACCAUCGACGUCCCUCCAGAAGAGGAGUGUGAAUUUUAGACACUUCUGCAGGGAUCUGCCUGCAUCCUGACGCGGUGCCGUCCCCAGCACGGUGAUUAGUCCCAGAGCUCGGCUGCCACCUCCACCGGACACCUCAGACACGCUUCUGCAGCUGUGCCUCGGCUCACAACACAGAUUGACUGCUCUGACUUUGACUACUCAAAAUUGGCCUAAAAAUUAAAAGAGAUCGAUAUUAA-3'- Poly-A tail
- Coding region
DNA
DNA (Gene ID: 7031)
trefoil factor 1
strand -
D21S21, HPS2, pS2, pNR-2, HP1.A
NCBI CDS gene sequence (255 bp)
5'-ATGGCCACCATGGAGAACAAGGTGATCTGCGCCCTGGTCCTGGTGTCCATGCTGGCCCTCGGCACCCTGGCCGAGGCCCAGACAGAGACGTGTACAGTGGCCCCCCGTGAAAGACAGAATTGTGGTTTTCCTGGTGTCACGCCCTCCCAGTGTGCAAATAAGGGCTGCTGTTTCGACGACACCGTTCGTGGGGTCCCCTGGTGCTTCTATCCTAATACCATCGACGTCCCTCCAGAAGAGGAGTGTGAATTTTAG-3'
By using this site you agree to our privacy policy.
Please confirm you agree with the privacy policy before using the site.