NCBI Summary
This gene belongs to the pentraxin superfamily, whose members encode highly conserved multifunctional proteins. The encoded protein, like other members of this family, contains a conserved pentraxin domain at the C-terminus. The highest levels of expression of the protein were observed in bone marrow, small intestine and testes. [provided by RefSeq, Jun 2016].
Protein
Protein (NP_001315537)
Pentraxin-4
Pentraxin-4
PTX4
pentraxin 4
Undefined
Very low evidence
Pentraxin
Undefined
b-sandwich / ConA-like
Uncharacterised
0.392
Undefined
Protein sequence and protein families (fasta) (478 amino acids) Download
MGCSWRKTLSFFLVFVPIYLHGASSQEAAPVGPRKPFFERLRRLEEQFRRFQEVTWTHLQNIASNYNVSYNVDVRFRSLAEESQAVAQAVNRSQASVQGELAQLKAWVRKLQRRGRKVDTRLRALDLTLGERSQQRARERKAHKAQRDALQDSLARLEGLVHSQGARLAALEGRLPVAHPGTAALGPALVPTPTQPEELGPTSLKLQRDRQELRAASEHRGPPQDSSAPLQGRREPPASGSHRVLSGTAPKDPRQQAWSPQVPGEICGVGPTLVFPNASTRNVVFLSPGFVTALRALSFCSWVRTASGRLGTLLSYATEDNDNKLVLHGRDSLLPGSIHFVIGDPAFRELPLQLLLDGQWHHICVIWTSTQGRYWLHVDRRLVATGSRFREGYEIPPGGSLVLGQEQDSVGGGFDSSEAFVGSMSGLAIWDRALVPGEVANLAIGKEFPTGAILTLANAALAGGFVQGANCTCLERCP
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.55, 2.0] ÅDownload
The location of the lectin domain structural model is: 269-473
We infer [1.55, 2.0] Å as the interval of error of this structural model.
Template 1: 1GYK chain: A, P02743, NP_001630.1, sequence identity: 28.3%, coverage: 96.1%, location in sequence: 20-223, (1-204 in PDB).
Template 2: 3PVN chain: A, P02741, NP_000558.2, sequence identity: 27.8%, coverage: 93.7%, location in sequence: 19-224, (1-206 in PDB).
Template 3: 1HAS chain: A, P07629, NP_0NO0REFSEQ0.0, sequence identity: 26.3%, coverage: 96.1%, location in sequence: 23-234, (1-212 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (3 PubMed Identifiers)
  • Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. [22504420]
  • Evolution of the pentraxin family: the new entry PTX4. [20357257]
  • Sequence, structure and pathology of the fully annotated terminal 2 Mb of the short arm of human chromosome 16. [11157797]
UniProt Main References (2 PubMed Identifiers)
  • The sequence and analysis of duplication-rich human chromosome 16. [15616553]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
All isoforms of this gene containing a lectin domain
NP_001013680.1, NP_001315537.1
RNA
RNA (Transcript ID: NM_001328608.2)
pentraxin 4, transcript variant 1
m7G-5')ppp(5'-GGAGGGAGACUGCUGGGGCCUUGCCGUCUCUCCGGAUGGGUUGCUCGUGGAGGAAGACCUUGUCUUUCUUCCUUGUUUUUGUGCCUAUAUAUCUACAUGGGGCUUCAUCGCAGGAAGCCGCCCCAGUGGGGCCCAGGAAACCGUUUUUCGAGAGGCUCCGUAGGCUGGAGGAACAGUUCCGGAGAUUCCAGGAGGUGACCUGGACACACCUGCAGAACAUCGCCAGCAACUACAACGUGUCCUACAACGUUGACGUCCGGUUCCGGAGCCUGGCGGAAGAGAGCCAGGCUGUGGCUCAGGCAGUCAACCGGUCACAGGCCUCGGUGCAGGGGGAGCUGGCGCAGCUCAAGGCCUGGGUGAGGAAGCUGCAGCGCCGAGGCCGGAAAGUAGACACGCGGCUGCGGGCCUUGGACCUCACCCUGGGCGAGAGGAGCCAGCAGCGGGCCCGGGAAAGGAAGGCACACAAGGCCCAGAGGGACGCCCUGCAGGACUCACUGGCACGCCUGGAGGGCCUCGUCCACAGCCAGGGCGCCAGGCUGGCUGCUCUGGAGGGGCGGCUGCCCGUGGCCCACCCUGGCACUGCAGCCCUCGGGCCGGCCCUGGUCCCAACCCCAACCCAGCCUGAGGAGCUGGGCCCGACCUCCCUGAAGCUUCAGAGGGACAGGCAGGAGCUCCGAGCUGCCUCUGAGCACAGGGGCCCCCCACAGGACUCCUCGGCCCCUCUCCAAGGGAGGCGGGAGCCUCCAGCCUCAGGCAGCCAUCGGGUACUCAGUGGGACUGCCCCAAAAGACCCUCGGCAGCAGGCAUGGUCCCCCCAGGUGCCAGGAGAGAUUUGCGGCGUGGGCCCCACCCUCGUUUUCCCAAACGCCUCCACCAGGAACGUGGUCUUCCUCAGCCCUGGUUUCGUCACUGCCCUGCGAGCCCUGUCCUUCUGCAGCUGGGUCCGCACGGCCUCCGGCCGCCUGGGCACCCUCCUGUCCUACGCCACCGAGGACAAUGACAACAAGCUGGUGCUGCACGGCCGAGACUCCCUGCUGCCCGGAUCCAUCCACUUCGUGAUCGGGGACCCGGCCUUCAGGGAGCUGCCCUUGCAGCUGCUGCUGGACGGCCAGUGGCACCACAUCUGUGUCAUCUGGACGUCCACCCAGGGCAGGUACUGGCUCCACGUGGAUCGCAGGCUGGUGGCCACCGGCUCCCGCUUCAGGGAGGGCUAUGAGAUCCCCCCCGGAGGGUCCCUCGUGCUGGGCCAGGAACAAGACAGCGUGGGGGGCGGAUUCGACAGCUCCGAGGCCUUCGUGGGGAGCAUGUCUGGCUUGGCUAUCUGGGAUCGGGCGCUGGUUCCCGGGGAAGUUGCAAACCUUGCCAUCGGGAAAGAGUUCCCGACAGGUGCCAUCCUGACGCUGGCCAAUGCUGCACUAGCAGGCGGAUUUGUGCAGGGGGCCAACUGCACCUGCCUGGAACGCUGUCCCUGAGGCCGAGCCGCACGGGGGCUGAGGCCAGCAAGGGCAGCAUGCCCCCAUCCACA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 390667)
pentraxin 4
strand -
NCBI CDS gene sequence (1437 bp)
5'-ATGGGTTGCTCGTGGAGGAAGACCTTGTCTTTCTTCCTTGTTTTTGTGCCTATATATCTACATGGGGCTTCATCGCAGGAAGCCGCCCCAGTGGGGCCCAGGAAACCGTTTTTCGAGAGGCTCCGTAGGCTGGAGGAACAGTTCCGGAGATTCCAGGAGGTGACCTGGACACACCTGCAGAACATCGCCAGCAACTACAACGTGTCCTACAACGTTGACGTCCGGTTCCGGAGCCTGGCGGAAGAGAGCCAGGCTGTGGCTCAGGCAGTCAACCGGTCACAGGCCTCGGTGCAGGGGGAGCTGGCGCAGCTCAAGGCCTGGGTGAGGAAGCTGCAGCGCCGAGGCCGGAAAGTAGACACGCGGCTGCGGGCCTTGGACCTCACCCTGGGCGAGAGGAGCCAGCAGCGGGCCCGGGAAAGGAAGGCACACAAGGCCCAGAGGGACGCCCTGCAGGACTCACTGGCACGCCTGGAGGGCCTCGTCCACAGCCAGGGCGCCAGGCTGGCTGCTCTGGAGGGGCGGCTGCCCGTGGCCCACCCTGGCACTGCAGCCCTCGGGCCGGCCCTGGTCCCAACCCCAACCCAGCCTGAGGAGCTGGGCCCGACCTCCCTGAAGCTTCAGAGGGACAGGCAGGAGCTCCGAGCTGCCTCTGAGCACAGGGGCCCCCCACAGGACTCCTCGGCCCCTCTCCAAGGGAGGCGGGAGCCTCCAGCCTCAGGCAGCCATCGGGTACTCAGTGGGACTGCCCCAAAAGACCCTCGGCAGCAGGCATGGTCCCCCCAGGTGCCAGGAGAGATTTGCGGCGTGGGCCCCACCCTCGTTTTCCCAAACGCCTCCACCAGGAACGTGGTCTTCCTCAGCCCTGGTTTCGTCACTGCCCTGCGAGCCCTGTCCTTCTGCAGCTGGGTCCGCACGGCCTCCGGCCGCCTGGGCACCCTCCTGTCCTACGCCACCGAGGACAATGACAACAAGCTGGTGCTGCACGGCCGAGACTCCCTGCTGCCCGGATCCATCCACTTCGTGATCGGGGACCCGGCCTTCAGGGAGCTGCCCTTGCAGCTGCTGCTGGACGGCCAGTGGCACCACATCTGTGTCATCTGGACGTCCACCCAGGGCAGGTACTGGCTCCACGTGGATCGCAGGCTGGTGGCCACCGGCTCCCGCTTCAGGGAGGGCTATGAGATCCCCCCCGGAGGGTCCCTCGTGCTGGGCCAGGAACAAGACAGCGTGGGGGGCGGATTCGACAGCTCCGAGGCCTTCGTGGGGAGCATGTCTGGCTTGGCTATCTGGGATCGGGCGCTGGTTCCCGGGGAAGTTGCAAACCTTGCCATCGGGAAAGAGTTCCCGACAGGTGCCATCCTGACGCTGGCCAATGCTGCACTAGCAGGCGGATTTGTGCAGGGGGCCAACTGCACCTGCCTGGAACGCTGTCCCTGA-3'
NCBI CDS gene sequence with introns (location: 1485939.. 1488909) (2971 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 1485886.. 1488944) (3059 bp)Download
NCBI gene sequence (location: [1485886.. 1488944 + 1000]) (4059 bp)Download
Cite How to cite