NCBI Summary
This gene encodes the alpha subunit of the coagulation factor fibrinogen, which is a component of the blood clot. Following vascular injury, the encoded preproprotein is proteolytically processed by thrombin during the conversion of fibrinogen to fibrin. Mutations in this gene lead to several disorders, including dysfibrinogenemia, hypofibrinogenemia, afibrinogenemia and renal amyloidosis. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that undergoes proteolytic processing. [provided by RefSeq, Jan 2016].
Protein
Protein (NP_000499)
Fibrinogen alpha chain
Fibrinogen alpha chain [Cleaved into: Fibrinopeptide A; Fibrinogen alpha chain]
FGA
fibrinogen alpha chain
Undefined
Very low evidence
Ficolin-like
Undefined
a/b mixed with b-sheet / Fibrinogen C-ter like
Uncharacterised
Undefined
0.582
Undefined
Protein sequence and protein families (fasta) (866 amino acids) Download
MFSMRIVCLVLSVVGTAWTADSGEGDFLAEGGGVRGPRVVERHQSACKDSDWPFCSDEDWNYKCPSGCRMKGLIDEVNQDFTNRINKLKNSLFEYQKNNKDSHSLTTNIMEILRGDFSSANNRDNTYNRVSEDLRSRIEVLKRKVIEKVQHIQLLQKNVRAQLVDMKRLEVDIDIKIRSCRGSCSRALAREVDLKDYEDQQKQLEQVIAKDLLPSRDRQHLPLIKMKPVPDLVPGNFKSQLQKVPPEWKALTDMPQMRMELERPGGNEITRGGSTSYGTGSETESPRNPSSAGSWNSGSSGPGSTGNRNPGSSGTGGTATWKPGSSGPGSTGSWNSGSSGTGSTGNQNPGSPRPGSTGTWNPGSSERGSAGHWTSESSVSGSTGQWHSESGSFRPDSPGSGNARPNNPDWGTFEEVSGNVSPGTRREYHTEKLVTSKGDKELRTGKEKVTSGSTTTTRRSCSKTVTKTVIGPDGHKEVTKEVVTSEDGSDCPEAMDLGTLSGIGTLDGFRHRHPDEAAFFDTASTGKTFPGFFSPMLGEFVSETESRGSESGIFTNTKESSSHHPGIAEFPSRGKSSSYSKQFTSSTSYNRGDSTFESKSYKMADEAGSEADHEGTHSTKRGHAKSRPVRDCDDVLQTHPSGTQSGIFNIKLPGSSKIFSVYCDQETSLGGWLLIQQRMDGSLNFNRTWQDYKRGFGSLNDEGEGEFWLGNDYLHLLTQRGSVLRVELEDWAGNEAYAEYHFRVGSEAEGYALQVSSYEGTAGDALIEGSVEEGAEYTSHNNMQFSTFDRDADQWEENCAEVYGGGWWYNNCQAANLNGIYYPGGSYDPRNNSPYEIENGVVWVSFRGADYSLRAVRMKIRPLVTQ
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Afibrinogenemia with two compound heterozygous mutations in FGA gene. [34255402]
  • Identification of a novel mutation in congenital afibrinogenemia in Iranian patients. [33901106]
  • GPVI (Glycoprotein VI) Interaction With Fibrinogen Is Mediated by Avidity and the Fibrinogen alphaC-Region. [33472402]
  • Analysis of an Inherited Dysfibrinogenemia Pedigree Associated with a Heterozygous Mutation in the FGA Gene. [33374030]
  • Fibrinogen and factor XIII at the intersection of coagulation, fibrinolysis and inflammation. [25182841]
  • Fibrinogen gene regulation. [22836683]
  • Amino acid sequence studies on the alpha chain of human fibrinogen. Overlapping sequences providing the complete sequence. [518846]
  • Amino acid sequence studies on the alpha chain of human fibrinogen. Exact location of cross-linking acceptor sites. [518845]
  • Localization of the alpha-chain cross-link acceptor sites of human fibrin. [632262]
  • Disulfide bridges in nh2 -terminal part of human fibrinogen. [936108]
UniProt Main References (41 PubMed Identifiers)
  • Carboxy-terminal-extended variant of the human fibrinogen alpha subunit: a novel exon conferring marked homology to beta and gamma subunits. [1457396]
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Nucleotide sequences of the three genes coding for human fibrinogen. [2102623]
  • Partial mRNA sequences for human A alpha, B beta, and gamma fibrinogen chains: evolutionary and functional implications. [6575389]
  • Characterization of a complementary deoxyribonucleic acid coding for the alpha chain of human fibrinogen. [6688355]
  • Isolation and characterisation of cDNA clones for the A alpha- and gamma-chains of human fibrinogen. [6689067]
  • Cloning of fibrinogen genes and their cDNA. [6575700]
  • The arrangement of disulfide bonds in fragment D from human fibrinogen. [741445]
  • Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry. [16335952]
  • Show more
RNA
RNA (Transcript ID: NM_000508.5)
fibrinogen alpha chain, transcript variant alpha-E
m7G-5')ppp(5'-AAUCCUUUCUUUCAGCUGGAGUGCUCCUCAGGAGCCAGCCCCACCCUUAGAAAAGAUGUUUUCCAUGAGGAUCGUCUGCCUGGUCCUAAGUGUGGUGGGCACAGCAUGGACUGCAGAUAGUGGUGAAGGUGACUUUCUAGCUGAAGGAGGAGGCGUGCGUGGCCCAAGGGUUGUGGAAAGACAUCAAUCUGCCUGCAAAGAUUCAGACUGGCCCUUCUGCUCUGAUGAAGACUGGAACUACAAAUGCCCUUCUGGCUGCAGGAUGAAAGGGUUGAUUGAUGAAGUCAAUCAAGAUUUUACAAACAGAAUAAAUAAGCUCAAAAAUUCACUAUUUGAAUAUCAGAAGAACAAUAAGGAUUCUCAUUCGUUGACCACUAAUAUAAUGGAAAUUUUGAGAGGCGAUUUUUCCUCAGCCAAUAACCGUGAUAAUACCUACAACCGAGUGUCAGAGGAUCUGAGAAGCAGAAUUGAAGUCCUGAAGCGCAAAGUCAUAGAAAAAGUACAGCAUAUCCAGCUUCUGCAGAAAAAUGUUAGAGCUCAGUUGGUUGAUAUGAAACGACUGGAGGUGGACAUUGAUAUUAAGAUCCGAUCUUGUCGAGGGUCAUGCAGUAGGGCUUUAGCUCGUGAAGUAGAUCUGAAGGACUAUGAAGAUCAGCAGAAGCAACUUGAACAGGUCAUUGCCAAAGACUUACUUCCCUCUAGAGAUAGGCAACACUUACCACUGAUAAAAAUGAAACCAGUUCCAGACUUGGUUCCCGGAAAUUUUAAGAGCCAGCUUCAGAAGGUACCCCCAGAGUGGAAGGCAUUAACAGACAUGCCGCAGAUGAGAAUGGAGUUAGAGAGACCUGGUGGAAAUGAGAUUACUCGAGGAGGCUCCACCUCUUAUGGAACCGGAUCAGAGACGGAAAGCCCCAGGAACCCUAGCAGUGCUGGAAGCUGGAACUCUGGGAGCUCUGGACCUGGAAGUACUGGAAACCGAAACCCUGGGAGCUCUGGGACUGGAGGGACUGCAACCUGGAAACCUGGGAGCUCUGGACCUGGAAGUACUGGAAGCUGGAACUCUGGGAGCUCUGGAACUGGAAGUACUGGAAACCAAAACCCUGGGAGCCCUAGACCUGGUAGUACCGGAACCUGGAAUCCUGGCAGCUCUGAACGCGGAAGUGCUGGGCACUGGACCUCUGAGAGCUCUGUAUCUGGUAGUACUGGACAAUGGCACUCUGAAUCUGGAAGUUUUAGGCCAGAUAGCCCAGGCUCUGGGAACGCGAGGCCUAACAACCCAGACUGGGGCACAUUUGAAGAGGUGUCAGGAAAUGUAAGUCCAGGGACAAGGAGAGAGUACCACACAGAAAAACUGGUCACUUCUAAAGGAGAUAAAGAGCUCAGGACUGGUAAAGAGAAGGUCACCUCUGGUAGCACAACCACCACGCGUCGUUCAUGCUCUAAAACCGUUACUAAGACUGUUAUUGGUCCUGAUGGUCACAAAGAAGUUACCAAAGAAGUGGUGACCUCCGAAGAUGGUUCUGACUGUCCCGAGGCAAUGGAUUUAGGCACAUUGUCUGGCAUAGGUACUCUGGAUGGGUUCCGCCAUAGGCACCCUGAUGAAGCUGCCUUCUUCGACACUGCCUCAACUGGAAAAACAUUCCCAGGUUUCUUCUCACCUAUGUUAGGAGAGUUUGUCAGUGAGACUGAGUCUAGGGGCUCAGAAUCUGGCAUCUUCACAAAUACAAAGGAAUCCAGUUCUCAUCACCCUGGGAUAGCUGAAUUCCCUUCCCGUGGUAAAUCUUCAAGUUACAGCAAACAAUUUACUAGUAGCACGAGUUACAACAGAGGAGACUCCACAUUUGAAAGCAAGAGCUAUAAAAUGGCAGAUGAGGCCGGAAGUGAAGCCGAUCAUGAAGGAACACAUAGCACCAAGAGAGGCCAUGCUAAAUCUCGCCCUGUCAGAGACUGUGAUGAUGUCCUCCAAACACAUCCUUCAGGUACCCAAAGUGGCAUUUUCAAUAUCAAGCUACCGGGAUCCAGUAAGAUUUUUUCUGUUUAUUGCGAUCAAGAGACCAGUUUGGGAGGAUGGCUUUUGAUCCAGCAAAGAAUGGAUGGAUCACUGAAUUUUAACCGGACCUGGCAAGACUACAAGAGAGGUUUCGGCAGCCUGAAUGACGAGGGGGAAGGAGAAUUCUGGCUAGGCAAUGACUACCUCCACUUACUAACCCAAAGGGGCUCUGUUCUUAGGGUUGAAUUAGAGGACUGGGCUGGGAAUGAAGCUUAUGCAGAAUAUCACUUCCGGGUAGGCUCUGAGGCUGAAGGCUAUGCCCUCCAAGUCUCCUCCUAUGAAGGCACUGCGGGUGAUGCUCUGAUUGAGGGUUCCGUAGAGGAAGGGGCAGAGUACACCUCUCACAACAACAUGCAGUUCAGCACCUUUGACAGGGAUGCAGACCAGUGGGAAGAGAACUGUGCAGAAGUCUAUGGGGGAGGCUGGUGGUAUAAUAACUGCCAAGCAGCCAAUCUCAAUGGAAUCUACUACCCUGGGGGCUCCUAUGACCCAAGGAAUAACAGUCCUUAUGAGAUUGAGAAUGGAGUGGUCUGGGUUUCCUUUAGAGGGGCAGAUUAUUCCCUCAGGGCUGUUCGCAUGAAAAUUAGGCCCCUUGUGACCCAAUAGGCUGAAGAAGUGGGAAUGGGAGCACUCUGUCUUCUUUGCUAGAGAAGUGGAGAGAAAAUACAAAAGGUAAAGCAGUUGAGAUUCUCUACAACCUAAAAAAUUCCUAGGUGCUAUUUUCUUAUCCUUUGUACUGUAGCUAAAUGUACCUGAGACAUAUUAGUCUUUGAAAAAUAAAGUUAUGUAAGGUUUUUUUUAUCUUUAAAUAGCUCUGUGGGUUUUAACAUUUUUAUAAAGAUAUACCAAGGGCCAUUCAGUACAUCAGGAAAGUGGCAGACAGAAGCUUCUCUCUGCAACCUUGAAGACUAUUGGUUUGAGAACUUCUCUUCCCAUACCACCCAAAAUCAUAAUGCCAUUGGAAAGCAAAAAGUUGUUUUAUCCAUUUGAUUUGAAUUGUUUUAAGCCAAUAUUUUAAGGUAAAACUCACUGAAUCUAACCAUAGCUGACCUUUGUAGUAGAAUUUACAACUUAUAAUUACAAUGCACAAUUUAUAAUUACAAUAUGUAUUUAUGUCUUUUGCUAUGGAGCAAAUCCAGGAAGGCAAGAGAAACAUUCUUUCCUAAAUAUAAAUGAAAAUCUAUCCUUUAAACUCUUCCACUAGACGUUGUAAUGCACACUUAUUUUUUUCCCAAGGAGUAACCAAUUUCUUUCUAAAACACAUUUAAAAUUUUAAAACUAUUUAUGAAUAUUAAAAAAAGACAUAAUUCACACAUUAAUAAACAAUCUCCCAAGUAUUGAUUUAACUUCAUUUUUCUAAUAAUCAUAAACUAUAUUCUGUGACAUGCUAAUUAUUAUUAAAUGUAAGUCGUUAGUUCGAAAGCCUCUCACUAAGUAUGAUCUAUGCUAUAUUCAAAAUUCAACCCAUUUACUUUGGUCAAUAUUUGAUCUAAGUUGCAUCUUUAAUCCUGGUGGUCUUGCCUUCUGAUUUUUAAUUUGUAUCCUUUUCUAUUAAGAUAUAUUUGUCAUUUUCUCUUGAAUAUGUAUUAAAAUAUCCCAAGCAA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 2243)
FGA
fibrinogen alpha chain
strand -
NCBI CDS gene sequence (2601 bp)
5'-ATGTTTTCCATGAGGATCGTCTGCCTGGTCCTAAGTGTGGTGGGCACAGCATGGACTGCAGATAGTGGTGAAGGTGACTTTCTAGCTGAAGGAGGAGGCGTGCGTGGCCCAAGGGTTGTGGAAAGACATCAATCTGCCTGCAAAGATTCAGACTGGCCCTTCTGCTCTGATGAAGACTGGAACTACAAATGCCCTTCTGGCTGCAGGATGAAAGGGTTGATTGATGAAGTCAATCAAGATTTTACAAACAGAATAAATAAGCTCAAAAATTCACTATTTGAATATCAGAAGAACAATAAGGATTCTCATTCGTTGACCACTAATATAATGGAAATTTTGAGAGGCGATTTTTCCTCAGCCAATAACCGTGATAATACCTACAACCGAGTGTCAGAGGATCTGAGAAGCAGAATTGAAGTCCTGAAGCGCAAAGTCATAGAAAAAGTACAGCATATCCAGCTTCTGCAGAAAAATGTTAGAGCTCAGTTGGTTGATATGAAACGACTGGAGGTGGACATTGATATTAAGATCCGATCTTGTCGAGGGTCATGCAGTAGGGCTTTAGCTCGTGAAGTAGATCTGAAGGACTATGAAGATCAGCAGAAGCAACTTGAACAGGTCATTGCCAAAGACTTACTTCCCTCTAGAGATAGGCAACACTTACCACTGATAAAAATGAAACCAGTTCCAGACTTGGTTCCCGGAAATTTTAAGAGCCAGCTTCAGAAGGTACCCCCAGAGTGGAAGGCATTAACAGACATGCCGCAGATGAGAATGGAGTTAGAGAGACCTGGTGGAAATGAGATTACTCGAGGAGGCTCCACCTCTTATGGAACCGGATCAGAGACGGAAAGCCCCAGGAACCCTAGCAGTGCTGGAAGCTGGAACTCTGGGAGCTCTGGACCTGGAAGTACTGGAAACCGAAACCCTGGGAGCTCTGGGACTGGAGGGACTGCAACCTGGAAACCTGGGAGCTCTGGACCTGGAAGTACTGGAAGCTGGAACTCTGGGAGCTCTGGAACTGGAAGTACTGGAAACCAAAACCCTGGGAGCCCTAGACCTGGTAGTACCGGAACCTGGAATCCTGGCAGCTCTGAACGCGGAAGTGCTGGGCACTGGACCTCTGAGAGCTCTGTATCTGGTAGTACTGGACAATGGCACTCTGAATCTGGAAGTTTTAGGCCAGATAGCCCAGGCTCTGGGAACGCGAGGCCTAACAACCCAGACTGGGGCACATTTGAAGAGGTGTCAGGAAATGTAAGTCCAGGGACAAGGAGAGAGTACCACACAGAAAAACTGGTCACTTCTAAAGGAGATAAAGAGCTCAGGACTGGTAAAGAGAAGGTCACCTCTGGTAGCACAACCACCACGCGTCGTTCATGCTCTAAAACCGTTACTAAGACTGTTATTGGTCCTGATGGTCACAAAGAAGTTACCAAAGAAGTGGTGACCTCCGAAGATGGTTCTGACTGTCCCGAGGCAATGGATTTAGGCACATTGTCTGGCATAGGTACTCTGGATGGGTTCCGCCATAGGCACCCTGATGAAGCTGCCTTCTTCGACACTGCCTCAACTGGAAAAACATTCCCAGGTTTCTTCTCACCTATGTTAGGAGAGTTTGTCAGTGAGACTGAGTCTAGGGGCTCAGAATCTGGCATCTTCACAAATACAAAGGAATCCAGTTCTCATCACCCTGGGATAGCTGAATTCCCTTCCCGTGGTAAATCTTCAAGTTACAGCAAACAATTTACTAGTAGCACGAGTTACAACAGAGGAGACTCCACATTTGAAAGCAAGAGCTATAAAATGGCAGATGAGGCCGGAAGTGAAGCCGATCATGAAGGAACACATAGCACCAAGAGAGGCCATGCTAAATCTCGCCCTGTCAGAGACTGTGATGATGTCCTCCAAACACATCCTTCAGGTACCCAAAGTGGCATTTTCAATATCAAGCTACCGGGATCCAGTAAGATTTTTTCTGTTTATTGCGATCAAGAGACCAGTTTGGGAGGATGGCTTTTGATCCAGCAAAGAATGGATGGATCACTGAATTTTAACCGGACCTGGCAAGACTACAAGAGAGGTTTCGGCAGCCTGAATGACGAGGGGGAAGGAGAATTCTGGCTAGGCAATGACTACCTCCACTTACTAACCCAAAGGGGCTCTGTTCTTAGGGTTGAATTAGAGGACTGGGCTGGGAATGAAGCTTATGCAGAATATCACTTCCGGGTAGGCTCTGAGGCTGAAGGCTATGCCCTCCAAGTCTCCTCCTATGAAGGCACTGCGGGTGATGCTCTGATTGAGGGTTCCGTAGAGGAAGGGGCAGAGTACACCTCTCACAACAACATGCAGTTCAGCACCTTTGACAGGGATGCAGACCAGTGGGAAGAGAACTGTGCAGAAGTCTATGGGGGAGGCTGGTGGTATAATAACTGCCAAGCAGCCAATCTCAATGGAATCTACTACCCTGGGGGCTCCTATGACCCAAGGAATAACAGTCCTTATGAGATTGAGAATGGAGTGGTCTGGGTTTCCTTTAGAGGGGCAGATTATTCCCTCAGGGCTGTTCGCATGAAAATTAGGCCCCTTGTGACCCAATAG-3'
NCBI CDS gene sequence with introns (location: 154584124.. 154590687) (6564 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 154583126.. 154590742) (7617 bp)Download
NCBI gene sequence (location: [154583126.. 154590742 + 1000]) (8617 bp)Download
Cite How to cite