NCBI Summary
This locus represents naturally occurring transcripts that splice the 5' exons of the POC1B (POC1 centriolar protein homolog B) gene on chromosome 12 to the GALNT4 (UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 4) gene, which is located within a POC1B intron. Alternative splicing results in two transcript variants, one of which encodes a fusion isoform that shares sequence identity with the products of each individual gene. [provided by RefSeq, Dec 2010].
Protein
Protein (NP_001186710)
CBM13-ppGalNAc-T4
Polypeptide N-acetylgalactosaminyltransferase 4 (EC 2.4.1.41) (Polypeptide GalNAc transferase 4) (GalNAc-T4) (pp-GaNTase 4) (Protein-UDP acetylgalactosaminyltransferase 4) (UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 4)
POC1B-GALNT4
POC1B-GALNT4 readthrough
Undefined
Curated
Ricin-like
R-Type Lectins
b-trefoil
Undefined
Undefined
Protein sequence and protein families (fasta) (575 amino acids) Download
MASATEDPVLERYFKGHKAAITSLDLSPNGKQLGAGRARELGSRRLSDLQKNTEDLSRPLYKKPPADSRALGEWGKASKLQLNEDELKQQEELIERYAINIYLSDRISLHRHIEDKRMYECKSQKFNYRTLPTTSVIIAFYNEAWSTLLRTIHSVLETSPAVLLKEIILVDDLSDRVYLKTQLETYISNLDRVRLIRTNKREGLVRARLIGATFATGDVLTFLDCHCECNSGWLEPLLERIGRDETAVVCPVIDTIDWNTFEFYMQIGEPMIGGFDWRLTFQWHSVPKQERDRRISRIDPIRSPTMAGGLFAVSKKYFQYLGTYDTGMEVWGGENLELSFRVWQCGGKLEIHPCSHVGHVFPKRAPYARPNFLQNTARAAEVWMDEYKEHFYNRNPPARKEAYGDISERKLLRERLRCKSFDWYLKNVFPNLHVPEDRPGWHGAIRSRGISSECLDYNSPDNNPTGANLSLFGCHGQGGNQFFEYTSNKEIRFNSVTELCAEVPEQKNYVGMQNCPKDGFPVPANIIWHFKEDGTIFHPHSGLCLSAYRTPEGRPDVQMRTCDALDKNQIWSFEK
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
GalNAc, Glycopeptide
GalNAc
References
NCBI References (1 PubMed Identifiers)
  • Expression of conjoined genes: another mechanism for gene regulation in eukaryotes. [20967262]
UniProt Main References (6 PubMed Identifiers)
  • Cloning of a human UDP-N-acetyl-alpha-D-Galactosamine:polypeptide N-acetylgalactosaminyltransferase that complements other GalNAc-transferases in complete O-glycosylation of the MUC1 tandem repeat. [9804815]
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The finished DNA sequence of human chromosome 12. [16541075]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • The lectin domain of UDP-N-acetyl-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase-T4 directs its glycopeptide specificities. [10984485]
  • The interdomain flexible linker of the polypeptide GalNAc transferases dictates their long-range glycosylation preferences. [29208955]
All isoforms of this gene containing a lectin domain
NP_001186711.1, NP_001186710.1
RNA
RNA (Transcript ID: NM_001199781.2)
POC1B-GALNT4 readthrough, transcript variant 1
m7G-5')ppp(5'-GACUGGGCCGCCGUUGUUGUAGUGACCGGGAGGCGCUGCCGCUCUGGGCAGACGGUUCCGGGAGCCGCACGGUCCCCUCUCCUUCCCCAUCCUCUCCCCUCCCCUCUCCGGGUUCCCCCACCCACAGGAGCCUUGGGCCGACCACUCCCCCGAUGGCCUCAGCCACGGAGGACCCCGUUCUGGAGCGUUAUUUCAAAGGCCACAAAGCUGCGAUCACCUCCUUGGACCUCAGCCCCAACGGCAAGCAACUUGGAGCCGGCCGUGCCAGGGAGCUGGGGUCAAGAAGGCUCUCAGACCUCCAGAAAAAUACGGAGGAUUUGUCUCGACCGCUUUAUAAGAAGCCCCCUGCAGAUUCCCGUGCACUUGGGGAGUGGGGGAAAGCCAGCAAACUCCAGCUCAACGAGGAUGAACUGAAGCAGCAAGAAGAACUCAUUGAGAGAUACGCCAUCAAUAUUUACCUCAGUGACAGGAUUUCCCUGCAUCGACACAUAGAGGAUAAAAGAAUGUAUGAGUGUAAGUCCCAGAAGUUCAACUAUAGGACACUUCCUACCACCUCUGUUAUCAUUGCUUUCUAUAACGAAGCCUGGUCGACUUUGCUCCGUACCAUUCACAGUGUUUUAGAAACUUCUCCUGCAGUUCUUUUGAAAGAGAUCAUCUUGGUGGAUGACUUGAGUGACAGAGUUUAUUUGAAGACACAACUUGAAACUUACAUCAGCAAUCUUGAUAGAGUACGCUUGAUUAGGACCAAUAAGCGAGAGGGGCUGGUUAGGGCCCGUCUGAUUGGGGCCACUUUCGCCACUGGGGACGUCCUCACUUUCCUGGAUUGUCACUGUGAGUGUAAUUCCGGUUGGCUGGAACCGCUUUUGGAAAGGAUUGGGAGAGAUGAAACAGCAGUUGUGUGUCCUGUUAUAGACACAAUUGAUUGGAAUACUUUUGAAUUCUAUAUGCAGAUAGGGGAGCCCAUGAUUGGUGGGUUUGACUGGCGUUUAACAUUUCAGUGGCAUUCUGUCCCCAAACAGGAAAGGGACAGGCGGAUAUCAAGAAUUGACCCCAUCAGAUCACCUACCAUGGCUGGAGGACUGUUUGCUGUCAGCAAGAAAUAUUUUCAGUACCUUGGAACGUAUGACACAGGAAUGGAAGUGUGGGGAGGUGAAAACCUUGAGCUGUCUUUUAGGGUGUGGCAGUGUGGUGGCAAAUUGGAGAUCCACCCGUGUUCCCACGUGGGCCAUGUGUUCCCCAAGCGGGCACCAUAUGCUCGCCCCAAUUUCCUACAGAAUACUGCUCGGGCAGCAGAAGUUUGGAUGGAUGAAUACAAAGAGCACUUCUACAAUAGAAACCCUCCAGCAAGAAAAGAAGCUUAUGGUGAUAUUUCUGAAAGAAAAUUACUACGAGAGCGGUUGAGAUGCAAGAGCUUUGACUGGUAUUUGAAAAACGUUUUUCCUAAUUUACAUGUUCCAGAGGAUAGACCAGGCUGGCAUGGGGCUAUUCGCAGUAGAGGGAUCUCGUCUGAAUGUUUAGAUUAUAAUUCUCCUGACAACAACCCCACAGGUGCUAACCUUUCACUGUUUGGAUGCCAUGGUCAAGGAGGCAAUCAAUUCUUUGAAUAUACUUCAAACAAAGAAAUAAGGUUUAAUUCUGUGACAGAGUUAUGUGCAGAGGUACCUGAGCAAAAAAAUUAUGUGGGAAUGCAAAAUUGUCCCAAAGAUGGGUUCCCUGUACCAGCAAACAUUAUUUGGCAUUUUAAAGAAGAUGGAACUAUUUUUCACCCACACUCAGGACUGUGUCUUAGUGCUUAUCGGACACCGGAGGGCCGACCUGAUGUACAAAUGAGAACUUGUGAUGCUCUAGAUAAAAAUCAAAUUUGGAGUUUUGAGAAAUAGAGCACAACAGCACUUUCGUCAUGAGCUGACAGUAGUGUCAAGAAAGUCAAAGAGCCUUAAGAGCCUCAGUGAAGAUUGUAUUUUAUUUUAUCAAAAGCCACCUAGCAGUCAUCUGUGGAGCACUGGAAAGCUGGGGUUCAUUUUGGUAUAUCACACUGAAACUGGGUACCCAGAGUGCUGCUGUUUAAUAUUUCACAAUGCCUUACUUAUUGGUUGUUUUAUAUAAGAGUUUUGUCAAUAUGGUCUCUUCUUAAAAGAAGUUGACUAUGAAUUGAAACACACAAAACAUUUAAGUGCCAGACUUAAUAUUAAAGAAUGUAAAGGUCCAAGUAAAAUGAGGUAUGAUUUAUGUUGAUGUGUAAGUUCACCGCACAUCCCACUUUUUAACAAAACUCAUGAAUGUGCAGUUUGAGCCAUUGCUAUUUUGAUUACAUAGAAUUUGUAUUUCUUUUUUAGCCAGCACAUUAAAUUUUAGAUUUUAUUUUUUAAUCUAAUUUUUUUCUAAUCAAAAAGAAAAUUGAGCUUAAGGCAAAAGGCCUGGUUUUAGAGAUAUGUGUAAUUGGAAGAGGGCAUUUGUUUGAGUGUGAGUUUGGAGGCCUUUUUAACAUGCAGACAUACCCAUAUUUAAAUGAAAUGGGGAGAUAUUUACAUUCCGUACUUUGUAAACUUGAGCUAUUGGACUUCACUGAUGUAUAUAUUAAUACCUCAGAUUCCUCUGAUUUUGUAAGCUGUCUUCUCUGUGAACGUGUUUGUGUGUGUAGGGCAUUUUCUGAUUGCACUUCCUUAAGUUAUGAAUGUACUAGAAAGGGACUCAUCCAGAAUACUAUGCCUCCCUUUGUUAAUGCUUAAUCAUUUAAAGUAAACACAAUUGAAGCCUCUCUGAAGUUAAACCCAACUAUGUUUAUUAAAAUGUGUGAAACUGAAAGUGGGCUAGGUUCUACCAAGGCUGUGGAACUCUCCUACGAGUUCUGCUGAUCAGGAAAUUUAAGAAUUUAUCUUAAAAAUGCAAGGAAAAAAGACUGCCUUGGCAAUUGUGAAUGGUGCUUUCAAUCUCCUAGCACCGAGCCUGGCACUUAGGCAGCUUUCAGUAAGUGGGUGAAUGAAUGACUGAAUGAAUGAAUGAAUGGCUCAGCUGAGGAAUGUAACUUUGGUCAAGUUAUUAUGAUGUGUUUGGGCUUAGUUUUCUCAUUGGUAAAAUGUGGGUGCUGGAUUGGAUCUUAAAGAUCCCUUCCAGCUCUGAAAUGCUGAUUGUACAGUAUAUUCUUCCCAGAUUGACUCACUGUGCAAUCUUUACAAUACUUUUUAUCUUUUCACUUUUGACAUAGGUAAUGUUGUUGAGCAGUUGAGCAAUGUUCAGUCCAGUUGUGAAGCUGGAGAAGAGAAAUGGGUUUUAAAAAUUAAGUGAGGGGAGGCCGGGUGCGGUGGCUCACGCAUGUAAUCCCAGCACUUUGGGAGGCCAAGGCAGGUGGAUCACGAGGUCAGGAGAUCCAGACCAUCCUGGCUAACAUGGUGAAACCUCGUCUCUACUAAAAAUACAAAAAAUUAGCCAGCUGUGGUGGCGGGCGCCUGUAGUCCCAGCUACUCAGGAGGCUGAGGCAGGAGAAUGGCGUGAACCUGUGAGGCAGAGCUUACAGUGAGCCGAGAUCGUGCCACUGCACUCCAGCCUGGGCGACAGAGCAAGACUCUGUCUCAAAAAAAAAAAAUAAUAAUAAAAUAAGUGAGCUGAACUCACCUGAAGUGGUUUACUUCUGUGGGUUAAGAAGUUCUAGUCAGUGUUCAUAGUCGUUUCGUUUUGAUAAUUGUUGAACCAAUUUUGUUUUUAAAACCUUUAGACUCUGAAAGUAAUAUUUUGACUAAGAAUGUAAAUAUUUCCAAACUAAAUUACUCGGGAAGUAAACGCUUUUUUUAAAAGUAUUUUUACUGGUUUUAUACCAAUAUUAUAUGCAGAAAUCACAGGAUGAAUUUAGAAUUAAAUCUCAAUUAGUUCACUUUGGCCUAGAUUUAUGAAAAAUGCAUGCCUCGUAAAGAGUCCACUGUAUUCACGAGUAAAGUUGCUUUUAGUGUUCACUUGAUGACUUGGAGAGUAGGAAUUUUGCAAAAUCUGAAUUUAAGGAAAUUCUUUAGGAUAACCAUUUCAAAAAAUAAAAUUGCUAUGCAAUCUUGAAUAUUUUCUCUUUUGCCUCGUAAAAUGAAAAUGCAUUCACAGUUUCUGUAAAUUAUUUAGCAGCCUUAAAGUUUAUCAAAAAAUUGUCCAGAUUCCACGUGCAGCAUGCUUGGCCCUGCAUUUAAUUUAAGAAGGAUUAAUAAUAAUGCUCUGAAUUUUUCGAAAGGGAUUCUCCUAAACCCACCCACUUCUCUUGCCCAGGCUGCUUUUUAAAAAUAUUUUUUUAUUUUUUACUUAUUUUUAAAUUUUCUCUUUUUAUUUAUUUUUGGUUUUCUUGUUAGCCACCUGUUAUAUGGGAGAACGAAAAUUGUUAUAUUUUGAAAGUACUUAUUACAUUAUUUUUAUUUUAGUAUCUUGAUGCUCCUGUCAAAAGGGAAAUGAGGCUUUUAAAAAUAAAGUACCUUAAUUCUUUAUUGACUUUUUGCCCUAAAUUGCUAGGUGUGACCCAGCAAUCUUUUAGGAAGAGAUUUUACAGUGGUGCUUUAUUUAUAUCAAUAAUCCAGUAUAGUUAGGCUGUUCAUUCCUCAUAAUAGAGUACAUAACAGAAAAGUGGGACUUUCACAUUUUCAUAUUUAGGCACGUUCCAAUUUAAUUCCAAAAAUACUCUGUAAUUCUACAUCUAAAAAAACCGAUUCCCUAAUUCGAAUUUAUUGGUACCAAAGCUCUCUUUGGCUAUAGACAAUUAAGAGUUGACCUUUUAAGUUAAUGUAUAUGCUUAAAAACAGUUUUAGGAAAAUAUUUGGUAGACAAAGAGUUUCAACUUUAAAUGUUCACUAUGUCAUUUAGUGUCCAACUUUACGGAUAGGUUGACUAUCUAAAUAGGCAUUUUUAGUCAUUAAAAAAAAUCUAGUCACCAGGAGGAUCCCUAUAACUCAAAAUAACUUGUUUGUAAAAGAAAAUUUGUUUACUUACCCAUUAGUAAGUUCCUGCAUAUUCAUUAUAAGAUGGCAAAUCAAACUUUUCUAGGAUGAAGACAGCUUAUUUUUAAGUUGUAUAGUCUUAGUUGGUUUAGGGUCUCAAUUUUAAUUAAUAAAAUACUUGGUUUUUAUUUGCUUGUCCUUUUGAAUUCCUGUUUUAAUAAUUUUAAAAUGAGCACAAAGAACGUUGAAGUUCAGAUUAAUCUCUUCUGAAUGAUGUUUUUUUCCUCUGUGAUGAGUUGUUUCUGACUUUUUUCCUUUUGUAUUUGUAAUGUUGAUUAAGAUGUAAAAUAAAAAGUGUGCCUGAUUAUUUUUGCAAA-3'- Poly-A tail
  • Coding region
;
DNA
POC1B-GALNT4 readthrough
strand -
NCBI CDS gene sequence (1728 bp)
5'-ATGGCCTCAGCCACGGAGGACCCCGTTCTGGAGCGTTATTTCAAAGGCCACAAAGCTGCGATCACCTCCTTGGACCTCAGCCCCAACGGCAAGCAACTTGGAGCCGGCCGTGCCAGGGAGCTGGGGTCAAGAAGGCTCTCAGACCTCCAGAAAAATACGGAGGATTTGTCTCGACCGCTTTATAAGAAGCCCCCTGCAGATTCCCGTGCACTTGGGGAGTGGGGGAAAGCCAGCAAACTCCAGCTCAACGAGGATGAACTGAAGCAGCAAGAAGAACTCATTGAGAGATACGCCATCAATATTTACCTCAGTGACAGGATTTCCCTGCATCGACACATAGAGGATAAAAGAATGTATGAGTGTAAGTCCCAGAAGTTCAACTATAGGACACTTCCTACCACCTCTGTTATCATTGCTTTCTATAACGAAGCCTGGTCGACTTTGCTCCGTACCATTCACAGTGTTTTAGAAACTTCTCCTGCAGTTCTTTTGAAAGAGATCATCTTGGTGGATGACTTGAGTGACAGAGTTTATTTGAAGACACAACTTGAAACTTACATCAGCAATCTTGATAGAGTACGCTTGATTAGGACCAATAAGCGAGAGGGGCTGGTTAGGGCCCGTCTGATTGGGGCCACTTTCGCCACTGGGGACGTCCTCACTTTCCTGGATTGTCACTGTGAGTGTAATTCCGGTTGGCTGGAACCGCTTTTGGAAAGGATTGGGAGAGATGAAACAGCAGTTGTGTGTCCTGTTATAGACACAATTGATTGGAATACTTTTGAATTCTATATGCAGATAGGGGAGCCCATGATTGGTGGGTTTGACTGGCGTTTAACATTTCAGTGGCATTCTGTCCCCAAACAGGAAAGGGACAGGCGGATATCAAGAATTGACCCCATCAGATCACCTACCATGGCTGGAGGACTGTTTGCTGTCAGCAAGAAATATTTTCAGTACCTTGGAACGTATGACACAGGAATGGAAGTGTGGGGAGGTGAAAACCTTGAGCTGTCTTTTAGGGTGTGGCAGTGTGGTGGCAAATTGGAGATCCACCCGTGTTCCCACGTGGGCCATGTGTTCCCCAAGCGGGCACCATATGCTCGCCCCAATTTCCTACAGAATACTGCTCGGGCAGCAGAAGTTTGGATGGATGAATACAAAGAGCACTTCTACAATAGAAACCCTCCAGCAAGAAAAGAAGCTTATGGTGATATTTCTGAAAGAAAATTACTACGAGAGCGGTTGAGATGCAAGAGCTTTGACTGGTATTTGAAAAACGTTTTTCCTAATTTACATGTTCCAGAGGATAGACCAGGCTGGCATGGGGCTATTCGCAGTAGAGGGATCTCGTCTGAATGTTTAGATTATAATTCTCCTGACAACAACCCCACAGGTGCTAACCTTTCACTGTTTGGATGCCATGGTCAAGGAGGCAATCAATTCTTTGAATATACTTCAAACAAAGAAATAAGGTTTAATTCTGTGACAGAGTTATGTGCAGAGGTACCTGAGCAAAAAAATTATGTGGGAATGCAAAATTGTCCCAAAGATGGGTTCCCTGTACCAGCAAACATTATTTGGCATTTTAAAGAAGATGGAACTATTTTTCACCCACACTCAGGACTGTGTCTTAGTGCTTATCGGACACCGGAGGGCCGACCTGATGTACAAATGAGAACTTGTGATGCTCTAGATAAAAATCAAATTTGGAGTTTTGAGAAATAG-3'
NCBI CDS gene sequence with introns (location: 89522813.. 89525895) (3083 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 89519412.. 89526047) (6636 bp)Download
NCBI gene sequence (location: [89519412.. 89526047 + 1000]) (7636 bp)Download
Cite How to cite