Protein
Protein (XP_006717411)
Adhesion G protein-coupled receptor D2
Adhesion G-protein coupled receptor D2 (G-protein coupled receptor 144) (G-protein coupled receptor PGR24)
ADGRD2
adhesion G protein-coupled receptor D2
Undefined
Very low evidence
Pentraxin
L-Type Lectins
b-sandwich / ConA-like
Uncharacterised
Undefined
0.386
Undefined
Protein sequence and protein families (fasta) (974 amino acids) Download
MVTGPEEGNSEMDAPWGAGERWLHGAAVDRSGVSLGPPPTPQVNQGTLGPQVAPVAAGEVVKTAGGVCKFSGQRLSWWQAQESCEQQFGHLALQPPDGVLASRLRDPVWVGQREAPLRRPPQRRARTTAVLVFDERTADRAARLRSPLPELAALTACTHVQWDCASPDPAALFSVAAPALPNALQLRAFAEPGGVVRAALVVRGQHAPFLAAFRADGRWHHVCATWEQRGGRWALFSDGRRRAGARGLGAGHPVPSGGILVLGQDQDSLGGGFSVRHALSGNLTDFHLWARALSPAQLHRARACAPPSEGLLFRWDPGALDVTPSLLPTVWVRLLCPVPSEECPTWNPGPRSEGSELCLEPQPFLCCYRTEPYRRLQDAQSWPGQDVISRVNALANDIVLLPDPLSEVHGALSPAEASSFLGLLEHVLAMEMAPLGPAALLAVVRFLKRVVALGAGDPELLLTGPWEQLSQGVVSVASLVLEEQVADTWLSLREVIGGPMALVASVQRLAPLLSTSMTSERPRMRIQHRHAGLSGVTVIHSWFTSRVFQHTLEGPDLEPQAPASSEEANRVQRFLSTQVGSAIISSEVWDVTGEVNVAMTFHLQHRAQSPLFPPHPPSPYTGGAWATTGCSVAALYLDSTACFCNHSTSFAILLQIYEVQRGPEEESLLRTLSFVGCGVSFCALTTTFLLFLVAGVPKSERTTVHKNLTFSLASAEGFLMTSEWAKANEVACVAVTVAMHFLFLVAFSWMLVEGLLLWRKVVAVSMHPGPGMRLYHATGWGVPVGIVAVTLAMLPHDYVAPGHCWLNVHTNAIWAFVGPVLFVLTANTCILARVVMITVSSARRRARMLSPQPCLQQQIWTQIWATVKPVLVLLPVLGLTWLAGILVHLSPAWAYAAVGLNSIQGLYIFLVYAACNEEVRSALQRMAEKKVAEVLRALGVWGGAAKEHSLPFSVLPLFLPPKPSTPRHPLKAPA
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.63, 2.13] ÅDownload
The location of the lectin domain structural model is: 116-325
We infer [1.63, 2.13] Å as the interval of error of this structural model.
Template 1: 1HAS chain: A, P07629, NP_0NO0REFSEQ0.0, sequence identity: 22.9%, coverage: 91.0%, location in sequence: 23-234, (1-212 in PDB).
Template 2: 3PVN chain: A, P02741, NP_000558.2, sequence identity: 22.4%, coverage: 93.3%, location in sequence: 19-224, (1-206 in PDB).
Template 3: 1GYK chain: A, P02743, NP_001630.1, sequence identity: 22.4%, coverage: 92.4%, location in sequence: 20-223, (1-204 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
UniProt Main References (5 PubMed Identifiers)
  • The human and mouse repertoire of the adhesion family of G-protein-coupled receptors. [15203201]
  • DNA sequence and analysis of human chromosome 9. [15164053]
  • The G protein-coupled receptor repertoires of human and mouse. [12679517]
  • International Union of Basic and Clinical Pharmacology. XCIV. Adhesion G protein-coupled receptors. [25713288]
  • CSNK2B splice site mutations in patients cause intellectual disability with or without myoclonic epilepsy. [28585349]
RNA
RNA (Transcript ID: XM_006717348.3)
adhesion G protein-coupled receptor D2, transcript variant X2
m7G-5')ppp(5'-GGCAGUCCAGGCAGGAGGGAUGGCAUGGUCACAGGUCCAGAGGAGGGAAACUCAGAAAUGGACGCACCUUGGGGAGCAGGGGAAAGGUGGCUGCACGGAGCAGCGGUGGACAGAUCAGGAGUCUCUCUGGGACCCCCUCCAACUCCCCAGGUGAAUCAAGGAACCCUUGGGCCCCAGGUUGCCCCCGUGGCCGCCGGCGAGGUGGUGAAGACUGCAGGUGGGGUGUGCAAGUUCUCUGGACAGCGACUGAGCUGGUGGCAGGCCCAAGAGUCCUGCGAGCAGCAGUUUGGCCACUUGGCACUGCAGCCCCCUGAUGGGGUUCUUGCUUCACGGCUGCGCGAUCCGGUCUGGGUGGGCCAAAGAGAGGCCCCUCUGCGGAGACCCCCACAGAGGCGUGCGCGCACCACCGCCGUGCUGGUGUUCGACGAGAGGACGGCUGACCGGGCGGCGCGGCUGCGGAGCCCUCUGCCUGAGCUGGCAGCGCUGACCGCGUGUACUCACGUGCAGUGGGACUGUGCCUCGCCCGACCCCGCAGCGCUCUUCUCCGUUGCCGCGCCCGCGCUGCCCAACGCGCUGCAGCUGCGCGCCUUCGCCGAGCCGGGGGGCGUCGUGCGCGCUGCGCUGGUGGUGCGUGGGCAGCACGCGCCCUUCCUCGCAGCCUUCCGCGCCGACGGCCGCUGGCACCAUGUGUGCGCCACGUGGGAGCAGCGGGGCGGGCGCUGGGCGCUGUUCUCCGAUGGGAGGCGGCGCGCUGGGGCGCGGGGGCUGGGCGCCGGCCACCCGGUGCCGUCCGGCGGCAUCCUGGUGCUGGGCCAGGAUCAGGACUCUCUGGGCGGUGGCUUCUCGGUGCGUCACGCCCUCAGCGGCAACCUCACCGACUUCCACCUGUGGGCGCGGGCGCUGAGCCCCGCUCAGCUGCACCGGGCACGGGCCUGCGCGCCGCCCUCAGAGGGCCUGCUCUUCCGCUGGGACCCGGGCGCCCUGGACGUCACGCCCUCGCUGCUGCCCACUGUGUGGGUGCGCCUUCUCUGUCCCGUGCCCUCCGAGGAGUGCCCUACGUGGAACCCGGGACCUCGCAGUGAGGGCUCUGAGCUCUGCCUGGAGCCGCAGCCCUUCCUCUGCUGCUACCGGACAGAGCCCUAUCGUCGGCUGCAGGAUGCCCAGUCGUGGCCUGGCCAGGAUGUUAUCAGCCGAGUCAAUGCCUUGGCCAACGACAUUGUGCUCCUCCCGGACCCCCUCUCCGAAGUCCAUGGGGCCCUGUCCCCAGCGGAGGCCUCCAGCUUCCUGGGCCUUCUGGAGCAUGUCCUGGCGAUGGAGAUGGCUCCCCUGGGGCCGGCCGCACUGCUGGCUGUUGUCCGCUUCCUGAAGAGGGUGGUGGCCCUCGGGGCUGGGGACCCAGAGCUGUUGUUGACAGGCCCCUGGGAGCAGCUGAGCCAAGGCGUUGUAUCUGUGGCCAGCCUGGUCCUGGAGGAGCAGGUGGCUGACACAUGGCUCUCCCUCCGUGAAGUGAUUGGUGGGCCUAUGGCCCUGGUGGCGAGUGUGCAGCGCCUGGCACCCCUGCUGAGCACCUCAAUGACCUCAGAGCGGCCCCGAAUGCGCAUCCAGCACCGCCAUGCUGGCCUCUCUGGAGUCACCGUGAUCCACAGCUGGUUCACCUCCAGAGUCUUCCAGCACACCCUAGAGGGACCGGACCUAGAGCCCCAGGCCCCUGCCAGCUCAGAGGAGGCAAACAGGGUGCAGAGGUUCCUAAGCACCCAGGUGGGGUCAGCCAUCAUCUCCUCUGAAGUGUGGGACGUCACUGGAGAGGUCAACGUGGCCAUGACCUUUCAUCUCCAGCACCGGGCCCAGAGCCCCCUGUUCCCUCCCCAUCCCCCAAGCCCAUAUACAGGGGGUGCCUGGGCCACCACAGGCUGCUCCGUGGCUGCCCUGUACCUGGACUCCACCGCCUGCUUCUGCAACCACAGCACCAGCUUUGCCAUCCUGCUGCAAAUCUAUGAAGUACAGAGAGGCCCUGAGGAGGAGUCGCUGCUGAGGACUCUGUCAUUUGUGGGCUGUGGCGUGUCCUUCUGCGCCCUCACCACCACCUUCUUGCUCUUCCUGGUGGCCGGGGUCCCCAAGUCAGAGCGAACCACAGUCCACAAGAACCUCACCUUCUCCCUGGCCUCUGCCGAGGGCUUCCUCAUGACCAGCGAGUGGGCCAAGGCCAAUGAGGUGGCAUGUGUGGCUGUCACAGUCGCAAUGCACUUCCUCUUUCUGGUGGCAUUCUCCUGGAUGCUGGUGGAGGGGCUGCUGCUGUGGAGGAAGGUGGUAGCUGUGAGCAUGCACCCGGGCCCAGGCAUGCGGCUCUACCACGCCACAGGCUGGGGCGUGCCUGUGGGCAUCGUGGCGGUCACCCUGGCCAUGCUCCCCCAUGACUACGUGGCCCCCGGACAUUGCUGGCUCAAUGUGCACACAAAUGCCAUCUGGGCCUUCGUGGGGCCUGUGCUCUUCGUGCUGACUGCCAACACCUGCAUCCUGGCCCGUGUGGUAAUGAUCACCGUGUCCAGUGCCCGCCGCCGUGCCCGCAUGUUGAGCCCACAGCCCUGCCUGCAGCAGCAGAUCUGGACCCAGAUAUGGGCCACGGUGAAGCCCGUGCUGGUCCUGCUGCCCGUCCUAGGCCUGACCUGGCUGGCAGGCAUCCUGGUGCACCUGAGCCCCGCCUGGGCCUACGCUGCCGUGGGCCUCAACUCCAUCCAGGGGCUGUACAUCUUCCUGGUUUAUGCUGCCUGCAAUGAGGAGGUGCGGAGCGCCCUGCAGAGGAUGGCUGAGAAGAAGGUGGCCGAGGUGCUCAGGGCACUGGGGGUGUGGGGGGGCGCUGCCAAGGAGCACAGCCUGCCUUUCUCUGUCCUCCCCCUCUUUCUGCCCCCUAAGCCCAGCACCCCCCGUCACCCUCUGAAGGCCCCGGCCUGAUGCCCUAGGAUCCAGAGCCUUCCAAACCCGCUGAGGGAGAAGUGCUUUCCUCCAAGGCUGCGGGUCACCAGCUGGACAGCUGAUGGGGGCAUGACGGGGGCUGAGCAGUGGCAGGGUGGGUACUGUGGGAGGGUGAGGACACCCCAGCUCCGGCUCAGGGAGAGGACUGAAGCCUGGGGAGCUCAGCCGGGCCCAGGGGAGCCAUGCGGACCCUGACCGCUGGCCGCCUCCCUGAGGGAGCACUCCAUCUGAAACCCACACGCCUCAGCCUCCGCCAGGUGACUGUUUCCAGCGAAGGCAAGAGCGCUGUUCACCAGGCCCCUCCCAGGGGCAGGUUCAGUGCUCAGCCCAGGCACCCAGUGAUUCUGAUUCAGAGAGGGGGAGGGGGAGGUGCCUUUCUCCACCCAUUGCGCGGAUGAGGAAGUUGAGGCACAGAAAGGCGCAGCCGCUAGCCAGAGCCCGCACAGAGCCAGAGCCAGGUCCCCACUGGCGCAGAUGGGGGACUGCAGGCACAGCAGUAGCCACGCGGGUGUAAACGUAGAGCCGCGUGAACCCGGGUUGUGGGAUCCCAGGCCCCGACCAGCCCCCAUCCCCGGCUGGCAUCUCGGUCCCGGGGAGUCUCAGCUUCCCUUUCUGCAGAAUGGGCUGGAGGCGCCCCCCACAGGCCCGCCCAGGCGCCCCCCGGGGCCAGCGCC-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 347088)
adhesion G protein-coupled receptor D2
strand +
PGR24
NCBI CDS gene sequence (2925 bp)
5'-ATGGTCACAGGTCCAGAGGAGGGAAACTCAGAAATGGACGCACCTTGGGGAGCAGGGGAAAGGTGGCTGCACGGAGCAGCGGTGGACAGATCAGGAGTCTCTCTGGGACCCCCTCCAACTCCCCAGGTGAATCAAGGAACCCTTGGGCCCCAGGTTGCCCCCGTGGCCGCCGGCGAGGTGGTGAAGACTGCAGGTGGGGTGTGCAAGTTCTCTGGACAGCGACTGAGCTGGTGGCAGGCCCAAGAGTCCTGCGAGCAGCAGTTTGGCCACTTGGCACTGCAGCCCCCTGATGGGGTTCTTGCTTCACGGCTGCGCGATCCGGTCTGGGTGGGCCAAAGAGAGGCCCCTCTGCGGAGACCCCCACAGAGGCGTGCGCGCACCACCGCCGTGCTGGTGTTCGACGAGAGGACGGCTGACCGGGCGGCGCGGCTGCGGAGCCCTCTGCCTGAGCTGGCAGCGCTGACCGCGTGTACTCACGTGCAGTGGGACTGTGCCTCGCCCGACCCCGCAGCGCTCTTCTCCGTTGCCGCGCCCGCGCTGCCCAACGCGCTGCAGCTGCGCGCCTTCGCCGAGCCGGGGGGCGTCGTGCGCGCTGCGCTGGTGGTGCGTGGGCAGCACGCGCCCTTCCTCGCAGCCTTCCGCGCCGACGGCCGCTGGCACCATGTGTGCGCCACGTGGGAGCAGCGGGGCGGGCGCTGGGCGCTGTTCTCCGATGGGAGGCGGCGCGCTGGGGCGCGGGGGCTGGGCGCCGGCCACCCGGTGCCGTCCGGCGGCATCCTGGTGCTGGGCCAGGATCAGGACTCTCTGGGCGGTGGCTTCTCGGTGCGTCACGCCCTCAGCGGCAACCTCACCGACTTCCACCTGTGGGCGCGGGCGCTGAGCCCCGCTCAGCTGCACCGGGCACGGGCCTGCGCGCCGCCCTCAGAGGGCCTGCTCTTCCGCTGGGACCCGGGCGCCCTGGACGTCACGCCCTCGCTGCTGCCCACTGTGTGGGTGCGCCTTCTCTGTCCCGTGCCCTCCGAGGAGTGCCCTACGTGGAACCCGGGACCTCGCAGTGAGGGCTCTGAGCTCTGCCTGGAGCCGCAGCCCTTCCTCTGCTGCTACCGGACAGAGCCCTATCGTCGGCTGCAGGATGCCCAGTCGTGGCCTGGCCAGGATGTTATCAGCCGAGTCAATGCCTTGGCCAACGACATTGTGCTCCTCCCGGACCCCCTCTCCGAAGTCCATGGGGCCCTGTCCCCAGCGGAGGCCTCCAGCTTCCTGGGCCTTCTGGAGCATGTCCTGGCGATGGAGATGGCTCCCCTGGGGCCGGCCGCACTGCTGGCTGTTGTCCGCTTCCTGAAGAGGGTGGTGGCCCTCGGGGCTGGGGACCCAGAGCTGTTGTTGACAGGCCCCTGGGAGCAGCTGAGCCAAGGCGTTGTATCTGTGGCCAGCCTGGTCCTGGAGGAGCAGGTGGCTGACACATGGCTCTCCCTCCGTGAAGTGATTGGTGGGCCTATGGCCCTGGTGGCGAGTGTGCAGCGCCTGGCACCCCTGCTGAGCACCTCAATGACCTCAGAGCGGCCCCGAATGCGCATCCAGCACCGCCATGCTGGCCTCTCTGGAGTCACCGTGATCCACAGCTGGTTCACCTCCAGAGTCTTCCAGCACACCCTAGAGGGACCGGACCTAGAGCCCCAGGCCCCTGCCAGCTCAGAGGAGGCAAACAGGGTGCAGAGGTTCCTAAGCACCCAGGTGGGGTCAGCCATCATCTCCTCTGAAGTGTGGGACGTCACTGGAGAGGTCAACGTGGCCATGACCTTTCATCTCCAGCACCGGGCCCAGAGCCCCCTGTTCCCTCCCCATCCCCCAAGCCCATATACAGGGGGTGCCTGGGCCACCACAGGCTGCTCCGTGGCTGCCCTGTACCTGGACTCCACCGCCTGCTTCTGCAACCACAGCACCAGCTTTGCCATCCTGCTGCAAATCTATGAAGTACAGAGAGGCCCTGAGGAGGAGTCGCTGCTGAGGACTCTGTCATTTGTGGGCTGTGGCGTGTCCTTCTGCGCCCTCACCACCACCTTCTTGCTCTTCCTGGTGGCCGGGGTCCCCAAGTCAGAGCGAACCACAGTCCACAAGAACCTCACCTTCTCCCTGGCCTCTGCCGAGGGCTTCCTCATGACCAGCGAGTGGGCCAAGGCCAATGAGGTGGCATGTGTGGCTGTCACAGTCGCAATGCACTTCCTCTTTCTGGTGGCATTCTCCTGGATGCTGGTGGAGGGGCTGCTGCTGTGGAGGAAGGTGGTAGCTGTGAGCATGCACCCGGGCCCAGGCATGCGGCTCTACCACGCCACAGGCTGGGGCGTGCCTGTGGGCATCGTGGCGGTCACCCTGGCCATGCTCCCCCATGACTACGTGGCCCCCGGACATTGCTGGCTCAATGTGCACACAAATGCCATCTGGGCCTTCGTGGGGCCTGTGCTCTTCGTGCTGACTGCCAACACCTGCATCCTGGCCCGTGTGGTAATGATCACCGTGTCCAGTGCCCGCCGCCGTGCCCGCATGTTGAGCCCACAGCCCTGCCTGCAGCAGCAGATCTGGACCCAGATATGGGCCACGGTGAAGCCCGTGCTGGTCCTGCTGCCCGTCCTAGGCCTGACCTGGCTGGCAGGCATCCTGGTGCACCTGAGCCCCGCCTGGGCCTACGCTGCCGTGGGCCTCAACTCCATCCAGGGGCTGTACATCTTCCTGGTTTATGCTGCCTGCAATGAGGAGGTGCGGAGCGCCCTGCAGAGGATGGCTGAGAAGAAGGTGGCCGAGGTGCTCAGGGCACTGGGGGTGTGGGGGGGCGCTGCCAAGGAGCACAGCCTGCCTTTCTCTGTCCTCCCCCTCTTTCTGCCCCCTAAGCCCAGCACCCCCCGTCACCCTCTGAAGGCCCCGGCCTGA-3'
NCBI CDS gene sequence with introns (location: 124451111.. 124477100) (25990 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 124451087.. 124477795) (26709 bp)Download
NCBI gene sequence (location: [124451087 - 1000].. 124477795) (27709 bp)Download
Cite How to cite