NCBI Summary
This gene encodes a cell adhesion protein which is a member of the immunoglobulin superfamily. The encoded protein is involved in cell-to-cell interactions as well as cell-matrix interactions during development and differentiation. The encoded protein plays a role in the development of the nervous system by regulating neurogenesis, neurite outgrowth, and cell migration. This protein is also involved in the expansion of T lymphocytes, B lymphocytes and natural killer (NK) cells which play an important role in immune surveillance. This protein plays a role in signal transduction by interacting with fibroblast growth factor receptors, N-cadherin and other components of the extracellular matrix and by triggering signalling cascades involving FYN-focal adhesion kinase (FAK), mitogen-activated protein kinase (MAPK), and phosphatidylinositol 3-kinase (PI3K). One prominent isoform of this gene, cell surface molecule CD56, plays a role in several myeloproliferative disorders such as acute myeloid leukemia and differential expression of this gene is associated with differential disease progression. For example, increased expression of CD56 is correlated with lower survival in acute myeloid leukemia patients whereas increased severity of COVID-19 is correlated with decreased abundance of CD56-expressing NK cells in peripheral blood. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Aug 2020].
Protein
Protein (NP_851996)
Neural cell adhesion molecule 1
Neural cell adhesion molecule 1 (N-CAM-1) (NCAM-1) (CD antigen CD56)
NCAM1
neural cell adhesion molecule 1
Low evidence
I-type lectin
I-Type Lectins
b-sandwich / Ig-like
Oligomannose
0.323
Protein sequence and protein families (fasta) (858 amino acids) Download
MLQTKDLIWTLFFLGTAVSLQVDIVPSQGEISVGESKFFLCQVAGDAKDKDISWFSPNGEKLTPNQQRISVVWNDDSSSTLTIYNANIDDAGIYKCVVTGEDGSESEATVNVKIFQKLMFKNAPTPQEFREGEDAVIVCDVVSSLPPTIIWKHKGRDVILKKDVRFIVLSNNYLQIRGIKKTDEGTYRCEGRILARGEINFKDIQVIVNVPPTIQARQNIVNATANLGQSVTLVCDAEGFPEPTMSWTKDGEQIEQEEDDEKYIFSDDSSQLTIKKVDKNDEAEYICIAENKAGEQDATIHLKVFAKPKITYVENQTAMELEEQVTLTCEASGDPIPSITWRTSTRNISSEEKASWTRPEKQETLDGHMVVRSHARVSSLTLKSIQYTDAGEYICTASNTIGQDSQSMYLEVQYAPKLQGPVAVYTWEGNQVNITCEVFAYPSATISWFRDGQLLPSSNYSNIKIYNTPSASYLEVTPDSENDFGNYNCTAVNRIGQESLEFILVQADTPSSPSIDQVEPYSSTAQVQFDEPEATGGVPILKYKAEWRAVGEEVWHSKWYDAKEASMEGIVTIVGLKPETTYAVRLAALNGKGLGEISAASEFKTQPVQGEPSAPKLEGQMGEDGNSIKVNLIKQDDGGSPIRHYLVRYRALSSEWKPEIRLPSGSDHVMLKSLDWNAEYEVYVVAENQQGKSKAAHFVFRTSAQPTAIPANGSPTSGLSTGAIVGILIVIFVLLLVVVDITCYFLNKCGLFMCIAVNLCGKAGPGAKGKDMEEGKAAFSKDESKEPIVEVRTEEERTPNHDGGKHTEPNETTPLTEPEKGPVEAKPECQETETKPAPAEVKTVPNDATQTKENESKA
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Quantitative analyses of CD7, CD33, CD34, CD56, and CD123 within the FLT3-ITD/NPM1-MUT myeloblastic/monocytic bulk AML blastic populations. [34034609]
  • Prognostic Relevance of Concordant Expression CD69 and CD56 in Response to Bortezomib Combination Therapy in Multiple Myeloma Patients. [34344244]
  • Ovarian Cancer-Associated Ascites Have High Proportions of Cytokine-Responsive CD56bright NK Cells. [34359872]
  • Aberrant myelomonocytic CD56 expression in Down syndrome is frequent and not associated with leukemogenesis. [33890142]
  • Prognostic Significance of CD56 Antigen Expression in Patients with De Novo Non-M3 Acute Myeloid Leukemia. [33928145]
  • A discordance between the human muscle NCAM sequence and those seen in other NCAM cDNA clones. [1543753]
  • Splicing of the VASE exon of neural cell adhesion molecule (NCAM) in human small-cell lung carcinoma (SCLC). [1339414]
  • Molecular and functional analysis of human natural killer cell-associated neural cell adhesion molecule (N-CAM/CD56). [1710251]
  • Precise in situ localization of NCAM, ETS1, and D11S29 on human meiotic chromosomes. [2612216]
  • Human muscle neural cell adhesion molecule (N-CAM): identification of a muscle-specific sequence in the extracellular domain. [2887295]
UniProt Main References (9 PubMed Identifiers)
  • Complete sequence and in vitro expression of a tissue-specific phosphatidylinositol-linked N-CAM isoform from skeletal muscle. [3253057]
  • Complementary DNA sequence encoding the major neural cell adhesion molecule isoform in a human small cell lung cancer cell line. [8075973]
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Alternative splicing generates a secreted form of N-CAM in muscle and brain. [3203385]
  • The neural cell adhesion molecule is a receptor for rabies virus. [9696812]
  • Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry. [16335952]
  • An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. [24275569]
  • Chemical proteomics tracks virus entry and uncovers NCAM1 as Zika virus receptor. [32753727]
All isoforms of this gene containing a lectin domain
NP_001070150.1, NP_001373220.1, NP_001229537.1, NP_001373221.1, NP_000606.3, NP_001373218.1, NP_001373219.1, NP_851996.2, NP_001229536.1
RNA
RNA (Transcript ID: NM_181351.5)
neural cell adhesion molecule 1, transcript variant 2
m7G-5')ppp(5'-ACUCAUUCUCCGAUCAGCGCGUGAACGCAGCUCGGCUGCCGCUGGCAGGAAACAAUUCUGCAAAAAUAAUCAUACUCAGCCUGGCAAUUGUCUGCCCCUAGGUCUGUCGCUCAGCCGCCGUCCACACUCGCUGCAGGGGGGGGGGCACAGAAUUUACCGCGGCAAGAACAUCCCUCCCAGCCAGCAGAUUACAAUGCUGCAAACUAAGGAUCUCAUCUGGACUUUGUUUUUCCUGGGAACUGCAGUUUCUCUGCAGGUGGAUAUUGUUCCCAGCCAGGGGGAGAUCAGCGUUGGAGAGUCCAAAUUCUUCUUAUGCCAAGUGGCAGGAGAUGCCAAAGAUAAAGACAUCUCCUGGUUCUCCCCCAAUGGAGAAAAGCUCACCCCAAACCAGCAGCGGAUCUCAGUGGUGUGGAAUGAUGAUUCCUCCUCCACCCUCACCAUCUAUAACGCCAACAUCGACGACGCCGGCAUUUACAAGUGUGUGGUUACAGGCGAGGAUGGCAGUGAGUCAGAGGCCACCGUCAACGUGAAGAUCUUUCAGAAGCUCAUGUUCAAGAAUGCGCCAACCCCACAGGAGUUCCGGGAGGGGGAAGAUGCCGUGAUUGUGUGUGAUGUGGUCAGCUCCCUCCCACCAACCAUCAUCUGGAAACACAAAGGCCGAGAUGUCAUCCUGAAAAAAGAUGUCCGAUUCAUAGUCCUGUCCAACAACUACCUGCAGAUCCGGGGCAUCAAGAAAACAGAUGAGGGCACUUAUCGCUGUGAGGGCAGAAUCCUGGCACGGGGGGAGAUCAACUUCAAGGACAUUCAGGUCAUUGUGAAUGUGCCACCUACCAUCCAGGCCAGGCAGAAUAUUGUGAAUGCCACCGCCAACCUCGGCCAGUCCGUCACCCUGGUGUGCGAUGCCGAAGGCUUCCCAGAGCCCACCAUGAGCUGGACAAAGGAUGGGGAACAGAUAGAGCAAGAGGAAGACGAUGAGAAGUACAUCUUCAGCGACGAUAGUUCCCAGCUGACCAUCAAAAAGGUGGAUAAGAACGACGAGGCUGAGUACAUCUGCAUUGCUGAGAACAAGGCUGGCGAGCAGGAUGCGACCAUCCACCUCAAAGUCUUUGCAAAACCCAAAAUCACAUAUGUAGAGAACCAGACUGCCAUGGAAUUAGAGGAGCAGGUCACUCUUACCUGUGAAGCCUCCGGAGACCCCAUUCCCUCCAUCACCUGGAGGACUUCUACCCGGAACAUCAGCAGCGAAGAAAAGGCUUCGUGGACUCGACCAGAGAAGCAAGAGACUCUGGAUGGGCACAUGGUGGUGCGUAGCCAUGCCCGUGUGUCGUCGCUGACCCUGAAGAGCAUCCAGUACACUGAUGCCGGAGAGUACAUCUGCACCGCCAGCAACACCAUCGGCCAGGACUCCCAGUCCAUGUACCUUGAAGUGCAAUAUGCCCCAAAGCUACAGGGCCCUGUGGCUGUGUACACUUGGGAGGGGAACCAGGUGAACAUCACCUGCGAGGUAUUUGCCUAUCCCAGUGCCACGAUCUCAUGGUUUCGGGAUGGCCAGCUGCUGCCAAGCUCCAAUUACAGCAAUAUCAAGAUCUACAACACCCCCUCUGCCAGCUAUCUGGAGGUGACCCCAGACUCUGAGAAUGAUUUUGGGAACUACAACUGUACUGCAGUGAACCGCAUUGGGCAGGAGUCCUUGGAAUUCAUCCUUGUUCAAGCAGACACCCCCUCUUCACCAUCCAUCGACCAGGUGGAGCCAUACUCCAGCACAGCCCAGGUGCAGUUUGAUGAACCAGAGGCCACAGGUGGGGUGCCCAUCCUCAAAUACAAAGCUGAGUGGAGAGCAGUUGGUGAAGAAGUAUGGCAUUCCAAGUGGUAUGAUGCCAAGGAAGCCAGCAUGGAGGGCAUCGUCACCAUCGUGGGCCUGAAGCCCGAAACAACGUACGCCGUAAGGCUGGCGGCGCUCAAUGGCAAAGGGCUGGGUGAGAUCAGCGCGGCCUCCGAGUUCAAGACGCAGCCAGUCCAAGGGGAACCCAGUGCACCUAAGCUCGAAGGGCAGAUGGGAGAGGAUGGAAACUCUAUUAAAGUGAACCUGAUCAAGCAGGAUGACGGCGGCUCCCCCAUCAGACACUAUCUGGUCAGGUACCGAGCGCUCUCCUCCGAGUGGAAACCAGAGAUCAGGCUCCCGUCUGGCAGUGACCACGUCAUGCUGAAGUCCCUGGACUGGAAUGCUGAGUAUGAGGUCUACGUGGUGGCUGAGAACCAGCAAGGAAAAUCCAAGGCGGCUCAUUUUGUGUUCAGGACCUCGGCCCAGCCCACAGCCAUCCCAGCCAACGGCAGCCCCACCUCAGGCCUGAGCACCGGGGCCAUCGUGGGCAUCCUCAUCGUCAUCUUCGUCCUGCUCCUGGUGGUUGUGGACAUCACCUGCUACUUCCUGAACAAGUGUGGCCUGUUCAUGUGCAUUGCGGUCAACCUGUGUGGAAAAGCCGGGCCCGGGGCCAAGGGCAAGGACAUGGAGGAGGGCAAGGCCGCCUUCUCGAAAGAUGAGUCCAAGGAGCCCAUCGUGGAGGUUCGAACGGAGGAGGAGAGGACCCCAAACCAUGAUGGAGGGAAACACACAGAGCCCAACGAGACCACGCCACUGACGGAGCCCGAGAAGGGCCCCGUAGAAGCAAAGCCAGAGUGCCAGGAGACAGAAACGAAGCCAGCGCCAGCCGAAGUCAAGACGGUCCCCAAUGACGCCACACAGACAAAGGAGAACGAGAGCAAAGCAUGAUGGGUGAAGAGAACCGAGCAAAGAUCAAAAUAAAAAGUGACACAGCAGCUUCACCAGAGCAUUUCCAACACCACAGACACACACACGCACGCACACACACAAACACACAUGCACACACACACAUCUCAUUUCUCUAGUGUCUUUUGCCUUUAAAAAAAACUAAACAGAUAAAACAUGGGAAUCUCCUUUUUGUAGGUUUAUAGAAAGGGUCCCUUUGUUGCACACUCACUUGUAAGAAAAUGAGACAAAAAGGUUAAACCCACAGCCAAACUAGGACACUCCGUUCCCUGAAACCGUUAAAAAAUCAAACAAAAGGACCCCAAAUUAAGAAUCUAGGAAGCUCAGAAACGAAAUCUAGGUUCAGGAAGACCACACUUGGUGUUACCCGAUUGGCACAGACCAGUUUCAGAGAAAUACUUUCAGGCACUAAGACUAAUCGAAUGAACAAAGUCCACAGUUUAUUUUUAUACUUUCAGUCAAGUUUGAACUCUGUAAAACCUCAUAAAUAAGUUAUAAUUUCUGUUCACUUUGUAUUUGUUCAGUAUGCAAAGUGUGUCACCCUUUCUAGCUGAAUUCAAUUCCCACGUAGACUCUUAUUUUAUAGGACGAAUGCCAAAUUGCAGCUUCUGGGGGUAGAUCUCAAUUUGCAGUAUUCAGACUUCUUUUUCUUUCUUUUACAUUCUUUUUUCUUUCUUUCUUUCUGCCAACUUUGUUUUCCAGUGUUUACAAGGUGACAAAUGUUUGACUUUGGUUGUGUUUAAAUGUCCGUGUAAAAUAGCUGCCUUUUAUUUUUUAAGGUAACAAAUACCACCUAGAGGUAGGUAGGAUCAUCCCACGCUUGCUUUAGCACAGGACAACUUUACAAAACAUGAUUGUUUACAGCUGCUCUUCCCCUCUUUUCUGAUCUGCAGUUUUUGCCUGGGUCCCACUCAGGUGAAAAUCCAUCUCAUUCUGGAAUGGUUUUGCUUUUGAAUUUUUGGUUAUUUUUGUGUUUCUUUGGGGGUUAGACCACUUUCUGAUUAGCCGCCACCUGCCUGCAUCUGUGAAAAGGGAUCUGCUCCCAGGCGUUCUCACCCUUCUUUUGAAGGACUCCUUAGGCUUUGUUGAAUGAAGCAGAGAAGAUUGUAUAGUUGGGGCUGGUCUUGGUGAACACACAUUAUUACCCCACACAUCCCCUUUGUGUAGAAAGCCAAAUAAAAUCUAUACAUACCAUUUCCUUUUGAGCCCAGAAUCUAGAUUUGAGCGGAAGAGCAUGUGUGCUUCAGGGAAUUAGUGUCUUUUUUUGGAAAUCUGUUGAAGUAAAGUAACAUCGGCCUUCUGUUCACUUAGGCAGCAUUUAUAGAAACAAAAGAAGAAAGAAACAACCUACUGUCUGGAGUCAUAACACAACUUUCCUGGAUUGGAAACCAAGUGGGGGAAAAAAUACAGAAACUUUAAGGGGGAUGGGAGGGGGGGGAGAAGGGAAAAGCCAGCCCUUUGUAUAGAAAUUUUGCUUUUUUUUCCCUCAUUCUACUUUAGAACUGCAAGCUUGUGCACUGUGGAUGCGUGAAUAUUUUAGUGUGAAACGUGUUUUUGUCAUAGUAUUGAAAUAAAACUUCAACAUAGUUUGGUUGUGGAAGGUAUAGCAGAUAGUUCAGAAAAAAUAUUCAGGAAACAAAAAUCACUCAAACGGAAUCGAAGCCUUUUAACAAAGAAAAUGAAAUACAGAUGAUGAUGAUGAUGAUGAAGAUGAUGCUAAGUAAACAGAAAUCAGUACUCCGCAUGCGCUCCUCUCCUAAGGUACAAAGCAGCAAGAGGUUAGGGUGGCAAGGCUGCCUCUGGGUCCAUUCUGUGGGCCACUCUCCCCAACGUUCUGACACUUCUGCAGUCUGAUCAGUGGCGAUGCUAGAUUAUAAUUUCAAACUGUGAAGAAUAAUGGUCUUGUCAUUUGCUCAAUGUGGGGUUAUGUUGCAUUUUCUCAGCUCCUGGGGAUGGAAAUGGAGGAUCCCAGAACACACAGCCCUGGCCCCUUUGAUUCUAGGGCCUGCACAGAUCUCUGGUUCAAAUGCACAGGCCCUCAGAAUAGAGGAACAUGAAGAGAGAUCUUAGAGCACACAGUAGAAUGUGAGAGCCUGGGUGUCUGAGACCGGGAGGGCCCAGCAGUGAGGGGCAGGCUCUUCUGGUCACCAGGCUGUUCAGUGGACUCAGUUCUUCAUCUUGUAAUGUCGAUGGCUUUGCCACACCAGGCCAAGCCCAUGCCAUACCUUGUCAAGACUGUCAAAGUGGUUGUGGUUAGGUCAAACUGGUUUUGGUUCUGAUGGUUAGGAAGAAACAGGUCAGCCCUCAGAUCACCUGGCCCGGGACAGCUGACCCCCUAGAACCCUGGCUCUGCCAUUAGCUAGGACCUAAGACUCUGCCCACAUUUUGGUCUGUUCUCUCCCAUUACACAUAGGUUUGUCUCAGCAUGCAAGAGUUUUUCCUUUAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAAUGCUUUCUCUAAAAUCAAAGAGGGAGUCAUUUUAUUCCAAGAUGUUUUAUCUUUUAUGUUAAGAGAUCAAAGCUUAUAAUUUUCUUUUUUAAUUUUUGAAGGAGGGAUCAACUCCAGUUUCCAAUGUCUAUGUGUCUAUGUGUGUAUGUGCCAUACAUAUGUAUUCACAUGAAGACCGGCAUGGCCAAGUUCUGCUGGAGGAGCACUCAAGUGUGACGAGCAGGGCCACUGGACCCUGCAGGGCUGUGGUGUAUAUAGUGCAGCUUUGGAGGUGGAACUCUAUUUUCACACUUUUCUAUGGAGCCUUCCGAGUCCCAGGUUUUCACUUGAGGCUGUCUGUCUGGAUGGCGGUUUUCAGACCUCCAUUAACAUCCCUACCCAGCAUUCUGUACUUCGGGGGCCUUCUCUCUUGUUAUAAAACUUUUUACCAAGUGAAACAUCGAUACCACCUUUGUUUCCAUUCUCACUGGUGUAAAUACUGAGUACUAACUGAGAAUUUUGACUUUGCAUUCUGUCGGAAUACUUGUGUUCAAUAAAAAUUGAAAGAAAAAAGCUA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 4684)
neural cell adhesion molecule 1
strand +
NCAM, CD56
NCBI CDS gene sequence (2577 bp)
5'-ATGCTGCAAACTAAGGATCTCATCTGGACTTTGTTTTTCCTGGGAACTGCAGTTTCTCTGCAGGTGGATATTGTTCCCAGCCAGGGGGAGATCAGCGTTGGAGAGTCCAAATTCTTCTTATGCCAAGTGGCAGGAGATGCCAAAGATAAAGACATCTCCTGGTTCTCCCCCAATGGAGAAAAGCTCACCCCAAACCAGCAGCGGATCTCAGTGGTGTGGAATGATGATTCCTCCTCCACCCTCACCATCTATAACGCCAACATCGACGACGCCGGCATTTACAAGTGTGTGGTTACAGGCGAGGATGGCAGTGAGTCAGAGGCCACCGTCAACGTGAAGATCTTTCAGAAGCTCATGTTCAAGAATGCGCCAACCCCACAGGAGTTCCGGGAGGGGGAAGATGCCGTGATTGTGTGTGATGTGGTCAGCTCCCTCCCACCAACCATCATCTGGAAACACAAAGGCCGAGATGTCATCCTGAAAAAAGATGTCCGATTCATAGTCCTGTCCAACAACTACCTGCAGATCCGGGGCATCAAGAAAACAGATGAGGGCACTTATCGCTGTGAGGGCAGAATCCTGGCACGGGGGGAGATCAACTTCAAGGACATTCAGGTCATTGTGAATGTGCCACCTACCATCCAGGCCAGGCAGAATATTGTGAATGCCACCGCCAACCTCGGCCAGTCCGTCACCCTGGTGTGCGATGCCGAAGGCTTCCCAGAGCCCACCATGAGCTGGACAAAGGATGGGGAACAGATAGAGCAAGAGGAAGACGATGAGAAGTACATCTTCAGCGACGATAGTTCCCAGCTGACCATCAAAAAGGTGGATAAGAACGACGAGGCTGAGTACATCTGCATTGCTGAGAACAAGGCTGGCGAGCAGGATGCGACCATCCACCTCAAAGTCTTTGCAAAACCCAAAATCACATATGTAGAGAACCAGACTGCCATGGAATTAGAGGAGCAGGTCACTCTTACCTGTGAAGCCTCCGGAGACCCCATTCCCTCCATCACCTGGAGGACTTCTACCCGGAACATCAGCAGCGAAGAAAAGGCTTCGTGGACTCGACCAGAGAAGCAAGAGACTCTGGATGGGCACATGGTGGTGCGTAGCCATGCCCGTGTGTCGTCGCTGACCCTGAAGAGCATCCAGTACACTGATGCCGGAGAGTACATCTGCACCGCCAGCAACACCATCGGCCAGGACTCCCAGTCCATGTACCTTGAAGTGCAATATGCCCCAAAGCTACAGGGCCCTGTGGCTGTGTACACTTGGGAGGGGAACCAGGTGAACATCACCTGCGAGGTATTTGCCTATCCCAGTGCCACGATCTCATGGTTTCGGGATGGCCAGCTGCTGCCAAGCTCCAATTACAGCAATATCAAGATCTACAACACCCCCTCTGCCAGCTATCTGGAGGTGACCCCAGACTCTGAGAATGATTTTGGGAACTACAACTGTACTGCAGTGAACCGCATTGGGCAGGAGTCCTTGGAATTCATCCTTGTTCAAGCAGACACCCCCTCTTCACCATCCATCGACCAGGTGGAGCCATACTCCAGCACAGCCCAGGTGCAGTTTGATGAACCAGAGGCCACAGGTGGGGTGCCCATCCTCAAATACAAAGCTGAGTGGAGAGCAGTTGGTGAAGAAGTATGGCATTCCAAGTGGTATGATGCCAAGGAAGCCAGCATGGAGGGCATCGTCACCATCGTGGGCCTGAAGCCCGAAACAACGTACGCCGTAAGGCTGGCGGCGCTCAATGGCAAAGGGCTGGGTGAGATCAGCGCGGCCTCCGAGTTCAAGACGCAGCCAGTCCAAGGGGAACCCAGTGCACCTAAGCTCGAAGGGCAGATGGGAGAGGATGGAAACTCTATTAAAGTGAACCTGATCAAGCAGGATGACGGCGGCTCCCCCATCAGACACTATCTGGTCAGGTACCGAGCGCTCTCCTCCGAGTGGAAACCAGAGATCAGGCTCCCGTCTGGCAGTGACCACGTCATGCTGAAGTCCCTGGACTGGAATGCTGAGTATGAGGTCTACGTGGTGGCTGAGAACCAGCAAGGAAAATCCAAGGCGGCTCATTTTGTGTTCAGGACCTCGGCCCAGCCCACAGCCATCCCAGCCAACGGCAGCCCCACCTCAGGCCTGAGCACCGGGGCCATCGTGGGCATCCTCATCGTCATCTTCGTCCTGCTCCTGGTGGTTGTGGACATCACCTGCTACTTCCTGAACAAGTGTGGCCTGTTCATGTGCATTGCGGTCAACCTGTGTGGAAAAGCCGGGCCCGGGGCCAAGGGCAAGGACATGGAGGAGGGCAAGGCCGCCTTCTCGAAAGATGAGTCCAAGGAGCCCATCGTGGAGGTTCGAACGGAGGAGGAGAGGACCCCAAACCATGATGGAGGGAAACACACAGAGCCCAACGAGACCACGCCACTGACGGAGCCCGAGAAGGGCCCCGTAGAAGCAAAGCCAGAGTGCCAGGAGACAGAAACGAAGCCAGCGCCAGCCGAAGTCAAGACGGTCCCCAATGACGCCACACAGACAAAGGAGAACGAGAGCAAAGCATGA-3'
NCBI CDS gene sequence with introns (location: 112961613.. 113275387) (313775 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 112961420.. 113278436) (317017 bp)Download
NCBI gene sequence (location: [112961420 - 1000].. 113278436) (318017 bp)Download
Cite How to cite