Protein
Protein (NP_699197)
Sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Sushi, von Willebrand factor type A, EGF and pentraxin domain-containing protein 1 (CCP module-containing protein 22) (Polydom) (Selectin-like osteoblast-derived protein) (SEL-OB) (Serologically defined breast cancer antigen NY-BR-38)
SVEP1
sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Undefined
Very low evidence
Pentraxin
L-Type Lectins
b-sandwich / ConA-like
Uncharacterised
0.395
Undefined
Protein sequence and protein families (fasta) (3571 amino acids) Download
MWPRLAFCCWGLALVSGWATFQQMSPSRNFSFRLFPETAPGAPGSIPAPPAPGDEAAGSRVERLGQAFRRRVRLLRELSERLELVFLVDDSSSVGEVNFRSELMFVRKLLSDFPVVPTATRVAIVTFSSKNYVVPRVDYISTRRARQHKCALLLQEIPAISYRGGGTYTKGAFQQAAQILLHARENSTKVVFLITDGYSNGGDPRPIAASLRDSGVEIFTFGIWQGNIRELNDMASTPKEEHCYLLHSFEEFEALARRALHEDLPSGSFIQDDMVHCSYLCDEGKDCCDRMGSCKCGTHTGHFECICEKGYYGKGLQYECTACPSGTYKPEGSPGGISSCIPCPDENHTSPPGSTSPEDCVCREGYRASGQTCELVHCPALKPPENGYFIQNTCNNHFNAACGVRCHPGFDLVGSSIILCLPNGLWSGSESYCRVRTCPHLRQPKHGHISCSTREMLYKTTCLVACDEGYRLEGSDKLTCQGNSQWDGPEPRCVERHCSTFQMPKDVIISPHNCGKQPAKFGTICYVSCRQGFILSGVKEMLRCTTSGKWNVGVQAAVCKDVEAPQINCPKDIEAKTLEQQDSANVTWQIPTAKDNSGEKVSVHVHPAFTPPYLFPIGDVAIVYTATDLSGNQASCIFHIKVIDAEPPVIDWCRSPPPVQVSEKVHAASWDEPQFSDNSGAELVITRSHTQGDLFPQGETIVQYTATDPSGNNRTCDIHIVIKGSPCEIPFTPVNGDFICTPDNTGVNCTLTCLEGYDFTEGSTDKYYCAYEDGVWKPTYTTEWPDCAKKRFANHGFKSFEMFYKAARCDDTDLMKKFSEAFETTLGKMVPSFCSDAEDIDCRLEENLTKKYCLEYNYDYENGFAIGPGGWGAANRLDYSYDDFLDTVQETATSIGNAKSSRIKRSAPLSDYKIKLIFNITASVPLPDERNDTLEWENQQRLLQTLETITNKLKRTLNKDPMYSFQLASEILIADSNSLETKKASPFCRPGSVLRGRMCVNCPLGTYYNLEHFTCESCRIGSYQDEEGQLECKLCPSGMYTEYIHSRNISDCKAQCKQGTYSYSGLETCESCPLGTYQPKFGSRSCLSCPENTSTVKRGAVNISACGVPCPEGKFSRSGLMPCHPCPRDYYQPNAGKAFCLACPFYGTTPFAGSRSITECSSFSSTFSAAEESVVPPASLGHIKKRHEISSQVFHECFFNPCHNSGTCQQLGRGYVCLCPLGYTGLKCETDIDECSPLPCLNNGVCKDLVGEFICECPSGYTGQRCEENINECSSSPCLNKGICVDGVAGYRCTCVKGFVGLHCETEVNECQSNPCLNNAVCEDQVGGFLCKCPPGFLGTRCGKNVDECLSQPCKNGATCKDGANSFRCLCAAGFTGSHCELNINECQSNPCRNQATCVDELNSYSCKCQPGFSGKRCETEQSTGFNLDFEVSGIYGYVMLDGMLPSLHALTCTFWMKSSDDMNYGTPISYAVDNGSDNTLLLTDYNGWVLYVNGREKITNCPSVNDGRWHHIAITWTSANGIWKVYIDGKLSDGGAGLSVGLPIPGGGALVLGQEQDKKGEGFSPAESFVGSISQLNLWDYVLSPQQVKSLATSCPEELSKGNVLAWPDFLSGIVGKVKIDSKSIFCSDCPRLGGSVPHLRTASEDLKPGSKVNLFCDPGFQLVGNPVQYCLNQGQWTQPLPHCERISCGVPPPLENGFHSADDFYAGSTVTYQCNNGYYLLGDSRMFCTDNGSWNGVSPSCLDVDECAVGSDCSEHASCLNVDGSYICSCVPPYTGDGKNCAEPIKCKAPGNPENGHSSGEIYTVGAEVTFSCQEGYQLMGVTKITCLESGEWNHLIPYCKAVSCGKPAIPENGCIEELAFTFGSKVTYRCNKGYTLAGDKESSCLANSSWSHSPPVCEPVKCSSPENINNGKYILSGLTYLSTASYSCDTGYSLQGPSIIECTASGIWDRAPPACHLVFCGEPPAIKDAVITGNNFTFRNTVTYTCKEGYTLAGLDTIECLADGKWSRSDQQCLAVSCDEPPIVDHASPETAHRLFGDIAFYYCSDGYSLADNSQLLCNAQGKWVPPEGQDMPRCIAHFCEKPPSVSYSILESVSKAKFAAGSVVSFKCMEGFVLNTSAKIECMRGGQWNPSPMSIQCIPVRCGEPPSIMNGYASGSNYSFGAMVAYSCNKGFYIKGEKKSTCEATGQWSSPIPTCHPVSCGEPPKVENGFLEHTTGRIFESEVRYQCNPGYKSVGSPVFVCQANRHWHSESPLMCVPLDCGKPPPIQNGFMKGENFEVGSKVQFFCNEGYELVGDSSWTCQKSGKWNKKSNPKCMPAKCPEPPLLENQLVLKELTTEVGVVTFSCKEGHVLQGPSVLKCLPSQQWNDSFPVCKIVLCTPPPLISFGVPIPSSALHFGSTVKYSCVGGFFLRGNSTTLCQPDGTWSSPLPECVPVECPQPEEIPNGIIDVQGLAYLSTALYTCKPGFELVGNTTTLCGENGHWLGGKPTCKAIECLKPKEILNGKFSYTDLHYGQTVTYSCNRGFRLEGPSALTCLETGDWDVDAPSCNAIHCDSPQPIENGFVEGADYSYGAIIIYSCFPGFQVAGHAMQTCEESGWSSSIPTCMPIDCGLPPHIDFGDCTKLKDDQGYFEQEDDMMEVPYVTPHPPYHLGAVAKTWENTKESPATHSSNFLYGTMVSYTCNPGYELLGNPVLICQEDGTWNGSAPSCISIECDLPTAPENGFLRFTETSMGSAVQYSCKPGHILAGSDLRLCLENRKWSGASPRCEAISCKKPNPVMNGSIKGSNYTYLSTLYYECDPGYVLNGTERRTCQDDKNWDEDEPICIPVDCSSPPVSANGQVRGDEYTFQKEIEYTCNEGFLLEGARSRVCLANGSWSGATPDCVPVRCATPPQLANGVTEGLDYGFMKEVTFHCHEGYILHGAPKLTCQSDGNWDAEIPLCKPVNCGPPEDLAHGFPNGFSFIHGGHIQYQCFPGYKLHGNSSRRCLSNGSWSGSSPSCLPCRCSTPVIEYGTVNGTDFDCGKAARIQCFKGFKLLGLSEITCEADGQWSSGFPHCEHTSCGSLPMIPNAFISETSSWKENVITYSCRSGYVIQGSSDLICTEKGVWSQPYPVCEPLSCGSPPSVANAVATGEAHTYESEVKLRCLEGYTMDTDTDTFTCQKDGRWFPERISCSPKKCPLPENITHILVHGDDFSVNRQVSVSCAEGYTFEGVNISVCQLDGTWEPPFSDESCSPVSCGKPESPEHGFVVGSKYTFESTIIYQCEPGYELEGNRERVCQENRQWSGGVAICKETRCETPLEFLNGKADIENRTTGPNVVYSCNRGYSLEGPSEAHCTENGTWSHPVPLCKPNPCPVPFVIPENALLSEKEFYVDQNVSIKCREGFLLQGHGIITCNPDETWTQTSAKCEKISCGPPAHVENAIARGVHYQYGDMITYSCYSGYMLEGFLRSVCLENGTWTSPPICRAVCRFPCQNGGICQRPNACSCPEGWMGRLCEEPICILPCLNGGRCVAPYQCDCPPGWTGSRCHTAVCQSPCLNGGKCVRPNRCHCLSSWTGHNCSRKRRTGF
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.54, 1.98] ÅDownload
The location of the lectin domain structural model is: 1424-1628
We infer [1.54, 1.98] Å as the interval of error of this structural model.
Template 1: 1GYK chain: A, P02743, NP_001630.1, sequence identity: 29.3%, coverage: 95.6%, location in sequence: 20-223, (1-204 in PDB).
Template 2: 3PVN chain: A, P02741, NP_000558.2, sequence identity: 28.3%, coverage: 95.6%, location in sequence: 19-224, (1-206 in PDB).
Template 3: 1HAS chain: A, P07629, NP_0NO0REFSEQ0.0, sequence identity: 27.8%, coverage: 97.1%, location in sequence: 23-234, (1-212 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • SVEP1 is a human coronary artery disease locus that promotes atherosclerosis. [33762433]
  • Functional investigation of the coronary artery disease gene SVEP1. [33185739]
  • SVEP1 as a Genetic Modifier of TEK-Related Primary Congenital Glaucoma. [33027505]
  • The novel miR-1269b-regulated protein SVEP1 induces hepatocellular carcinoma proliferation and metastasis likely through the PI3K/Akt pathway. [32371982]
  • Expression of polydom in dermal neurofibroma and surrounding dermis in von Recklinghausen's disease. [31570272]
  • Fine mapping of the 9q31 Hirschsprung's disease locus. [20361209]
  • Characterization of SVEP1, KIAA, and SRPX2 in an in vitro cell culture model of endotoxemia. [20236627]
  • Collaborative genome-wide association analysis supports a role for ANK3 and CACNA1C in bipolar disorder. [18711365]
  • Molecular and cellular characterization of SEL-OB/SVEP1 in osteogenic cells in vivo and in vitro. [16206243]
  • Polydom: a secreted protein with pentraxin, complement control protein, epidermal growth factor and von Willebrand factor A domains. [11062057]
UniProt Main References (6 PubMed Identifiers)
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • DNA sequence and analysis of human chromosome 9. [15164053]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • The full-ORF clone resource of the German cDNA Consortium. [17974005]
  • Humoral immunity to human breast cancer: antigen definition and quantitative analysis of mRNA expression. [12747765]
  • Human urinary glycoproteomics. attachment site specific analysis of N- and O-linked glycosylations by CID and ECD. [22171320]
RNA
RNA (Transcript ID: NM_153366.4)
sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
m7G-5')ppp(5'-GUUCCCUCCGGAGUUCCCGAGCUGCUGAGGAGUCUGGAUUGUGUCUGUCCCCAGUGUCAGAUGAAAGGGCGCUGAGGCUCUUGGCCGCUGCCCCGCGCCCAGCUCCGCGCACGCCCCUCUGCGAGUCCGGCCGCCCAGCGCCUCUUCCCGCCCGAGCCGCCGCCUGCGCUCCGGGGCAGCCGCUCUGUCUCCAGCGCGAUGUGGCCUCGCCUGGCCUUUUGUUGCUGGGGUCUGGCGCUCGUUUCGGGCUGGGCGACCUUUCAGCAGAUGUCCCCGUCGCGCAAUUUCAGCUUCCGCCUCUUCCCCGAGACCGCGCCCGGGGCCCCCGGGAGUAUCCCCGCGCCGCCCGCUCCUGGCGACGAAGCGGCGGGGAGCAGAGUGGAGCGGCUGGGCCAGGCGUUCCGGCGACGCGUGCGGCUGCUGCGGGAGCUCAGCGAGCGCCUGGAGCUUGUCUUCCUGGUGGAUGAUUCGUCCAGCGUGGGCGAAGUCAACUUCCGCAGCGAGCUCAUGUUCGUCCGCAAGCUGCUGUCCGACUUCCCCGUGGUGCCCACGGCCACGCGCGUGGCCAUCGUGACCUUCUCGUCCAAGAACUACGUGGUGCCGCGCGUCGAUUACAUCUCCACCCGCCGCGCGCGCCAGCACAAGUGCGCGCUGCUCCUCCAAGAGAUCCCUGCCAUCUCCUACCGAGGUGGCGGCACCUACACCAAGGGCGCCUUCCAGCAAGCCGCGCAAAUUCUUCUUCAUGCUAGAGAAAACUCAACAAAAGUUGUAUUUCUCAUCACUGAUGGAUAUUCCAAUGGGGGAGACCCUAGACCAAUUGCAGCGUCACUGCGAGAUUCAGGAGUGGAGAUCUUCACUUUUGGCAUAUGGCAAGGGAACAUUCGAGAGCUGAAUGACAUGGCUUCCACCCCAAAGGAGGAGCACUGUUACCUGCUACACAGUUUUGAAGAAUUUGAGGCUUUAGCUCGCCGGGCAUUGCAUGAAGAUCUACCUUCUGGGAGUUUUAUUCAAGAUGAUAUGGUCCACUGCUCAUAUCUUUGUGAUGAAGGCAAGGACUGCUGUGACCGAAUGGGAAGCUGCAAAUGUGGGACACACACAGGCCAUUUUGAGUGCAUCUGUGAAAAGGGGUAUUACGGGAAAGGUCUGCAGUAUGAAUGCACAGCUUGCCCAUCGGGGACAUACAAACCUGAAGGCUCACCAGGAGGAAUCAGCAGUUGCAUUCCAUGUCCUGAUGAAAAUCACACCUCUCCACCUGGAAGCACAUCCCCUGAAGACUGUGUCUGCAGAGAGGGAUACAGGGCAUCUGGCCAGACCUGUGAACUUGUCCACUGCCCUGCCCUGAAGCCUCCCGAAAAUGGUUACUUUAUCCAAAACACUUGCAACAACCACUUCAAUGCAGCCUGUGGGGUCCGAUGUCACCCUGGAUUUGAUCUUGUGGGAAGCAGCAUCAUCUUAUGUCUACCCAAUGGUUUGUGGUCCGGUUCAGAGAGCUACUGCAGAGUAAGAACAUGUCCUCAUCUCCGCCAGCCGAAACAUGGCCACAUCAGCUGUUCUACAAGGGAAAUGUUAUAUAAGACAACAUGUUUGGUUGCCUGUGAUGAAGGGUACAGACUAGAAGGCAGUGAUAAGCUUACUUGUCAAGGAAACAGCCAGUGGGAUGGGCCAGAACCCCGGUGUGUGGAGCGCCACUGUUCCACCUUUCAGAUGCCCAAAGAUGUCAUCAUAUCCCCCCACAACUGUGGCAAGCAGCCAGCCAAAUUUGGGACGAUCUGCUAUGUAAGUUGCCGCCAAGGGUUCAUUUUAUCUGGAGUCAAAGAAAUGCUGAGAUGUACCACUUCUGGAAAAUGGAAUGUCGGAGUUCAGGCAGCUGUGUGUAAAGACGUGGAGGCUCCUCAAAUCAACUGUCCUAAGGACAUAGAGGCUAAGACUCUGGAACAGCAAGAUUCUGCCAAUGUUACCUGGCAGAUUCCAACAGCUAAAGACAACUCUGGUGAAAAGGUGUCAGUCCACGUUCAUCCAGCUUUCACCCCACCUUACCUUUUCCCAAUUGGAGAUGUUGCUAUCGUAUACACGGCAACUGACCUAUCCGGCAACCAGGCCAGCUGCAUUUUCCAUAUCAAGGUUAUUGAUGCAGAACCACCUGUCAUAGACUGGUGCAGAUCUCCACCUCCCGUCCAGGUCUCGGAGAAGGUACAUGCCGCAAGCUGGGAUGAGCCUCAGUUCUCAGACAACUCAGGGGCUGAAUUGGUCAUUACCAGAAGUCAUACACAAGGAGACCUUUUCCCUCAAGGGGAGACUAUAGUACAGUAUACAGCCACUGACCCCUCAGGCAAUAACAGGACAUGUGAUAUCCAUAUUGUCAUAAAAGGUUCUCCCUGUGAAAUUCCAUUCACACCUGUAAAUGGGGAUUUUAUAUGCACUCCAGAUAAUACUGGAGUCAACUGUACAUUAACUUGCUUGGAGGGCUAUGAUUUCACAGAAGGGUCUACUGACAAGUAUUAUUGUGCUUAUGAAGAUGGCGUCUGGAAACCAACAUAUACCACUGAAUGGCCAGACUGUGCCAAAAAACGUUUUGCAAACCACGGGUUCAAGUCCUUUGAGAUGUUCUACAAAGCAGCUCGUUGUGAUGACACAGAUCUGAUGAAGAAGUUUUCUGAAGCAUUUGAGACGACCCUGGGAAAAAUGGUCCCAUCAUUUUGUAGUGAUGCAGAGGACAUUGACUGCAGACUGGAGGAGAACCUGACCAAAAAAUAUUGCCUAGAAUAUAAUUAUGACUAUGAAAAUGGCUUUGCAAUUGGACCAGGUGGCUGGGGUGCAGCUAAUAGGCUGGAUUACUCUUACGAUGACUUCCUGGACACUGUGCAAGAAACAGCCACAAGCAUCGGCAAUGCCAAGUCCUCACGGAUUAAAAGAAGUGCCCCAUUAUCUGACUAUAAAAUUAAGUUAAUUUUUAACAUCACAGCUAGUGUGCCAUUACCCGAUGAAAGAAAUGAUACCCUUGAAUGGGAAAAUCAGCAACGACUCCUUCAGACAUUGGAAACUAUCACAAAUAAACUGAAAAGGACUCUCAACAAAGACCCCAUGUAUUCCUUUCAGCUUGCAUCAGAAAUACUUAUAGCCGACAGCAAUUCAUUAGAAACAAAAAAGGCUUCCCCCUUCUGCAGACCAGGCUCAGUGCUGAGAGGGCGUAUGUGUGUCAAUUGCCCUUUGGGAACCUAUUAUAAUCUGGAACAUUUCACCUGUGAAAGCUGCCGGAUCGGAUCCUAUCAAGAUGAAGAAGGGCAACUUGAGUGCAAGCUUUGCCCCUCUGGGAUGUACACGGAAUAUAUCCAUUCAAGAAACAUCUCUGAUUGUAAAGCUCAGUGUAAACAAGGCACCUACUCAUACAGUGGACUUGAGACUUGUGAAUCGUGUCCACUGGGCACUUAUCAGCCAAAAUUUGGUUCCCGGAGCUGCCUCUCGUGUCCAGAAAACACCUCAACUGUGAAAAGAGGAGCCGUGAACAUUUCUGCAUGUGGAGUUCCUUGUCCAGAAGGAAAAUUCUCGCGUUCUGGGUUAAUGCCCUGUCACCCAUGUCCUCGUGACUAUUACCAACCUAAUGCAGGGAAGGCCUUCUGCCUGGCCUGUCCCUUUUAUGGAACUACCCCAUUCGCUGGUUCCAGAUCCAUCACAGAAUGUUCAAGUUUUAGUUCAACUUUCUCAGCGGCAGAGGAAAGUGUGGUGCCCCCUGCCUCUCUUGGACAUAUUAAAAAGAGGCAUGAAAUCAGCAGUCAGGUUUUCCAUGAAUGCUUCUUUAACCCUUGCCACAAUAGUGGAACCUGCCAGCAACUUGGGCGUGGUUAUGUUUGUCUCUGUCCACUUGGAUAUACAGGCUUAAAGUGUGAAACAGACAUCGAUGAGUGCAGCCCACUGCCUUGCCUCAACAAUGGAGUUUGUAAAGACCUAGUUGGGGAAUUCAUUUGUGAGUGCCCAUCAGGUUACACAGGUCAGCGGUGUGAAGAAAAUAUAAAUGAGUGUAGCUCCAGUCCUUGUUUAAAUAAAGGAAUCUGUGUUGAUGGUGUGGCUGGCUAUCGUUGCACAUGUGUGAAAGGAUUUGUAGGCCUGCAUUGUGAAACAGAAGUCAAUGAAUGCCAGUCAAACCCAUGCUUAAAUAAUGCAGUCUGUGAAGACCAGGUUGGGGGAUUCUUGUGCAAAUGCCCACCUGGAUUUUUGGGUACCCGAUGUGGAAAGAACGUCGAUGAGUGUCUCAGUCAGCCAUGCAAAAAUGGAGCUACCUGUAAAGACGGUGCCAAUAGCUUCAGAUGCCUGUGUGCAGCUGGCUUCACAGGAUCACACUGUGAAUUGAACAUCAAUGAAUGUCAGUCUAAUCCAUGUAGAAAUCAGGCCACCUGUGUGGAUGAAUUAAAUUCAUACAGUUGUAAAUGUCAGCCAGGAUUUUCAGGCAAAAGGUGUGAAACAGAACAGUCUACAGGCUUUAACCUGGAUUUUGAAGUUUCUGGCAUCUAUGGAUAUGUCAUGCUAGAUGGCAUGCUCCCAUCUCUCCAUGCUCUAACCUGUACCUUCUGGAUGAAAUCCUCUGACGACAUGAACUAUGGAACACCAAUCUCCUAUGCAGUUGAUAACGGCAGCGACAAUACCUUGCUCCUGACUGAUUAUAACGGCUGGGUUCUUUAUGUGAAUGGCAGGGAAAAGAUAACAAACUGUCCCUCGGUGAAUGAUGGCAGAUGGCAUCAUAUUGCAAUCACUUGGACAAGUGCCAAUGGCAUCUGGAAAGUCUAUAUCGAUGGGAAAUUAUCUGACGGUGGUGCUGGCCUCUCUGUUGGUUUGCCCAUACCUGGUGGUGGUGCGUUAGUUCUGGGGCAAGAGCAAGACAAAAAAGGAGAGGGAUUCAGCCCAGCUGAGUCUUUUGUGGGCUCCAUAAGCCAGCUCAACCUCUGGGACUAUGUCCUGUCUCCACAGCAGGUGAAGUCACUGGCUACCUCCUGCCCAGAGGAACUCAGUAAAGGAAACGUGUUAGCAUGGCCUGAUUUCUUGUCAGGAAUUGUGGGGAAAGUGAAGAUCGAUUCUAAGAGCAUAUUUUGUUCUGAUUGCCCACGCUUAGGAGGGUCAGUGCCUCAUCUGAGAACUGCAUCUGAAGAUUUAAAGCCAGGUUCCAAAGUCAAUCUGUUCUGUGAUCCAGGCUUCCAGCUGGUCGGGAACCCUGUGCAGUACUGUCUGAAUCAAGGACAGUGGACACAACCACUUCCUCACUGUGAACGCAUUAGCUGUGGGGUGCCACCUCCUUUGGAGAAUGGCUUCCAUUCAGCCGAUGACUUCUAUGCUGGCAGCACAGUAACCUACCAGUGCAACAAUGGCUACUAUCUAUUGGGUGACUCAAGGAUGUUCUGUACAGAUAAUGGGAGCUGGAACGGCGUUUCACCAUCCUGCCUUGAUGUCGAUGAGUGUGCAGUUGGAUCAGAUUGUAGUGAGCAUGCUUCUUGCCUGAACGUAGAUGGAUCCUACAUAUGUUCAUGUGUCCCACCGUACACAGGAGAUGGGAAAAACUGUGCAGAACCUAUAAAAUGUAAGGCUCCAGGAAAUCCGGAAAAUGGCCACUCCUCAGGUGAGAUUUAUACAGUAGGUGCCGAAGUCACAUUUUCGUGUCAGGAAGGAUACCAGUUGAUGGGAGUAACCAAAAUCACAUGUUUGGAGUCUGGAGAAUGGAAUCAUCUAAUACCAUAUUGUAAAGCUGUUUCAUGUGGUAAACCGGCUAUUCCAGAAAAUGGUUGCAUUGAGGAGUUAGCAUUUACUUUUGGCAGCAAAGUGACAUAUAGGUGUAAUAAAGGAUAUACUCUGGCCGGUGAUAAAGAAUCAUCCUGUCUUGCUAACAGUUCUUGGAGUCAUUCCCCUCCUGUGUGUGAACCAGUGAAGUGUUCUAGUCCGGAAAAUAUAAAUAAUGGAAAAUAUAUUUUGAGUGGGCUUACCUACCUUUCUACUGCAUCAUAUUCAUGCGAUACAGGAUACAGCUUACAGGGCCCUUCCAUUAUUGAAUGCACGGCUUCUGGCAUCUGGGACAGAGCGCCACCUGCCUGUCACCUCGUCUUCUGUGGAGAACCACCUGCCAUCAAAGAUGCUGUCAUUACGGGGAAUAACUUCACUUUCAGGAACACCGUCACUUACACUUGCAAAGAAGGCUAUACUCUUGCUGGUCUUGACACCAUUGAAUGCCUGGCCGACGGCAAGUGGAGUAGAAGUGACCAGCAGUGCCUGGCUGUCUCCUGUGAUGAGCCACCCAUUGUGGACCACGCCUCUCCAGAGACUGCCCAUCGGCUCUUUGGAGACAUUGCAUUCUACUACUGCUCUGAUGGUUACAGCCUAGCAGACAAUUCCCAGCUUCUCUGCAAUGCCCAGGGCAAGUGGGUACCCCCAGAAGGUCAAGACAUGCCCCGUUGUAUAGCUCAUUUCUGUGAAAAACCUCCAUCGGUUUCCUAUAGCAUCUUGGAAUCUGUGAGCAAAGCAAAAUUUGCAGCUGGCUCAGUUGUGAGCUUUAAAUGCAUGGAAGGCUUUGUACUGAACACCUCAGCAAAGAUUGAAUGUAUGAGAGGUGGGCAGUGGAACCCUUCCCCCAUGUCCAUCCAGUGCAUCCCUGUGCGGUGUGGAGAGCCACCAAGCAUCAUGAAUGGCUAUGCAAGUGGAUCAAACUACAGUUUUGGAGCCAUGGUGGCUUACAGCUGCAACAAGGGGUUCUACAUCAAAGGGGAAAAGAAGAGCACCUGCGAAGCCACAGGGCAGUGGAGUAGUCCUAUACCGACGUGCCACCCGGUAUCUUGUGGUGAACCACCUAAGGUUGAGAAUGGCUUUCUGGAGCAUACAACUGGCAGGAUCUUUGAGAGUGAAGUGAGGUAUCAGUGUAACCCGGGCUAUAAGUCAGUCGGAAGUCCUGUAUUUGUCUGCCAAGCCAAUCGCCACUGGCACAGUGAAUCCCCUCUGAUGUGUGUUCCUCUCGACUGUGGAAAACCUCCCCCGAUCCAGAAUGGCUUCAUGAAAGGAGAAAACUUUGAAGUAGGGUCCAAGGUUCAGUUUUUCUGUAAUGAGGGUUAUGAGCUUGUUGGUGACAGUUCUUGGACAUGUCAGAAAUCUGGCAAAUGGAAUAAGAAGUCAAAUCCAAAGUGCAUGCCUGCCAAGUGCCCAGAGCCGCCCCUCUUGGAAAACCAGCUAGUAUUAAAGGAGUUGACCACCGAGGUAGGAGUUGUGACAUUUUCCUGUAAAGAAGGGCAUGUCCUGCAAGGCCCCUCUGUCCUGAAAUGCUUGCCAUCCCAGCAAUGGAAUGACUCUUUCCCUGUUUGUAAGAUUGUUCUUUGUACCCCACCUCCCCUAAUUUCCUUUGGUGUCCCCAUUCCUUCUUCUGCUCUUCAUUUUGGAAGUACUGUCAAGUAUUCUUGUGUAGGUGGGUUUUUCCUAAGAGGAAAUUCUACCACCCUCUGCCAACCUGAUGGCACCUGGAGCUCUCCACUGCCAGAAUGUGUUCCAGUAGAAUGUCCCCAACCUGAGGAAAUCCCCAAUGGAAUCAUUGAUGUGCAAGGCCUUGCCUAUCUCAGCACAGCUCUCUAUACCUGCAAGCCAGGCUUUGAAUUGGUGGGAAAUACUACCACCCUUUGUGGAGAAAAUGGUCACUGGCUUGGAGGAAAACCAACAUGUAAAGCCAUUGAGUGCCUGAAACCCAAGGAGAUUUUGAAUGGCAAAUUCUCUUACACGGACCUACACUAUGGACAGACCGUUACCUACUCUUGCAACCGAGGCUUUCGGCUCGAAGGUCCCAGUGCCUUGACCUGUUUAGAGACAGGUGAUUGGGAUGUAGAUGCCCCAUCUUGCAAUGCCAUCCACUGUGAUUCCCCACAACCCAUUGAAAAUGGUUUUGUAGAAGGUGCAGAUUACAGCUAUGGUGCCAUAAUCAUCUACAGUUGCUUCCCUGGGUUUCAGGUGGCUGGUCAUGCCAUGCAGACCUGUGAAGAGUCAGGAUGGUCAAGUUCCAUCCCAACAUGUAUGCCAAUAGACUGUGGCCUCCCUCCUCAUAUAGAUUUUGGAGACUGUACUAAACUCAAAGAUGACCAGGGAUAUUUUGAGCAAGAAGACGACAUGAUGGAAGUUCCAUAUGUGACUCCUCACCCUCCUUAUCAUUUGGGAGCAGUGGCUAAAACCUGGGAAAAUACAAAGGAGUCUCCUGCUACACAUUCAUCAAACUUUCUGUAUGGUACCAUGGUUUCAUACACCUGUAAUCCAGGAUAUGAACUUCUGGGGAACCCUGUGCUGAUCUGCCAGGAAGAUGGAACUUGGAAUGGCAGUGCACCAUCCUGCAUUUCAAUUGAAUGUGACUUGCCUACUGCUCCUGAAAAUGGCUUUUUGCGUUUUACAGAGACUAGCAUGGGAAGUGCUGUGCAGUAUAGCUGUAAACCUGGACACAUUCUAGCAGGCUCUGACUUAAGGCUUUGUCUAGAGAAUAGAAAGUGGAGUGGUGCCUCCCCACGCUGUGAAGCCAUUUCAUGCAAAAAGCCAAAUCCAGUCAUGAAUGGAUCCAUCAAAGGAAGCAACUACACAUACCUGAGCACGUUGUACUAUGAGUGUGACCCCGGAUAUGUGCUGAAUGGCACUGAGAGGAGAACAUGCCAGGAUGACAAAAACUGGGAUGAGGAUGAGCCCAUUUGCAUUCCUGUGGACUGCAGUUCACCCCCAGUCUCAGCCAAUGGCCAGGUGAGAGGAGACGAGUACACAUUCCAAAAAGAGAUUGAAUACACUUGCAAUGAAGGGUUCUUGCUUGAGGGAGCCAGGAGUCGGGUUUGUCUUGCCAAUGGAAGUUGGAGUGGAGCCACUCCCGACUGUGUGCCUGUCAGAUGUGCCACCCCGCCACAACUGGCCAAUGGGGUGACGGAAGGCCUGGACUAUGGCUUCAUGAAGGAAGUAACAUUCCACUGUCACGAGGGCUACAUCUUGCACGGUGCUCCAAAACUCACCUGUCAGUCAGAUGGCAACUGGGAUGCAGAGAUUCCUCUCUGUAAACCAGUCAACUGUGGACCUCCUGAAGAUCUUGCCCAUGGUUUCCCUAAUGGUUUUUCCUUUAUUCAUGGGGGCCAUAUACAGUAUCAGUGCUUUCCUGGUUAUAAGCUCCAUGGAAAUUCAUCAAGAAGGUGCCUCUCCAAUGGCUCCUGGAGUGGCAGCUCACCUUCCUGCCUGCCUUGCAGAUGUUCCACACCAGUAAUUGAAUAUGGAACUGUCAAUGGGACAGAUUUUGACUGUGGAAAGGCAGCCCGGAUUCAGUGCUUCAAAGGCUUCAAGCUCCUAGGACUUUCUGAAAUCACCUGUGAAGCCGAUGGCCAGUGGAGCUCUGGGUUCCCCCACUGUGAACACACUUCUUGUGGUUCUCUUCCAAUGAUACCAAAUGCGUUCAUCAGUGAGACCAGCUCUUGGAAGGAAAAUGUGAUAACUUACAGCUGCAGGUCUGGAUAUGUCAUACAAGGCAGUUCAGAUCUGAUUUGUACAGAGAAAGGGGUAUGGAGCCAGCCUUAUCCAGUCUGUGAGCCCUUGUCCUGUGGGUCCCCACCGUCUGUCGCCAAUGCAGUGGCAACUGGAGAGGCACACACCUAUGAAAGUGAAGUGAAACUCAGAUGUCUGGAAGGUUAUACGAUGGAUACAGAUACAGAUACAUUCACCUGUCAGAAAGAUGGUCGCUGGUUCCCUGAGAGAAUCUCCUGCAGUCCUAAAAAAUGUCCUCUCCCGGAAAACAUAACACAUAUACUUGUACAUGGGGACGAUUUCAGUGUGAAUAGGCAAGUUUCUGUGUCAUGUGCAGAAGGGUAUACCUUUGAGGGAGUUAACAUAUCAGUAUGUCAGCUUGAUGGAACCUGGGAGCCACCAUUCUCCGAUGAAUCUUGCAGUCCAGUUUCUUGUGGGAAACCUGAAAGUCCAGAACAUGGAUUUGUGGUUGGCAGUAAAUACACCUUUGAAAGCACAAUUAUUUAUCAGUGUGAGCCUGGCUAUGAACUAGAGGGGAACAGGGAACGUGUCUGCCAGGAGAACAGACAGUGGAGUGGAGGGGUGGCAAUAUGCAAAGAGACCAGGUGUGAAACUCCACUUGAAUUUCUCAAUGGGAAAGCUGACAUUGAAAACAGGACGACUGGACCCAACGUGGUAUAUUCCUGCAACAGAGGCUACAGUCUUGAAGGGCCAUCUGAGGCACACUGCACAGAAAAUGGAACCUGGAGCCACCCAGUCCCUCUCUGCAAACCAAAUCCAUGCCCUGUUCCUUUUGUGAUUCCCGAGAAUGCUCUGCUGUCUGAAAAGGAGUUUUAUGUUGAUCAGAAUGUGUCCAUCAAAUGUAGGGAAGGUUUUCUGCUGCAGGGCCACGGCAUCAUUACCUGCAACCCCGACGAGACGUGGACACAGACAAGCGCCAAAUGUGAAAAAAUCUCAUGUGGUCCACCAGCUCACGUAGAAAAUGCAAUUGCUCGAGGCGUACAUUAUCAAUAUGGAGACAUGAUCACCUACUCAUGUUACAGUGGAUACAUGUUGGAGGGUUUCCUGAGGAGUGUUUGUUUAGAAAAUGGAACAUGGACAUCACCUCCUAUUUGCAGAGCUGUCUGUCGAUUUCCAUGUCAGAAUGGGGGCAUCUGCCAACGCCCAAAUGCUUGUUCCUGUCCAGAGGGCUGGAUGGGGCGCCUCUGUGAAGAACCAAUCUGCAUUCUUCCCUGUCUGAACGGAGGUCGCUGUGUGGCCCCUUACCAGUGUGACUGCCCGCCUGGCUGGACGGGGUCUCGCUGUCAUACAGCUGUUUGCCAGUCUCCCUGCUUAAAUGGUGGAAAAUGUGUAAGACCAAACCGAUGUCACUGUCUUUCUUCUUGGACGGGACAUAACUGUUCCAGGAAAAGGAGGACUGGGUUUUAACCACUGCACGACCAUCUGGCUCUCCCAAAAGCAGGAUCAUCUCUCCUCGGUAGUGCCUGGGCAUCCUGGAACUUAUGCAAAGAAAGUCCAACAUGGUGCUGGGUCUUGUUUAGUAAACUUGUUACUUGGGGUUACUUUUUUUAUUUUGUGAUAUAUUUUGUUAUUCCUUGUGACAUACUUUCUUACAUGUUUCCAUUUUUAAAUAUGCCUGUAUUUUCUAUAUAAAAAUUAUAUUAAAUAGAUGCUGCUCUACCCUCACAAAAUGUACAUAUUCUGCUGUCUAUUGGGAAAGUUCCUGGUACACAUUUUUAUUCAGUUACUUAAAAUGAUUUUUCCAUUAAAGUAUAUUUUGCUACUAAAUAAUAUUUUGCUGGAUAGUACCAUUUUAUGAGGUGGCCAAGGGAUUCAUAGAGAGGACUCAUGAUCUUUCAUCUGUGCCACUGGCACCACAUAGGAGACCCCUUACAAUAAAGGAGACCCCUUUGUUCUGGUUCCAUCUUCUAUACAAUAUGUGUAAUAAUAAAAGCUUUUUCUUUCAUUUAAUCAAUCAGAGAGUAACUGUUGGACCUGGUACUCUCCACCACAUAAUUAUGUCCUGGUACUUAGGGUAGCCUGGCUAAUUCUUUUCACAACAUUUGAAAAGCCGUAGGCAUUAACUUCAUGGAUGUGGAGAAACAGCAUAAUGACCUUGGUUCACAAUGAAAGUGCUAGCCUUCUUUCUCGUGGCUGGAAUAAGAAAUGCAAGAACUGGAAGAUUAACAAAGAGCUGAUACCCGGACUGGUAAUCCCACAACUCACUAUUUUGGGAGGAAGGGGAAGACAGGGAAAGAGAAGGAAAAAGGCAAAUGGGAAACAUUCCCCAGAGCUGUGCUCCUGGUCUCACCUGCAAAAAAGAAUUGCAGCCACCUAAGAGAAAGCUGAGCUGCCCCUCAGUCCUCACUGUCACCUACCUCUAUCACAACAAUUGUACCAAGAUGAAGCCUUCCCCAGACUUCAGAAAAUAAAGUCAAACCCUAGAUUUUGUUUUAAAAUAGGAAACUCAGAAUCAACUUGCCUCCAUCCUCUGGGAAAACUGCUCCCACACAGGCCUUGGAGUGUGUUGUAGCACUGUGGAGGAAUGCAGAAAGGAUGAAAGAGAUCUUGAUUCUCCUAGUGGUUCUCUUCACUACCGUAGGCAUCCCUCAGCCAUUGACUCCUCCUUCUUUCUCUUGACAUUCACUUUCUUGGCCAGUCUUACAUGCUUAUGAGUCUACUUUCCAAUAAAUUUACUCAUAGUCCAUUAACUUCCAAA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 79987)
sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
strand -
bA427L11.3, POLYDOM, FLJ13529
NCBI CDS gene sequence (10716 bp)
5'-ATGTGGCCTCGCCTGGCCTTTTGTTGCTGGGGTCTGGCGCTCGTTTCGGGCTGGGCGACCTTTCAGCAGATGTCCCCGTCGCGCAATTTCAGCTTCCGCCTCTTCCCCGAGACCGCGCCCGGGGCCCCCGGGAGTATCCCCGCGCCGCCCGCTCCTGGCGACGAAGCGGCGGGGAGCAGAGTGGAGCGGCTGGGCCAGGCGTTCCGGCGACGCGTGCGGCTGCTGCGGGAGCTCAGCGAGCGCCTGGAGCTTGTCTTCCTGGTGGATGATTCGTCCAGCGTGGGCGAAGTCAACTTCCGCAGCGAGCTCATGTTCGTCCGCAAGCTGCTGTCCGACTTCCCCGTGGTGCCCACGGCCACGCGCGTGGCCATCGTGACCTTCTCGTCCAAGAACTACGTGGTGCCGCGCGTCGATTACATCTCCACCCGCCGCGCGCGCCAGCACAAGTGCGCGCTGCTCCTCCAAGAGATCCCTGCCATCTCCTACCGAGGTGGCGGCACCTACACCAAGGGCGCCTTCCAGCAAGCCGCGCAAATTCTTCTTCATGCTAGAGAAAACTCAACAAAAGTTGTATTTCTCATCACTGATGGATATTCCAATGGGGGAGACCCTAGACCAATTGCAGCGTCACTGCGAGATTCAGGAGTGGAGATCTTCACTTTTGGCATATGGCAAGGGAACATTCGAGAGCTGAATGACATGGCTTCCACCCCAAAGGAGGAGCACTGTTACCTGCTACACAGTTTTGAAGAATTTGAGGCTTTAGCTCGCCGGGCATTGCATGAAGATCTACCTTCTGGGAGTTTTATTCAAGATGATATGGTCCACTGCTCATATCTTTGTGATGAAGGCAAGGACTGCTGTGACCGAATGGGAAGCTGCAAATGTGGGACACACACAGGCCATTTTGAGTGCATCTGTGAAAAGGGGTATTACGGGAAAGGTCTGCAGTATGAATGCACAGCTTGCCCATCGGGGACATACAAACCTGAAGGCTCACCAGGAGGAATCAGCAGTTGCATTCCATGTCCTGATGAAAATCACACCTCTCCACCTGGAAGCACATCCCCTGAAGACTGTGTCTGCAGAGAGGGATACAGGGCATCTGGCCAGACCTGTGAACTTGTCCACTGCCCTGCCCTGAAGCCTCCCGAAAATGGTTACTTTATCCAAAACACTTGCAACAACCACTTCAATGCAGCCTGTGGGGTCCGATGTCACCCTGGATTTGATCTTGTGGGAAGCAGCATCATCTTATGTCTACCCAATGGTTTGTGGTCCGGTTCAGAGAGCTACTGCAGAGTAAGAACATGTCCTCATCTCCGCCAGCCGAAACATGGCCACATCAGCTGTTCTACAAGGGAAATGTTATATAAGACAACATGTTTGGTTGCCTGTGATGAAGGGTACAGACTAGAAGGCAGTGATAAGCTTACTTGTCAAGGAAACAGCCAGTGGGATGGGCCAGAACCCCGGTGTGTGGAGCGCCACTGTTCCACCTTTCAGATGCCCAAAGATGTCATCATATCCCCCCACAACTGTGGCAAGCAGCCAGCCAAATTTGGGACGATCTGCTATGTAAGTTGCCGCCAAGGGTTCATTTTATCTGGAGTCAAAGAAATGCTGAGATGTACCACTTCTGGAAAATGGAATGTCGGAGTTCAGGCAGCTGTGTGTAAAGACGTGGAGGCTCCTCAAATCAACTGTCCTAAGGACATAGAGGCTAAGACTCTGGAACAGCAAGATTCTGCCAATGTTACCTGGCAGATTCCAACAGCTAAAGACAACTCTGGTGAAAAGGTGTCAGTCCACGTTCATCCAGCTTTCACCCCACCTTACCTTTTCCCAATTGGAGATGTTGCTATCGTATACACGGCAACTGACCTATCCGGCAACCAGGCCAGCTGCATTTTCCATATCAAGGTTATTGATGCAGAACCACCTGTCATAGACTGGTGCAGATCTCCACCTCCCGTCCAGGTCTCGGAGAAGGTACATGCCGCAAGCTGGGATGAGCCTCAGTTCTCAGACAACTCAGGGGCTGAATTGGTCATTACCAGAAGTCATACACAAGGAGACCTTTTCCCTCAAGGGGAGACTATAGTACAGTATACAGCCACTGACCCCTCAGGCAATAACAGGACATGTGATATCCATATTGTCATAAAAGGTTCTCCCTGTGAAATTCCATTCACACCTGTAAATGGGGATTTTATATGCACTCCAGATAATACTGGAGTCAACTGTACATTAACTTGCTTGGAGGGCTATGATTTCACAGAAGGGTCTACTGACAAGTATTATTGTGCTTATGAAGATGGCGTCTGGAAACCAACATATACCACTGAATGGCCAGACTGTGCCAAAAAACGTTTTGCAAACCACGGGTTCAAGTCCTTTGAGATGTTCTACAAAGCAGCTCGTTGTGATGACACAGATCTGATGAAGAAGTTTTCTGAAGCATTTGAGACGACCCTGGGAAAAATGGTCCCATCATTTTGTAGTGATGCAGAGGACATTGACTGCAGACTGGAGGAGAACCTGACCAAAAAATATTGCCTAGAATATAATTATGACTATGAAAATGGCTTTGCAATTGGACCAGGTGGCTGGGGTGCAGCTAATAGGCTGGATTACTCTTACGATGACTTCCTGGACACTGTGCAAGAAACAGCCACAAGCATCGGCAATGCCAAGTCCTCACGGATTAAAAGAAGTGCCCCATTATCTGACTATAAAATTAAGTTAATTTTTAACATCACAGCTAGTGTGCCATTACCCGATGAAAGAAATGATACCCTTGAATGGGAAAATCAGCAACGACTCCTTCAGACATTGGAAACTATCACAAATAAACTGAAAAGGACTCTCAACAAAGACCCCATGTATTCCTTTCAGCTTGCATCAGAAATACTTATAGCCGACAGCAATTCATTAGAAACAAAAAAGGCTTCCCCCTTCTGCAGACCAGGCTCAGTGCTGAGAGGGCGTATGTGTGTCAATTGCCCTTTGGGAACCTATTATAATCTGGAACATTTCACCTGTGAAAGCTGCCGGATCGGATCCTATCAAGATGAAGAAGGGCAACTTGAGTGCAAGCTTTGCCCCTCTGGGATGTACACGGAATATATCCATTCAAGAAACATCTCTGATTGTAAAGCTCAGTGTAAACAAGGCACCTACTCATACAGTGGACTTGAGACTTGTGAATCGTGTCCACTGGGCACTTATCAGCCAAAATTTGGTTCCCGGAGCTGCCTCTCGTGTCCAGAAAACACCTCAACTGTGAAAAGAGGAGCCGTGAACATTTCTGCATGTGGAGTTCCTTGTCCAGAAGGAAAATTCTCGCGTTCTGGGTTAATGCCCTGTCACCCATGTCCTCGTGACTATTACCAACCTAATGCAGGGAAGGCCTTCTGCCTGGCCTGTCCCTTTTATGGAACTACCCCATTCGCTGGTTCCAGATCCATCACAGAATGTTCAAGTTTTAGTTCAACTTTCTCAGCGGCAGAGGAAAGTGTGGTGCCCCCTGCCTCTCTTGGACATATTAAAAAGAGGCATGAAATCAGCAGTCAGGTTTTCCATGAATGCTTCTTTAACCCTTGCCACAATAGTGGAACCTGCCAGCAACTTGGGCGTGGTTATGTTTGTCTCTGTCCACTTGGATATACAGGCTTAAAGTGTGAAACAGACATCGATGAGTGCAGCCCACTGCCTTGCCTCAACAATGGAGTTTGTAAAGACCTAGTTGGGGAATTCATTTGTGAGTGCCCATCAGGTTACACAGGTCAGCGGTGTGAAGAAAATATAAATGAGTGTAGCTCCAGTCCTTGTTTAAATAAAGGAATCTGTGTTGATGGTGTGGCTGGCTATCGTTGCACATGTGTGAAAGGATTTGTAGGCCTGCATTGTGAAACAGAAGTCAATGAATGCCAGTCAAACCCATGCTTAAATAATGCAGTCTGTGAAGACCAGGTTGGGGGATTCTTGTGCAAATGCCCACCTGGATTTTTGGGTACCCGATGTGGAAAGAACGTCGATGAGTGTCTCAGTCAGCCATGCAAAAATGGAGCTACCTGTAAAGACGGTGCCAATAGCTTCAGATGCCTGTGTGCAGCTGGCTTCACAGGATCACACTGTGAATTGAACATCAATGAATGTCAGTCTAATCCATGTAGAAATCAGGCCACCTGTGTGGATGAATTAAATTCATACAGTTGTAAATGTCAGCCAGGATTTTCAGGCAAAAGGTGTGAAACAGAACAGTCTACAGGCTTTAACCTGGATTTTGAAGTTTCTGGCATCTATGGATATGTCATGCTAGATGGCATGCTCCCATCTCTCCATGCTCTAACCTGTACCTTCTGGATGAAATCCTCTGACGACATGAACTATGGAACACCAATCTCCTATGCAGTTGATAACGGCAGCGACAATACCTTGCTCCTGACTGATTATAACGGCTGGGTTCTTTATGTGAATGGCAGGGAAAAGATAACAAACTGTCCCTCGGTGAATGATGGCAGATGGCATCATATTGCAATCACTTGGACAAGTGCCAATGGCATCTGGAAAGTCTATATCGATGGGAAATTATCTGACGGTGGTGCTGGCCTCTCTGTTGGTTTGCCCATACCTGGTGGTGGTGCGTTAGTTCTGGGGCAAGAGCAAGACAAAAAAGGAGAGGGATTCAGCCCAGCTGAGTCTTTTGTGGGCTCCATAAGCCAGCTCAACCTCTGGGACTATGTCCTGTCTCCACAGCAGGTGAAGTCACTGGCTACCTCCTGCCCAGAGGAACTCAGTAAAGGAAACGTGTTAGCATGGCCTGATTTCTTGTCAGGAATTGTGGGGAAAGTGAAGATCGATTCTAAGAGCATATTTTGTTCTGATTGCCCACGCTTAGGAGGGTCAGTGCCTCATCTGAGAACTGCATCTGAAGATTTAAAGCCAGGTTCCAAAGTCAATCTGTTCTGTGATCCAGGCTTCCAGCTGGTCGGGAACCCTGTGCAGTACTGTCTGAATCAAGGACAGTGGACACAACCACTTCCTCACTGTGAACGCATTAGCTGTGGGGTGCCACCTCCTTTGGAGAATGGCTTCCATTCAGCCGATGACTTCTATGCTGGCAGCACAGTAACCTACCAGTGCAACAATGGCTACTATCTATTGGGTGACTCAAGGATGTTCTGTACAGATAATGGGAGCTGGAACGGCGTTTCACCATCCTGCCTTGATGTCGATGAGTGTGCAGTTGGATCAGATTGTAGTGAGCATGCTTCTTGCCTGAACGTAGATGGATCCTACATATGTTCATGTGTCCCACCGTACACAGGAGATGGGAAAAACTGTGCAGAACCTATAAAATGTAAGGCTCCAGGAAATCCGGAAAATGGCCACTCCTCAGGTGAGATTTATACAGTAGGTGCCGAAGTCACATTTTCGTGTCAGGAAGGATACCAGTTGATGGGAGTAACCAAAATCACATGTTTGGAGTCTGGAGAATGGAATCATCTAATACCATATTGTAAAGCTGTTTCATGTGGTAAACCGGCTATTCCAGAAAATGGTTGCATTGAGGAGTTAGCATTTACTTTTGGCAGCAAAGTGACATATAGGTGTAATAAAGGATATACTCTGGCCGGTGATAAAGAATCATCCTGTCTTGCTAACAGTTCTTGGAGTCATTCCCCTCCTGTGTGTGAACCAGTGAAGTGTTCTAGTCCGGAAAATATAAATAATGGAAAATATATTTTGAGTGGGCTTACCTACCTTTCTACTGCATCATATTCATGCGATACAGGATACAGCTTACAGGGCCCTTCCATTATTGAATGCACGGCTTCTGGCATCTGGGACAGAGCGCCACCTGCCTGTCACCTCGTCTTCTGTGGAGAACCACCTGCCATCAAAGATGCTGTCATTACGGGGAATAACTTCACTTTCAGGAACACCGTCACTTACACTTGCAAAGAAGGCTATACTCTTGCTGGTCTTGACACCATTGAATGCCTGGCCGACGGCAAGTGGAGTAGAAGTGACCAGCAGTGCCTGGCTGTCTCCTGTGATGAGCCACCCATTGTGGACCACGCCTCTCCAGAGACTGCCCATCGGCTCTTTGGAGACATTGCATTCTACTACTGCTCTGATGGTTACAGCCTAGCAGACAATTCCCAGCTTCTCTGCAATGCCCAGGGCAAGTGGGTACCCCCAGAAGGTCAAGACATGCCCCGTTGTATAGCTCATTTCTGTGAAAAACCTCCATCGGTTTCCTATAGCATCTTGGAATCTGTGAGCAAAGCAAAATTTGCAGCTGGCTCAGTTGTGAGCTTTAAATGCATGGAAGGCTTTGTACTGAACACCTCAGCAAAGATTGAATGTATGAGAGGTGGGCAGTGGAACCCTTCCCCCATGTCCATCCAGTGCATCCCTGTGCGGTGTGGAGAGCCACCAAGCATCATGAATGGCTATGCAAGTGGATCAAACTACAGTTTTGGAGCCATGGTGGCTTACAGCTGCAACAAGGGGTTCTACATCAAAGGGGAAAAGAAGAGCACCTGCGAAGCCACAGGGCAGTGGAGTAGTCCTATACCGACGTGCCACCCGGTATCTTGTGGTGAACCACCTAAGGTTGAGAATGGCTTTCTGGAGCATACAACTGGCAGGATCTTTGAGAGTGAAGTGAGGTATCAGTGTAACCCGGGCTATAAGTCAGTCGGAAGTCCTGTATTTGTCTGCCAAGCCAATCGCCACTGGCACAGTGAATCCCCTCTGATGTGTGTTCCTCTCGACTGTGGAAAACCTCCCCCGATCCAGAATGGCTTCATGAAAGGAGAAAACTTTGAAGTAGGGTCCAAGGTTCAGTTTTTCTGTAATGAGGGTTATGAGCTTGTTGGTGACAGTTCTTGGACATGTCAGAAATCTGGCAAATGGAATAAGAAGTCAAATCCAAAGTGCATGCCTGCCAAGTGCCCAGAGCCGCCCCTCTTGGAAAACCAGCTAGTATTAAAGGAGTTGACCACCGAGGTAGGAGTTGTGACATTTTCCTGTAAAGAAGGGCATGTCCTGCAAGGCCCCTCTGTCCTGAAATGCTTGCCATCCCAGCAATGGAATGACTCTTTCCCTGTTTGTAAGATTGTTCTTTGTACCCCACCTCCCCTAATTTCCTTTGGTGTCCCCATTCCTTCTTCTGCTCTTCATTTTGGAAGTACTGTCAAGTATTCTTGTGTAGGTGGGTTTTTCCTAAGAGGAAATTCTACCACCCTCTGCCAACCTGATGGCACCTGGAGCTCTCCACTGCCAGAATGTGTTCCAGTAGAATGTCCCCAACCTGAGGAAATCCCCAATGGAATCATTGATGTGCAAGGCCTTGCCTATCTCAGCACAGCTCTCTATACCTGCAAGCCAGGCTTTGAATTGGTGGGAAATACTACCACCCTTTGTGGAGAAAATGGTCACTGGCTTGGAGGAAAACCAACATGTAAAGCCATTGAGTGCCTGAAACCCAAGGAGATTTTGAATGGCAAATTCTCTTACACGGACCTACACTATGGACAGACCGTTACCTACTCTTGCAACCGAGGCTTTCGGCTCGAAGGTCCCAGTGCCTTGACCTGTTTAGAGACAGGTGATTGGGATGTAGATGCCCCATCTTGCAATGCCATCCACTGTGATTCCCCACAACCCATTGAAAATGGTTTTGTAGAAGGTGCAGATTACAGCTATGGTGCCATAATCATCTACAGTTGCTTCCCTGGGTTTCAGGTGGCTGGTCATGCCATGCAGACCTGTGAAGAGTCAGGATGGTCAAGTTCCATCCCAACATGTATGCCAATAGACTGTGGCCTCCCTCCTCATATAGATTTTGGAGACTGTACTAAACTCAAAGATGACCAGGGATATTTTGAGCAAGAAGACGACATGATGGAAGTTCCATATGTGACTCCTCACCCTCCTTATCATTTGGGAGCAGTGGCTAAAACCTGGGAAAATACAAAGGAGTCTCCTGCTACACATTCATCAAACTTTCTGTATGGTACCATGGTTTCATACACCTGTAATCCAGGATATGAACTTCTGGGGAACCCTGTGCTGATCTGCCAGGAAGATGGAACTTGGAATGGCAGTGCACCATCCTGCATTTCAATTGAATGTGACTTGCCTACTGCTCCTGAAAATGGCTTTTTGCGTTTTACAGAGACTAGCATGGGAAGTGCTGTGCAGTATAGCTGTAAACCTGGACACATTCTAGCAGGCTCTGACTTAAGGCTTTGTCTAGAGAATAGAAAGTGGAGTGGTGCCTCCCCACGCTGTGAAGCCATTTCATGCAAAAAGCCAAATCCAGTCATGAATGGATCCATCAAAGGAAGCAACTACACATACCTGAGCACGTTGTACTATGAGTGTGACCCCGGATATGTGCTGAATGGCACTGAGAGGAGAACATGCCAGGATGACAAAAACTGGGATGAGGATGAGCCCATTTGCATTCCTGTGGACTGCAGTTCACCCCCAGTCTCAGCCAATGGCCAGGTGAGAGGAGACGAGTACACATTCCAAAAAGAGATTGAATACACTTGCAATGAAGGGTTCTTGCTTGAGGGAGCCAGGAGTCGGGTTTGTCTTGCCAATGGAAGTTGGAGTGGAGCCACTCCCGACTGTGTGCCTGTCAGATGTGCCACCCCGCCACAACTGGCCAATGGGGTGACGGAAGGCCTGGACTATGGCTTCATGAAGGAAGTAACATTCCACTGTCACGAGGGCTACATCTTGCACGGTGCTCCAAAACTCACCTGTCAGTCAGATGGCAACTGGGATGCAGAGATTCCTCTCTGTAAACCAGTCAACTGTGGACCTCCTGAAGATCTTGCCCATGGTTTCCCTAATGGTTTTTCCTTTATTCATGGGGGCCATATACAGTATCAGTGCTTTCCTGGTTATAAGCTCCATGGAAATTCATCAAGAAGGTGCCTCTCCAATGGCTCCTGGAGTGGCAGCTCACCTTCCTGCCTGCCTTGCAGATGTTCCACACCAGTAATTGAATATGGAACTGTCAATGGGACAGATTTTGACTGTGGAAAGGCAGCCCGGATTCAGTGCTTCAAAGGCTTCAAGCTCCTAGGACTTTCTGAAATCACCTGTGAAGCCGATGGCCAGTGGAGCTCTGGGTTCCCCCACTGTGAACACACTTCTTGTGGTTCTCTTCCAATGATACCAAATGCGTTCATCAGTGAGACCAGCTCTTGGAAGGAAAATGTGATAACTTACAGCTGCAGGTCTGGATATGTCATACAAGGCAGTTCAGATCTGATTTGTACAGAGAAAGGGGTATGGAGCCAGCCTTATCCAGTCTGTGAGCCCTTGTCCTGTGGGTCCCCACCGTCTGTCGCCAATGCAGTGGCAACTGGAGAGGCACACACCTATGAAAGTGAAGTGAAACTCAGATGTCTGGAAGGTTATACGATGGATACAGATACAGATACATTCACCTGTCAGAAAGATGGTCGCTGGTTCCCTGAGAGAATCTCCTGCAGTCCTAAAAAATGTCCTCTCCCGGAAAACATAACACATATACTTGTACATGGGGACGATTTCAGTGTGAATAGGCAAGTTTCTGTGTCATGTGCAGAAGGGTATACCTTTGAGGGAGTTAACATATCAGTATGTCAGCTTGATGGAACCTGGGAGCCACCATTCTCCGATGAATCTTGCAGTCCAGTTTCTTGTGGGAAACCTGAAAGTCCAGAACATGGATTTGTGGTTGGCAGTAAATACACCTTTGAAAGCACAATTATTTATCAGTGTGAGCCTGGCTATGAACTAGAGGGGAACAGGGAACGTGTCTGCCAGGAGAACAGACAGTGGAGTGGAGGGGTGGCAATATGCAAAGAGACCAGGTGTGAAACTCCACTTGAATTTCTCAATGGGAAAGCTGACATTGAAAACAGGACGACTGGACCCAACGTGGTATATTCCTGCAACAGAGGCTACAGTCTTGAAGGGCCATCTGAGGCACACTGCACAGAAAATGGAACCTGGAGCCACCCAGTCCCTCTCTGCAAACCAAATCCATGCCCTGTTCCTTTTGTGATTCCCGAGAATGCTCTGCTGTCTGAAAAGGAGTTTTATGTTGATCAGAATGTGTCCATCAAATGTAGGGAAGGTTTTCTGCTGCAGGGCCACGGCATCATTACCTGCAACCCCGACGAGACGTGGACACAGACAAGCGCCAAATGTGAAAAAATCTCATGTGGTCCACCAGCTCACGTAGAAAATGCAATTGCTCGAGGCGTACATTATCAATATGGAGACATGATCACCTACTCATGTTACAGTGGATACATGTTGGAGGGTTTCCTGAGGAGTGTTTGTTTAGAAAATGGAACATGGACATCACCTCCTATTTGCAGAGCTGTCTGTCGATTTCCATGTCAGAATGGGGGCATCTGCCAACGCCCAAATGCTTGTTCCTGTCCAGAGGGCTGGATGGGGCGCCTCTGTGAAGAACCAATCTGCATTCTTCCCTGTCTGAACGGAGGTCGCTGTGTGGCCCCTTACCAGTGTGACTGCCCGCCTGGCTGGACGGGGTCTCGCTGTCATACAGCTGTTTGCCAGTCTCCCTGCTTAAATGGTGGAAAATGTGTAAGACCAAACCGATGTCACTGTCTTTCTTCTTGGACGGGACATAACTGTTCCAGGAAAAGGAGGACTGGGTTTTAA-3'
NCBI CDS gene sequence with introns (location: 110366539.. 110579543) (213005 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 110365248.. 110579741) (214494 bp)Download
NCBI gene sequence (location: [110365248.. 110579741 + 1000]) (215494 bp)Download
Cite How to cite