NCBI Summary
This gene encodes a member of the pentraxin protein family. The expression of this protein is induced by inflammatory cytokines in response to inflammatory stimuli in several mesenchymal and epithelial cell types, particularly endothelial cells and mononuclear phagocytes. The protein promotes fibrocyte differentiation and is involved in regulating inflammation and complement activation. It also plays a role in angiogenesis and tissue remodeling. The protein serves as a biomarker for several inflammatory conditions. [provided by RefSeq, Jun 2016].
Protein
Protein (NP_002843)
Pentraxin 3
Pentraxin-related protein PTX3 (Pentaxin-related protein PTX3) (Tumor necrosis factor alpha-induced protein 5) (TNF alpha-induced protein 5) (Tumor necrosis factor-inducible gene 14 protein) (TSG-14)
PTX3
pentraxin 3
Undefined
Very low evidence
Pentraxin
L-Type Lectins
b-sandwich / ConA-like
Heparin
0.381
Undefined
Protein sequence and protein families (fasta) (381 amino acids) Download
MHLLAILFCALWSAVLAENSDDYDLMYVNLDNEIDNGLHPTEDPTPCACGQEHSEWDKLFIMLENSQMRERMLLQATDDVLRGELQRLREELGRLAESLARPCAPGAPAEARLTSALDELLQATRDAGRRLARMEGAEAQRPEEAGRALAAVLEELRQTRADLHAVQGWAARSWLPAGCETAILFPMRSKKIFGSVHPVRPMRLESFSACIWVKATDVLNKTILFSYGTKRNPYEIQLYLSYQSIVFVVGGEENKLVAEAMVSLGRWTHLCGTWNSEEGLTSLWVNGELAATTVEMATGHIVPEGGILQIGQEKNGCCVGGGFDETLAFSGRLTGFNIWDSVLSNEEIRETGGAESCHIRGNIVGWGVTEIQPHGGAQYVS
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Pentraxin 3 secreted by human adipose-derived stem cells promotes dopaminergic neuron repair in Parkinson's disease via the inhibition of apoptosis. [34152016]
  • The Assessment of Pentraxin 3: A Novel Biomarker in Early Detection of Infection in Newborns. [34307663]
  • Correlation between single nucleotide polymorphisms in the 3 primer untranslated region of PTX3 and the risk of essential hypertension: A case-control study. [34128842]
  • PTX3 Effects on Osteogenic Differentiation in Osteoporosis: An In Vitro Study. [34073015]
  • Pentraxin 3: a powerful orchestrator in urinary tract infection. [34055573]
  • Inducible expression of PTX3, a new member of the pentraxin family, in human mononuclear phagocytes. [7949102]
  • Relationship of TSG-14 protein to the pentraxin family of major acute phase proteins. [7523502]
  • TSG-14, a tumor necrosis factor- and IL-1-inducible protein, is a novel member of the pentaxin family of acute phase proteins. [7679696]
  • Interleukin-1-inducible genes in endothelial cells. Cloning of a new gene related to C-reactive protein and serum amyloid P component. [1429570]
  • A novel secretory tumor necrosis factor-inducible protein (TSG-6) is a member of the family of hyaluronate binding proteins, closely related to the adhesion receptor CD44. [1730767]
UniProt Main References (6 PubMed Identifiers)
  • IL-1 inducible genes in human umbilical vein endothelial cells. [8131794]
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The DNA sequence, annotation and analysis of human chromosome 3. [16641997]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Pentraxin 3, a non-redundant soluble pattern recognition receptor involved in innate immunity. [12763682]
  • Structural characterization of PTX3 disulfide bond network and its multimeric status in cumulus matrix organization. [18223257]
RNA
RNA (Transcript ID: NM_002852.4)
pentraxin 3
m7G-5')ppp(5'-ACUCUCACUCUCCUCCGCUCAAACUCAGCUCACUUGAGAGUCUCCUCCCGCCAGCUGUGGAAAGAACUUUGCGUCUCUCCAGCAAUGCAUCUCCUUGCGAUUCUGUUUUGUGCUCUCUGGUCUGCAGUGUUGGCCGAGAACUCGGAUGAUUAUGAUCUCAUGUAUGUGAAUUUGGACAACGAAAUAGACAAUGGACUCCAUCCCACUGAGGACCCCACGCCGUGCGCCUGCGGUCAGGAGCACUCGGAAUGGGACAAGCUCUUCAUCAUGCUGGAGAACUCGCAGAUGAGAGAGCGCAUGCUGCUGCAAGCCACGGACGACGUCCUGCGGGGCGAGCUGCAGAGGCUGCGGGAGGAGCUGGGCCGGCUCGCGGAAAGCCUGGCGAGGCCGUGCGCGCCGGGGGCUCCCGCAGAGGCCAGGCUGACCAGUGCUCUGGACGAGCUGCUGCAGGCGACCCGCGACGCGGGCCGCAGGCUGGCGCGUAUGGAGGGCGCGGAGGCGCAGCGCCCAGAGGAGGCGGGGCGCGCCCUGGCCGCGGUGCUAGAGGAGCUGCGGCAGACGCGAGCCGACCUGCACGCGGUGCAGGGCUGGGCUGCCCGGAGCUGGCUGCCGGCAGGUUGUGAAACAGCUAUUUUAUUCCCAAUGCGUUCCAAGAAGAUUUUUGGAAGCGUGCAUCCAGUGAGACCAAUGAGGCUUGAGUCUUUUAGUGCCUGCAUUUGGGUCAAAGCCACAGAUGUAUUAAACAAAACCAUCCUGUUUUCCUAUGGCACAAAGAGGAAUCCAUAUGAAAUCCAGCUGUAUCUCAGCUACCAAUCCAUAGUGUUUGUGGUGGGUGGAGAGGAGAACAAACUGGUUGCUGAAGCCAUGGUUUCCCUGGGAAGGUGGACCCACCUGUGCGGCACCUGGAAUUCAGAGGAAGGGCUCACAUCCUUGUGGGUAAAUGGUGAACUGGCGGCUACCACUGUUGAGAUGGCCACAGGUCACAUUGUUCCUGAGGGAGGAAUCCUGCAGAUUGGCCAAGAAAAGAAUGGCUGCUGUGUGGGUGGUGGCUUUGAUGAAACAUUAGCCUUCUCUGGGAGACUCACAGGCUUCAAUAUCUGGGAUAGUGUUCUUAGCAAUGAAGAGAUAAGAGAGACCGGAGGAGCAGAGUCUUGUCACAUCCGGGGGAAUAUUGUUGGGUGGGGAGUCACAGAGAUCCAGCCACAUGGAGGAGCUCAGUAUGUUUCAUAAAUGUUGUGAAACUCCACUUGAAGCCAAAGAAAGAAACUCACACUUAAAACACAUGCCAGUUGGGAAGGUCUGAAAACUCAGUGCAUAAUAGGAACACUUGAGACUAAUGAAAGAGAGAGUUGAGACCAAUCUUUAUUUGUACUGGCCAAAUACUGAAUAAACAGUUGAAGGAAAGACAUUGGAAAAAGCUUUUGAGGAUAAUGUUACUAGACUUUAUGCCAUGGUGCUUUCAGUUUAAUGCUGUGUCUCUGUCAGAUAAACUCUCAAAUAAUUAAAAAGGACUGUAUUGUUGAACAGAGGGACAAUUGUUUUACUUUUCUUUGGUUAAUUUUGUUUUGGCCAGAGAUGAAUUUUACAUUGGAAGAAUAACAAAAUAAGAUUUGUUGUCCAUUGUUCAUUGUUAUUGGUAUGUACCUUAUUACAAAAAAAAGAUGAAAACAUAUUUAUACUACAAGGUGACUUAACAACUAUAAAUGUAGUUUAUGUGUUAUAAUCGAAUGUCACGUUUUUGAGAAGAUAGUCAUAUAAGUUAUAUUGCAAAAGGGAUUUGUAUUAAUUUAAGACUAUUUUUGUAAAGCUCUACUGUAAAUAAAAUAUUUUAUAAAACUAGCUCACGUCAUUUAAUUAUAAAUUUAAGAGAUGUUUUGGAGCAAA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 5806)
pentraxin 3
strand +
TSG-14
NCBI CDS gene sequence (1146 bp)
5'-ATGCATCTCCTTGCGATTCTGTTTTGTGCTCTCTGGTCTGCAGTGTTGGCCGAGAACTCGGATGATTATGATCTCATGTATGTGAATTTGGACAACGAAATAGACAATGGACTCCATCCCACTGAGGACCCCACGCCGTGCGCCTGCGGTCAGGAGCACTCGGAATGGGACAAGCTCTTCATCATGCTGGAGAACTCGCAGATGAGAGAGCGCATGCTGCTGCAAGCCACGGACGACGTCCTGCGGGGCGAGCTGCAGAGGCTGCGGGAGGAGCTGGGCCGGCTCGCGGAAAGCCTGGCGAGGCCGTGCGCGCCGGGGGCTCCCGCAGAGGCCAGGCTGACCAGTGCTCTGGACGAGCTGCTGCAGGCGACCCGCGACGCGGGCCGCAGGCTGGCGCGTATGGAGGGCGCGGAGGCGCAGCGCCCAGAGGAGGCGGGGCGCGCCCTGGCCGCGGTGCTAGAGGAGCTGCGGCAGACGCGAGCCGACCTGCACGCGGTGCAGGGCTGGGCTGCCCGGAGCTGGCTGCCGGCAGGTTGTGAAACAGCTATTTTATTCCCAATGCGTTCCAAGAAGATTTTTGGAAGCGTGCATCCAGTGAGACCAATGAGGCTTGAGTCTTTTAGTGCCTGCATTTGGGTCAAAGCCACAGATGTATTAAACAAAACCATCCTGTTTTCCTATGGCACAAAGAGGAATCCATATGAAATCCAGCTGTATCTCAGCTACCAATCCATAGTGTTTGTGGTGGGTGGAGAGGAGAACAAACTGGTTGCTGAAGCCATGGTTTCCCTGGGAAGGTGGACCCACCTGTGCGGCACCTGGAATTCAGAGGAAGGGCTCACATCCTTGTGGGTAAATGGTGAACTGGCGGCTACCACTGTTGAGATGGCCACAGGTCACATTGTTCCTGAGGGAGGAATCCTGCAGATTGGCCAAGAAAAGAATGGCTGCTGTGTGGGTGGTGGCTTTGATGAAACATTAGCCTTCTCTGGGAGACTCACAGGCTTCAATATCTGGGATAGTGTTCTTAGCAATGAAGAGATAAGAGAGACCGGAGGAGCAGAGTCTTGTCACATCCGGGGGAATATTGTTGGGTGGGGAGTCACAGAGATCCAGCCACATGGAGGAGCTCAGTATGTTTCATAA-3'
NCBI CDS gene sequence with introns (location: 157436934.. 157442979) (6046 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 157436850.. 157443633) (6784 bp)Download
NCBI gene sequence (location: [157436850 - 1000].. 157443633) (7784 bp)Download
Cite How to cite