NCBI Summary
NPTX1 is a member of the neuronal pentraxin gene family. Neuronal pentraxin 1 is similar to the rat NP1 gene which encodes a binding protein for the snake venom toxin taipoxin. Human NPTX1 mRNA is exclusively localized to the nervous system. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_002513)
Neuronal pentraxin 1
Neuronal pentraxin-1 (NP1) (Neuronal pentraxin I) (NP-I)
NPTX1
neuronal pentraxin 1
Undefined
Very low evidence
Pentraxin
L-Type Lectins
b-sandwich / ConA-like
Uncharacterised
0.407
Undefined
Protein sequence and protein families (fasta) (432 amino acids) Download
MPAGRAARTCALLALCLLGAGAQDFGPTRFICTSVPVDADMCAASVAAGGAEELRSSVLQLRETVLQQKETILSQKETIRELTAKLGRCESQSTLDPGAGEARAGGGRKQPGSGKNTMGDLSRTPAAETLSQLGQTLQSLKTRLENLEQYSRLNSSSQTNSLKDLLQSKIDELERQVLSRVNTLEEGKGGPRNDTEERVKIETALTSLHQRISELEKGQKDNRPGDKFQLTFPLRTNYMYAKVKKSLPEMYAFTVCMWLKSSATPGVGTPFSYAVPGQANELVLIEWGNNPMEILINDKVAKLPFVINDGKWHHICVTWTTRDGVWEAYQDGTQGGSGENLAPYHPIKPQGVLVLGQEQDTLGGGFDATQAFVGELAHFNIWDRKLTPGEVYNLATCSTKALSGNVIAWAESHIEIYGGATKWTFEACRQIN
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Downregulation of NPTX1 induces cell cycle progression through Wnt/beta-catenin signaling in breast cancer. [34212686]
  • Long non coding RNA SLC26A4-AS1 exerts antiangiogenic effects in human glioma by upregulating NPTX1 via NFKB1 transcriptional factor. [32255252]
  • MiR-4295 facilitates cell proliferation and metastasis in head and neck squamous cell carcinoma by targeting NPTX1. [31118494]
  • As a downstream target of the AKT pathway, NPTX1 inhibits proliferation and promotes apoptosis in hepatocellular carcinoma. [31113871]
  • Neuronal pentraxin 1: A synaptic-derived plasma biomarker in Alzheimer's disease. [29501530]
  • NPTX1 regulates neural lineage specification from human pluripotent stem cells. [24529709]
  • Neuronal pentraxin 1 contributes to the neuronal damage evoked by amyloid-beta and is overexpressed in dystrophic neurites in Alzheimer's brain. [17151277]
  • Specific sensitivity of small cell lung cancer cell lines to the snake venom toxin taipoxin. [16115696]
  • Biochemical interactions of the neuronal pentraxins. Neuronal pentraxin (NP) receptor binds to taipoxin and taipoxin-associated calcium-binding protein 49 via NP1 and NP2. [10748068]
  • Mouse and human neuronal pentraxin 1 (NPTX1): conservation, genomic structure, and chromosomal localization. [8884281]
UniProt Main References (2 PubMed Identifiers)
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
RNA
RNA (Transcript ID: NM_002522.4)
neuronal pentraxin 1
m7G-5')ppp(5'-GGCAGUGGGGGCCUGAUAGCGCGGCGGUGUGGACCGCGCGGCCGAAGAGCGCGGCGCCCAGAGCGCGGGCCGCUCGCGGAGCCACAGCCCGAGCCGGGUCCCAGCCGGAGCCGAGCCCCAGCCGAGCCGAGCCGGGCCCGGAGCGCCCGGUGCCCGCAGCCAUGCCGGCCGGCCGCGCCGCGCGCACCUGUGCGCUGCUCGCCCUCUGCCUCCUGGGCGCCGGGGCCCAGGAUUUCGGGCCGACGCGCUUCAUCUGCACCUCGGUGCCCGUGGACGCCGACAUGUGCGCCGCGUCCGUGGCCGCCGGCGGCGCCGAGGAGCUCCGGAGCAGCGUGCUGCAGCUCCGCGAGACGGUGCUGCAGCAGAAGGAGACCAUCCUGAGCCAGAAGGAGACCAUCCGCGAGCUGACCGCCAAGCUGGGCCGCUGCGAGAGCCAGAGCACGCUGGACCCCGGAGCCGGCGAGGCCCGGGCGGGCGGCGGCCGCAAGCAGCCCGGCUCGGGCAAGAACACCAUGGGCGACCUGUCCCGGACACCGGCCGCCGAGACGCUCAGCCAACUCGGGCAAACUUUGCAAUCGCUCAAAACCCGCCUGGAGAACCUCGAGCAGUACAGCCGCCUCAAUUCCUCCAGCCAGACCAACAGCCUCAAGGAUCUGCUGCAGAGCAAGAUCGAUGAGCUGGAGAGGCAGGUGCUGUCCCGGGUGAACACCCUGGAGGAGGGCAAGGGGGGCCCCAGGAACGACACCGAGGAGAGGGUCAAGAUCGAGACCGCCCUGACCUCCCUGCACCAGCGGAUCAGCGAGCUCGAGAAAGGUCAGAAAGACAACCGCCCUGGAGACAAGUUCCAGCUCACAUUCCCACUGCGGACCAACUAUAUGUAUGCCAAGGUGAAGAAGAGCCUGCCAGAGAUGUACGCCUUCACUGUCUGCAUGUGGCUCAAGUCCAGCGCCACGCCAGGUGUGGGCACGCCCUUCUCCUACGCUGUGCCCGGCCAGGCCAACGAGCUGGUCCUCAUUGAGUGGGGCAACAACCCCAUGGAGAUCCUCAUCAAUGACAAGGUGGCCAAGUUGCCUUUUGUCAUCAAUGAUGGCAAGUGGCACCACAUCUGUGUCACCUGGACCACCCGGGACGGGGUCUGGGAGGCCUACCAGGAUGGCACGCAGGGUGGCAGUGGCGAGAACUUGGCGCCCUAUCACCCCAUCAAGCCCCAGGGCGUGCUGGUGCUGGGCCAGGAGCAGGACACUCUGGGUGGUGGGUUUGAUGCCACCCAGGCAUUUGUGGGUGAGCUGGCCCACUUCAACAUCUGGGACCGCAAGCUGACCCCCGGGGAGGUGUACAACCUGGCCACCUGCAGCACCAAGGCUCUGUCCGGCAAUGUCAUCGCCUGGGCUGAAUCCCACAUCGAGAUCUACGGAGGGGCCACCAAGUGGACCUUCGAGGCCUGUCGCCAGAUCAACUGAGCACGGCAGGCCAGGCUGAGCCCGCCCGCCCUCGCCCCCUGCUUGUGCGGCGAUGAUCUGUUUUGUGCGUCUCUUCUCUCCCUUUUCCCCAGGAAUGAACCGAGGCCGUCGCCCCUGCACACGCACACGCACACAGCCUGGUUUUGUCCUCAUGCACACGAAGCAGCCCCUGCUCCCAUCUGUCCCUGAGGAAGCCCCACUUCUCUGUAGGAGCCCGGACUCUCUCAGGCAUGCCCCAUUCACAGCUGAAGUGGGUGCUGCAACGUCUUGAACAAGGCAGAAGUUGGUGAGAGGAUCUGUGUGUGCGUGUCUACAUGUGUGUGUCUACGUGUGUGCGUGCGUGGCUGGGGGAGGCCUUUUCUUUGAGGACGUACCUCAUUUCCUUCUUUCUUCUGGCUUUGGAAAAAUCUCAUGAUGAAAAUUCAUAUUUGCCAACUUUGUUAGCUGCGUGCGUGCUUUGGGGUUGGUGCAACCUCAGUACACGCAUUUGUCUUUGUUUGCAAACCUUUCUCAGAGCGACAUAUCUUUAUAUUGAUGUAAUAAAUGUCUUUUAGUGGUUUGUCAAAGGCCGGGGGCGGGGGCUCUCUACAGAGAAUUUUUAUUUUGUAAUAGAAGUGAACUGUCUCUGAAGGGUGAAGGCAGGCCGUCCUGGGAUGGUACCCUGUGCUCUCCCGUGGAGGAGAGGGGAUGGCUGAGGACACUGGCCCUUACCCCAGGGCCAGACAGCAUCCAUCCCUGCUGUUUGCAUCUGAGAGCAGCAUGGGGCCUGGGAGGUCGGCCUGUGUGCCCAGCUCAGCUAGCUCUGCCCCAGGACGGCCCUGCCCUCGACCUUCCCACCUCCUCAGAUCCUGCAAGGCUGGGGUCUGCCCCUCCCUUCUCACCUCUGGAGCUGUGCUGCACUGCUUCAGCCCAGAGGGCCCUGAGAGAGGAGCGUGCCACCCACAGCCCGGGAAGCCGGGCCCCAGCACCCCUCUCCUUUGGCCUCCGGCAGUGCAGACCAGAGGGGACCUUUUAAGGAAAGAAGCCGUGUUUCGAUGAAGACCUGGCCACAUGGGGCCACUGGGACUUCAACCCAGCCCAUCGGUGGGAAGGUCCUUUUUGGGGGACUUUGACAGCCAUAUCCCUCCCAGCACACCAGGCGCCAGGUGAGCUGGUUCAGACCCCUCCAGGGGUACUCCAGAGACCUCACGUGUGGAGCCAGGCCUGGCCAGGGCAGGGGCCUGAAACCCACUCCUCCAUCUCAUGGGGCUCACGGCCUACAGCAGCCCACAAGCUGCCACUGGCCGGCGACACUGACACCUGAGCAGUGUCCAGAACCUUUUUGCCUUUUUUUGUUCCCCGUGAAAAGCAACAUGGACAUUUCCUUCUAGUCCUUCCAAGGAGGGGAGAGAAGUGUAUGUGCAUUUGUGUGUGUGUGUGUGUGUUGUGUGUGUGUGUGCGCUAAGUGAGAAAGAGAGCAGGCUCGGGAGGCCCUGCCCAGGGUAGGAGGAGCUUCCUGCUUUGCACCAUCUGGUGGUCGCACGCCCUGAGGGCACCCCGACUCUGUCUCCAGGAGUCUCAUCAGCAAACCGCUGACAAGUCUUUCUAGAAAUUCUACUGCACUGCCUGGCUCAGCUGCAGCUGCAGACAUUUCUGCAGGAGGAGCAGGUGUUUCUGUCUUCUGUUCCUUCUAGGGCCACCUGUCCCCUUAAACACAGGUCCACGUUGUGUCAAGAACCUAGUGCAUCUGUGUGUGUCUGUCAGUGUCUCUGUGUCAGUGUUCUCGUGGGUGUCUGCACGGUACCCGGCCGCCGUUCUGCAAUGCAUCACUCCCGCAGAGGGGGGUGCAGAUCAGGCGCCGUGCUGCGCGUUGUUGUUCAACAGUGGCUUUUUCUUAGAUAAUCGUGCUUCCUCAGCGCCCGUCGGGUUGUGGCAUCCUUGGAUCUGCAGGGAUCUUCUCCGUUUGCAUGUUCCUCGGGGUGGCGUGUUCCUUGCUCCCUGGGUCCGACAUGUGUUCCCGCACCUGCAUGGACUGCCCCGGUUCUGUGUUGUGUGCCGAGUGCCGCCCAGUGUUCUGUGACCACCCGUGUAGCUACUGAAAAUGGCUGGGUAAGCAAGUCAAGGGUGUUGGAGGAGGUCAAGAGAGAGCUCAGUUUCCCUCUCCCCCUCCCCAAACACACCAAGAAGCAUUUUUAACGUGUAGGUUGAGAACAAGCCUAAAGGAUUCCCACAGCUGGGAGCCAGCAAGAGAGCUUGGAGUCGCCUCUCUAGACCAGAUCUAGCCCCACCCUCACUCCAGCCAUCUCGGAGCCCUUGUGUAGGCAACGCCCGGUGCGGGCUGUGUGGGGUGCUCCCCUGCCAGCACCUCCGGCCAGCCCCGCCCCUGCCGAUCUACUGGACCGCAGACCACCUUCUGCCCCCGUGGGCCAGGUGGGAGCUGUCCGUUCAGGACCAUGAGCCAUCCUCUGCCCUGACUAGCGAGGGGCAGAGCACACCCCAGUGCUUACGCCUCCACCCCUGCAGCCUCCUGGCCCGCUCACCUUCCUCACCCCUCCUCUGACCCACCCAUGGUGCCAGGGCCGAAGCUGACCUUUAGCUCCCUCCUGCCCCUUGCUAGGGUCUGAGCCAAGCCCCUCGACUCCCUCACUGUGUUGACACUUGGCACUUUGCUGGCCCCGAGAAAGGUCGAUGACACAGCCGCAAAUCUAAUCCACGUAGUUCCCAUUUACUCCUUAAUCUGAUUGAUGUUCCCUCUUGCACUGAAUAAUACAUGCCUCUCUCAGGUAAGCCAUUUUAUAAAACAAGAAGAUAAAAAGCACUGUUGAGGCAGUGUUUGCUUUUGCCGAGCUGGUGUCCGACAGCUCCCUGGGUGUCCGGGGUGGGAGAGCUGUUGACAGAAGCUCUCCGGGCCCUCAGGGGCUUAGAUCCCACUUGAGUCGUAAGCCUUCUUGCUUUUGAUAACACAGUAUUAUUUCUCUUACUGUAGAAGAAAAAGUUUAUUACCAAACAAGAGUAUUUUUAUGAAAGAAAAGGACAAACCUAUAAAUUAACUCAACCUAUAUCUCCCUUGAAAAUACUUUCAGGCUCCACCAAAACGUAGAACUGAAAGCAUGUAUUUUGGAAGAAAGAGAUACAUUUUGUAUGCUUUCUUUUCCUUUUGUAGAUUCCCAGUUUAUUUUCUAAGACUGCAAAGAUCACUUUGUCACCAGCCCUGGGACCUGAGACCAAGGGGGUGUCUUGUGGGCAGUGAGGGGGUGAGGAGAGGCUGGCAUGAGGUUCAGUCAUUCCAGUGAGCUCCAAAGAGGGGCCACCUGUUCUCAAAAGCAUGUUGGGGACCAGGAGGUAAAACUGGCCAUUUAUGGUGAACCUGUGUCUUGGAGCUGACUUACUAAGUGGAAUGAGCCGAGGAUUUGAAUAUCAGUUCUAACCUUGAUAGAAGAACCUUGGGUUACAUGUGGUUCACAUUAAGAGGAUAGAAUCCUUUGGAAUCUUAUGGCAACCAAAUGUGGCUUGACGAAGUCGUGGUUUCAUCUCUUAAACACAGUGUGUAAAUUUAUUCAACUAACGAUGGGAAAUGUAUUACUUCUGUACACAGUGGACUGAAGUGCAAUUUGUUGAAAGGGAACAAGUCAUUGAAGAGAAAAAAAAAGCCCAAUACUUAGAGUCCCAAUUUUGUCUCAUUUGCCAAAAAAAAAAAAAAAAAAAAAGCAAACCCCCUAUGGUUGAUAUUGUUAUAAUGUAUAUACUGUAUAAUAUGAAAGAGAAUCGAUGUAUCUCACUUUUUCAUUAUUUGCUAACCAAAGCUGUACAUUUUUCAUAUGAUCUGCAGCCUUUUGGGUAUCAAAUGGGUCAAAACCAUGGGACCUGCCACCUCCCAUCAGCAAUUCUGGAAAUGCACUAUUUCUACUGGUAUUCUUGCUUUUUUUUUUUUUUUCAUUUUCUUGCUGAAAUGACAUGAAUUGUUGAGUUUAUUUUUACACAGUAAAGAGUGGAGAAAGAC-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 4884)
neuronal pentraxin 1
strand -
NCBI CDS gene sequence (1299 bp)
5'-ATGCCGGCCGGCCGCGCCGCGCGCACCTGTGCGCTGCTCGCCCTCTGCCTCCTGGGCGCCGGGGCCCAGGATTTCGGGCCGACGCGCTTCATCTGCACCTCGGTGCCCGTGGACGCCGACATGTGCGCCGCGTCCGTGGCCGCCGGCGGCGCCGAGGAGCTCCGGAGCAGCGTGCTGCAGCTCCGCGAGACGGTGCTGCAGCAGAAGGAGACCATCCTGAGCCAGAAGGAGACCATCCGCGAGCTGACCGCCAAGCTGGGCCGCTGCGAGAGCCAGAGCACGCTGGACCCCGGAGCCGGCGAGGCCCGGGCGGGCGGCGGCCGCAAGCAGCCCGGCTCGGGCAAGAACACCATGGGCGACCTGTCCCGGACACCGGCCGCCGAGACGCTCAGCCAACTCGGGCAAACTTTGCAATCGCTCAAAACCCGCCTGGAGAACCTCGAGCAGTACAGCCGCCTCAATTCCTCCAGCCAGACCAACAGCCTCAAGGATCTGCTGCAGAGCAAGATCGATGAGCTGGAGAGGCAGGTGCTGTCCCGGGTGAACACCCTGGAGGAGGGCAAGGGGGGCCCCAGGAACGACACCGAGGAGAGGGTCAAGATCGAGACCGCCCTGACCTCCCTGCACCAGCGGATCAGCGAGCTCGAGAAAGGTCAGAAAGACAACCGCCCTGGAGACAAGTTCCAGCTCACATTCCCACTGCGGACCAACTATATGTATGCCAAGGTGAAGAAGAGCCTGCCAGAGATGTACGCCTTCACTGTCTGCATGTGGCTCAAGTCCAGCGCCACGCCAGGTGTGGGCACGCCCTTCTCCTACGCTGTGCCCGGCCAGGCCAACGAGCTGGTCCTCATTGAGTGGGGCAACAACCCCATGGAGATCCTCATCAATGACAAGGTGGCCAAGTTGCCTTTTGTCATCAATGATGGCAAGTGGCACCACATCTGTGTCACCTGGACCACCCGGGACGGGGTCTGGGAGGCCTACCAGGATGGCACGCAGGGTGGCAGTGGCGAGAACTTGGCGCCCTATCACCCCATCAAGCCCCAGGGCGTGCTGGTGCTGGGCCAGGAGCAGGACACTCTGGGTGGTGGGTTTGATGCCACCCAGGCATTTGTGGGTGAGCTGGCCCACTTCAACATCTGGGACCGCAAGCTGACCCCCGGGGAGGTGTACAACCTGGCCACCTGCAGCACCAAGGCTCTGTCCGGCAATGTCATCGCCTGGGCTGAATCCCACATCGAGATCTACGGAGGGGCCACCAAGTGGACCTTCGAGGCCTGTCGCCAGATCAACTGA-3'
NCBI CDS gene sequence with introns (location: 80470813.. 80476446) (5634 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 80466834.. 80476607) (9774 bp)Download
NCBI gene sequence (location: [80466834.. 80476607 + 1000]) (10774 bp)Download
Cite How to cite