NCBI Summary
The protein encoded by this gene belongs to the pentraxin family which also includes serum amyloid P component protein and pentraxin 3. Pentraxins are involved in complement activation and amplification via communication with complement initiation pattern recognition molecules, but also complement regulation via recruitment of complement regulators. The encoded protein has a calcium dependent ligand binding domain with a distinctive flattened beta-jellyroll structure. It exists in two forms as either a pentamer in circulation or as a nonsoluble monomer in tissues. It is involved in several host defense related functions based on its ability to recognize foreign pathogens and damaged cells of the host and to initiate their elimination by interacting with humoral and cellular effector systems in the blood. Consequently, the level of this protein in plasma increases greatly during acute phase response to tissue injury, infection, or other inflammatory stimuli. Elevated expression of the encoded protein is associated with severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) infection. [provided by RefSeq, Aug 2020].
Protein
Protein (NP_001315986)
C-reactive protein
C-reactive protein [Cleaved into: C-reactive protein(1-205)]
CRP
C-reactive protein
Undefined
Curated
Pentraxin
L-Type Lectins
b-sandwich / ConA-like
Gal / bGal containing oligosaccharides
Undefined
0.807
MEKLLCFLVLTSLSHAFGQTDMSRKAFVFPKESDTSYVSLKAPLTKPLKAFTVCLHFYTELSSTRGYSIFSYATKRQDNEILIFWSKDIGYSFTVGGSEILFEVPEVTVAPVHICTSWESASGIVEFWVDGKPRVRKSLKKGYTVGAEASIILGQEQDSFGGNFEGSQSLVGDIGNVNMWDFVLSPDEINTIYLGGPFSPNVLNWRALKYEVQGEVFTKPQLWP
Mol* PDB structure viewerUniLectin3D
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
- Investigation of C-reactive protein and AIM2 methylation as a marker for PTSD in Australian Vietnam veterans. [34391864]
- The natural trends of C-reactive protein after hip arthroplasty for femoral neck fracture without infection. [34559143]
- C-Reactive Protein Is an Independent Predictor of 30-Day Bacterial Infection Post-Liver Transplantation. [34439862]
- Pentraxins in Complement Activation and Regulation. [30619374]
- Pentraxins and Fc Receptor-Mediated Immune Responses. [30483265]
- The Pentraxins 1975-2018: Serendipity, Diagnostics and Drugs. [30459761]
- C-Reactive Protein in Atherothrombosis and Angiogenesis. [29552019]
- Primary structure of human C-reactive protein. [762075]
- Partial amino-acid sequences of human and rabbit C-reactive proteins: homology with immunoglobulins and histocompatibility antigens. [403526]
- Characterization of C-reactive protein and the complement subcomponent C1t as homologous proteins displaying cyclic pentameric symmetry (pentraxins). [265538]
UniProt Main References (11 PubMed Identifiers)
- Genomic DNA sequence for human C-reactive protein. [2997165]
- Characterization of genomic and complementary DNA sequence of human C-reactive protein, and comparison with the complementary DNA sequence of serum amyloid P component. [3840479]
- Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
- The DNA sequence and biological annotation of human chromosome 1. [16710414]
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
- Biosynthesis and postsynthetic processing of human C-reactive protein. [6685157]
- Isolation of human C-reactive protein complementary DNA and localization of the gene to chromosome 1. [6857266]
- Secreted M-ficolin anchors onto monocyte transmembrane G protein-coupled receptor 43 and cross talks with plasma C-reactive protein to mediate immune signaling and regulate host defense. [21037097]
- Comparative analyses of pentraxins: implications for protomer assembly and ligand binding. [7881902]
- Three dimensional structure of human C-reactive protein. [8599761] Show more
All isoforms of this gene containing a lectin domain
RNA
RNA (Transcript ID: NM_001329057.2)
C-reactive protein, transcript variant 1
m7G-5')ppp(5'-AAGGCAAGAGAUCUAGGACUUCUAGCCCCUGAACUUUCAGCCGAAUACAUCUUUUCCAAAGGAGUGAAUUCAGGCCCUUGUAUCACUGGCAGCAGGACGUGACCAUGGAGAAGCUGUUGUGUUUCUUGGUCUUGACCAGCCUCUCUCAUGCUUUUGGCCAGACAGACAUGUCGAGGAAGGCUUUUGUGUUUCCCAAAGAGUCGGAUACUUCCUAUGUAUCCCUCAAAGCACCGUUAACGAAGCCUCUCAAAGCCUUCACUGUGUGCCUCCACUUCUACACGGAACUGUCCUCGACCCGUGGGUACAGUAUUUUCUCGUAUGCCACCAAGAGACAAGACAAUGAGAUUCUCAUAUUUUGGUCUAAGGAUAUAGGAUACAGUUUUACAGUGGGUGGGUCUGAAAUAUUAUUCGAGGUUCCUGAAGUCACAGUAGCUCCAGUACACAUUUGUACAAGCUGGGAGUCCGCCUCAGGGAUCGUGGAGUUCUGGGUAGAUGGGAAGCCCAGGGUGAGGAAGAGUCUGAAGAAGGGAUACACUGUGGGGGCAGAAGCAAGCAUCAUCUUGGGGCAGGAGCAGGAUUCCUUCGGUGGGAACUUUGAAGGAAGCCAGUCCCUGGUGGGAGACAUUGGAAAUGUGAACAUGUGGGACUUUGUGCUGUCACCAGAUGAGAUUAACACCAUCUAUCUUGGCGGGCCCUUCAGUCCUAAUGUCCUGAACUGGCGGGCACUGAAGUAUGAAGUGCAAGGCGAAGUGUUCACCAAACCCCAGCUGUGGCCCUGAGGCCCAGCUGUGGGUCCUGAAGUGCUUUCUUAAUUUUAUGGCUCUUCUGGGAAACUCCUCCCCUUUUCCACACGAACCUUGUGGGGCUGUGAAUUCUUUCUUCAUCCCCGCAUUCCCAAUAUACCCAGGCCACAAGAGUGGACGUGAACCACAGGGUGUCCUGUCAGAGGAGCCCAUCUCCCAUCUCCCCAGCUCCCUAUCUGGAGGAUAGUUGGAUAGUUACGUGUUCCUAGCAGGACCAACUACAGUCUUCCCAAGGAUUGAGUUAUGGACUUUGGGAGUGAGACAUCUUCUUGCUGCUGGAUUUCCAAGCUGAGAGGACGUGAACCUGGGACCACCAGUAGCCAUCUUGUUUGCCACAUGGAGAGAGACUGUGAGGACAGAAGCCAAACUGGAAGUGGAGGAGCCAAGGGAUUGACAAACAACAGAGCCUUGACCACGUGGAGUCUCUGAAUCAGCCUUGUCUGGAACCAGAUCUACACCUGGACUGCCCAGGUCUAUAAGCCAAUAAAGCCCCUGUUUACUUGA-3'- Poly-A tail
- Coding region
DNA
DNA (Gene ID: 1401)
C-reactive protein
strand -
NCBI CDS gene sequence (675 bp)
5'-ATGGAGAAGCTGTTGTGTTTCTTGGTCTTGACCAGCCTCTCTCATGCTTTTGGCCAGACAGACATGTCGAGGAAGGCTTTTGTGTTTCCCAAAGAGTCGGATACTTCCTATGTATCCCTCAAAGCACCGTTAACGAAGCCTCTCAAAGCCTTCACTGTGTGCCTCCACTTCTACACGGAACTGTCCTCGACCCGTGGGTACAGTATTTTCTCGTATGCCACCAAGAGACAAGACAATGAGATTCTCATATTTTGGTCTAAGGATATAGGATACAGTTTTACAGTGGGTGGGTCTGAAATATTATTCGAGGTTCCTGAAGTCACAGTAGCTCCAGTACACATTTGTACAAGCTGGGAGTCCGCCTCAGGGATCGTGGAGTTCTGGGTAGATGGGAAGCCCAGGGTGAGGAAGAGTCTGAAGAAGGGATACACTGTGGGGGCAGAAGCAAGCATCATCTTGGGGCAGGAGCAGGATTCCTTCGGTGGGAACTTTGAAGGAAGCCAGTCCCTGGTGGGAGACATTGGAAATGTGAACATGTGGGACTTTGTGCTGTCACCAGATGAGATTAACACCATCTATCTTGGCGGGCCCTTCAGTCCTAATGTCCTGAACTGGCGGGCACTGAAGTATGAAGTGCAAGGCGAAGTGTTCACCAAACCCCAGCTGTGGCCCTGA-3'
By using this site you agree to our privacy policy.
Please confirm you agree with the privacy policy before using the site.