HumanLectome - Human Lectin Entry

NCBI Summary

This gene is specifically expressed in Schwann cells of the peripheral nervous system and encodes a type I transmembrane glycoprotein that is a major structural protein of the peripheral myelin sheath. The encoded protein contains a large hydrophobic extracellular domain and a smaller basic intracellular domain, which are essential for the formation and stabilization of the multilamellar structure of the compact myelin. Mutations in this gene are associated with autosomal dominant form of Charcot-Marie-Tooth disease type 1 (CMT1B) and other polyneuropathies, such as Dejerine-Sottas syndrome (DSS) and congenital hypomyelinating neuropathy (CHN). A recent study showed that two isoforms are produced from the same mRNA by use of alternative in-frame translation termination codons via a stop codon readthrough mechanism. [provided by RefSeq, Oct 2015].

Protein name

Myelin protein zero

Synonym(s)

Myelin protein P0 (Myelin peripheral protein) (MPP) (Myelin protein zero)

HGNC gene name

MPZ

HGNC name

myelin protein zero

Protein_CD_name

Undefined

Lectin confidence

Very low evidence

UniLectin class

I-type lectin

Known lectin group

I-Type Lectins

Lectin fold

b-sandwich / Ig-like

Glycan specificity

Uncharacterised

RefSeq accession

Gene ID

UniProt accession

Ensembl protein ID

UniRef cluster ID

LectomeXplore score

Undefined

Reference

Undefined

Either no PDB or existing PDB of non-glycosylated form

Structural models

AlphaFold v2: AF-P25189-F1 Download

Model Confidence:

Very high (pLDDT > 90)
Confident (90 > pLDDT > 70)
Low (70 > pLDDT > 50)
Very low (pLDDT < 50)

AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.

SWISS-MODEL structural models

SWISS-MODEL structural model

Modeller structural model (Homology modelling pipeline), Error: [1.64, 2.15] Å Download

The location of the lectin domain structural model is: 30-160
We infer [1.64, 2.15] Å as the interval of error of this structural model.
Template 1: 5LFR chain: A, P20917, NP_001333015.1, sequence identity: 18.3%, coverage: 100.0%, location in sequence: 19-331, (19-331 in PDB).
Template 2: 1QFO chain: A, Q62230, NP_035556.3, sequence identity: 22.1%, coverage: 84.0%, location in sequence: 20-137, (1-118 in PDB).
Template 3: 2ZG1 chain: A, O15389, NP_003821.1, sequence identity: 21.4%, coverage: 81.7%, location in sequence: 20-141, (25-146 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.

Expression

Human Protein Atlas

GeneCards

mRNA expression in normal human tissues for MPZ Gene

ProteomicsDB

References

NCBI References (11 PubMed Identifiers)

Phylogenetically Conserved Sequences Around Myelin P0 Stop Codon are Essential for Translational Readthrough to Produce L-MPZ. [29081003]

L-MPZ, a novel isoform of myelin P0, is produced by stop codon readthrough. [22457349]

Cytoplasmic domain of human myelin protein zero likely folded as beta-structure in compact myelin. [17142269]

Peripheral neuropathies caused by mutations in the myelin protein zero. [16414078]

Misreading of termination codons in eukaryotes by natural nonsense suppressor tRNAs. [11726686]

The major peripheral myelin protein zero gene: structure and localization in the cluster of Fc gamma receptor genes on human chromosome 1q21.3-q23. [7509228]

Structure and chromosomal localization of the gene encoding the human myelin protein zero (MPZ). [7503936]

Charcot-Marie-Tooth Hereditary Neuropathy Overview [20301532]

Charcot-Marie-Tooth Neuropathy Type 2 [20301462]

Charcot-Marie-Tooth Neuropathy Type 1 [20301384]

UniProt Main References (68 PubMed Identifiers)

Mutation of the myelin P0 gene in Charcot-Marie-tooth neuropathy type 1. [7688964]

Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]

The DNA sequence and biological annotation of human chromosome 1. [16710414]

The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]

Deletion of the serine 34 codon from the major peripheral myelin protein P0 gene in Charcot-Marie-Tooth disease type 1B. [7693130]

Linkage and mutation analysis in an extended family with Charcot-Marie-Tooth disease type 1B. [7530774]

Molecular genetics of Charcot-Marie-Tooth neuropathy. [7762451]

Charcot-Marie-Tooth disease: a new paradigm for the mechanism of inherited disease. [7518101]

Mutations in the peripheral myelin genes and associated genes in inherited peripheral neuropathies. [9888385]

Crystal structure of the extracellular domain of human myelin protein zero. [21971831]

New mutation of the myelin P0 gene in a pedigree of Charcot-Marie-Tooth neuropathy 1. [7505151]

Charcot-Marie-Tooth neuropathy type 1B is associated with mutations of the myelin P0 gene. [7693129]

Myelin protein zero gene mutated in Charcot-Marie-tooth type 1B patients. [7504284]

De novo mutation of the myelin P0 gene in Dejerine-Sottas disease (hereditary motor and sensory neuropathy type III). [7506095]

Rapid screening of myelin genes in CMT1 patients by SSCP analysis: identification of new mutations and polymorphisms in the P0 gene. [7527371]

Charcot-Marie-Tooth type 1B neuropathy: third mutation of serine 63 codon in the major peripheral myelin glycoprotein PO gene. [8835320]

Mutations in the myelin protein zero gene associated with Charcot-Marie-Tooth disease type 1B. [7550231]

A novel homozygous mutation of the myelin Po gene producing Dejerine-Sottas disease (hereditary motor and sensory neuropathy type III). [8630052]

Myelin protein zero (MPZ) gene mutations in nonduplication type 1 Charcot-Marie-Tooth disease. [8664899]

Charcot-Marie-Tooth type 1B neuropathy: a mutation at the single glycosylation site in the major peripheral myelin glycoprotein Po. [8844219]

Two divergent types of nerve pathology in patients with different P0 mutations in Charcot-Marie-Tooth disease. [8797476]

Clinical phenotypes of different MPZ (P0) mutations may include Charcot-Marie-Tooth type 1B, Dejerine-Sottas, and congenital hypomyelination. [8816708]

Novel mutation of the myelin Po gene in a pedigree with Charcot-Marie-Tooth disease type 1B. [9217235]

Mutational analysis of the MPZ, PMP22 and Cx32 genes in patients of Spanish ancestry with Charcot-Marie-Tooth disease and hereditary neuropathy with liability to pressure palsies. [9187667]

Novel mutation of the myelin P0 gene in a CMT1B family. [8990016]

Multiple de novo MPZ (P0) point mutations in a sporadic Dejerine-Sottas case. [9222756]

De novo mutation of the myelin Po gene in Dejerine-Sottas disease (hereditary motor and sensory neuropathy type III): two amino acid insertion after Asp 118. [9452055]

Mutations of the same sequence of the myelin P0 gene causing two different phenotypes. [9452091]

Mutation analysis in Charcot-Marie-Tooth disease type 1 (CMT1). [9452099]

Spectrum of mutations in Finnish patients with Charcot-Marie-Tooth disease and related neuropathies. [9633821]

Charcot-Marie-Tooth disease type 2 associated with mutation of the myelin protein zero gene. [9595994]

Congenital hypomyelination due to myelin protein zero Q215X mutation. [10319895]

The Roussy-Levy family: from the original description to the gene. [10553995]

The Thr124Met mutation in the peripheral myelin protein zero (MPZ) gene is associated with a clinically distinct Charcot-Marie-Tooth phenotype. [10071056]

Axonal phenotype of Charcot-Marie-Tooth disease associated with a mutation in the myelin protein zero gene. [10329755]

Novel mutation in the myelin protein zero gene in a family with intermediate hereditary motor and sensory neuropathy. [10406984]

A novel MPZ gene mutation in dominantly inherited neuropathy with focally folded myelin sheaths. [10214757]

Peripheral myelin modification in CMT1B correlates with MPZ gene mutations. [10545037]

Focally folded myelin in Charcot-Marie-Tooth neuropathy type 1B with Ser49Leu in the myelin protein zero. [10965800]

Charcot-Marie-Tooth neuropathy type 2 and P0 point mutations: two novel amino acid substitutions (Asp61Gly. Tyr119Cys) and a possible 'hotspot' on Thr124Met. [10764043]

Screening for mutations in the peripheral myelin genes PMP22, MPZ and Cx32 (GJB1) in Russian Charcot-Marie-Tooth neuropathy patients. [10737979]

Mutations in the peripheral myelin protein zero and connexin32 genes detected by non-isotopic RNase cleavage assay and their phenotypes in Japanese patients with Charcot-Marie-Tooth disease. [10923043]

An axonal form of Charcot-Marie-Tooth disease showing distinctive features in association with mutations in the peripheral myelin protein zero gene (Thr124Met or Asp75Val). [11080237]

Charcot-Marie-Tooth disease type I and related demyelinating neuropathies: Mutation analysis in a large cohort of Italian families. [11438991]

Mutation analysis in Chariot-Marie Tooth disease type 1: point mutations in the MPZ gene and the GJB1 gene cause comparable phenotypic heterogeneity. [11437164]

The range of chronic demyelinating neuropathy of infancy: a clinico-pathological and genetic study of 15 unrelated cases. [11596785]

A somatic and germline mosaic mutation in MPZ/P(0) mimics recessive inheritance of CMT1B. [11445635]

Charcot-Marie-Tooth disease and related neuropathies: mutation distribution and genotype-phenotype correlation. [11835375]

Molecular analysis in Japanese patients with Charcot-Marie-Tooth disease: DGGE analysis for PMP22, MPZ, and Cx32/GJB1 mutations. [12402337]

Corticosteroid- responsive asymmetric neuropathy with a myelin protein zero gene mutation. [12221176]

Two amino-acid substitutions in the myelin protein zero gene of a case of Charcot-Marie-Tooth disease associated with light-near dissociation. [11801400]

Charcot-Marie-Tooth neuropathy: clinical phenotypes of four novel mutations in the MPZ and Cx 32 genes. [12207932]

Demyelinating and axonal features of Charcot-Marie-Tooth disease with mutations of myelin-related proteins (PMP22, MPZ and Cx32): a clinicopathological study of 205 Japanese patients. [12477701]

Novel mutations in the Charcot-Marie-Tooth disease genes PMP22, MPZ, and GJB1. [12497641]

Clinical and genetic analysis of CMT1B in a Nigerian family. [12707985]

Charcot-Marie-Tooth disease: a novel Tyr145Ser mutation in the myelin protein zero (MPZ, P0) gene causes different phenotypes in homozygous and heterozygous carriers within one family. [12845552]

Late onset Charcot-Marie-Tooth 2 syndrome caused by two novel mutations in the MPZ gene. [14638973]

Phenotypic clustering in MPZ mutations. [14711881]

An axonal form of Charcot-Marie-Tooth disease with a novel missense mutation in the myelin protein zero gene. [14871447]

Mutational analysis of PMP22, MPZ, GJB1, EGR2 and NEFL in Korean Charcot-Marie-Tooth neuropathy patients. [15241803]

A novel MPZ gene mutation in congenital neuropathy with hypomyelination. [15184631]

Hearing loss as the first feature of late-onset axonal CMT disease due to a novel P0 mutation. [15326256]

Gene dosage sensitivity of a novel mutation in the intracellular domain of P0 associated with Charcot-Marie-Tooth disease type 1B. [16488608]

Different cellular and molecular mechanisms for early and late-onset myelin protein zero mutations. [18337304]

Chronic cough due to Thr124Met mutation in the peripheral myelin protein zero (MPZ gene). [15159512]

A novel mutation, Thr65Ala, in the MPZ gene in a patient with Charcot-Marie-Tooth type 1B disease with focally folded myelin. [15036333]

Case records of the Massachusetts General Hospital. Case 18-2006. A 57-year-old woman with numbness and weakness of the feet and legs. [16775239]

All isoforms of this gene containing a lectin domain

XP_016856810.1, NP_000521.2, NP_001302420.1

RNA

RNA (Transcript ID: NM_000530.8)

RNA RefSeq ID

NM_000530.8

RNA name

myelin protein zero, transcript variant 1

Isoforms

All isoforms of MPZ containing a lectin domain

RNA Ensembl ID

ENST00000533357.5

Coding region

64..810 (or 161305876.. 161309905)

mRNA location

161304735.. 161309968

NCBI Matured mRNA sequence 1951 NTP Download

m⁷G-5')ppp(5'-AGUUCCUGGUCCCCCACUUUCUCAACCCCACAGAUGCUCCGGGCCCCUGCCCCUGCCCCAGCUAUGGCUCCUGGGGCUCCCUCAUCCAGCCCCAGCCCUAUCCUGGCUGUGCUGCUCUUCUCUUCUUUGGUGCUGUCCCCGGCCCAGGCCAUCGUGGUUUACACCGACAGGGAGGUCCAUGGUGCUGUGGGCUCCCGGGUGACCCUGCACUGCUCCUUCUGGUCCAGUGAGUGGGUCUCAGAUGACAUCUCCUUCACCUGGCGCUACCAGCCCGAAGGGGGCAGAGAUGCCAUUUCGAUCUUCCACUAUGCCAAGGGACAACCCUACAUUGACGAGGUGGGGACCUUCAAAGAGCGCAUCCAGUGGGUAGGGGACCCUCGCUGGAAGGAUGGCUCCAUUGUCAUACACAACCUAGACUACAGUGACAAUGGCACGUUCACUUGUGACGUCAAAAACCCUCCAGACAUAGUGGGCAAGACCUCUCAGGUCACGCUGUAUGUCUUUGAAAAAGUGCCAACUAGGUACGGGGUCGUUCUGGGAGCUGUGAUCGGGGGUGUCCUCGGGGUGGUGCUGUUGCUGCUGCUGCUUUUCUACGUGGUUCGGUACUGCUGGCUACGCAGGCAGGCGGCCCUGCAGAGGAGGCUCAGUGCUAUGGAGAAGGGGAAAUUGCACAAGCCAGGAAAGGACGCGUCGAAGCGCGGGCGGCAGACGCCAGUGCUGUAUGCAAUGCUGGACCACAGCAGAAGCACCAAAGCUGUCAGUGAGAAGAAGGCCAAGGGGCUGGGGGAGUCUCGCAAGGAUAAGAAAUAGCGGUUAGCGGGCCGGGCGGGGGAUCGGGGGUUAGGGGUGGAGUCCGCCAAAGGCCCAAAGGUGAUGGUCAUCGAGAUGGAGCUACGAAAGGAUGAGCAGAGCCCGGAGCUCCGGCCUGCUGUCAAGUCCCCCAGCAGAACCAGCCUCAAAAACGCCCUCAAGAACAUGAUGGGCCUGAACUCGGACAAGUGAUCGCCACCCCCCCACCCCAGGCCCUGCCAGAGCAGGGGGACCUAGGCUCCUCUUACCCCCGUCUAGGUGCUUUCCCUCUUUGCUCCCCCGCCCUGCCCUGCCCUCACCUCCCUUUGAGAUGUAAGUUUCAUUCCAGAAUUCAUUCCCCAGGCAAUUGUAUUCUCCCCCACCUUCACCCCUGGCUUUCUGGGAGCCCAGGAGCUAAUCCUACCCCUCACCUGCCCCGGGGGCUGUGUGUUUGGUGCCUGUCCACCUGAGCACUGAGAAGAAAGGGACUUUGAUACCCUCUGCCUCAAGUCCAGGCCACCUGGCAUUCCCAUCUCCUGCAUCCCCCAGCCUGUCCCCCUGGCUGUUUCCUCUCCCGUCCCUCCCUCCCCUCUACCAGGUGGCCCAGCUCCAUACUCUGUCCCCCCAGCUAAUACCCAGAGCACCCAGAUCAGACUCUCCUUCAGGGUUUAUUUAGGUUAUUAUUUUUUAUUUUUUAAUCCAUUCUUUGUUUGUUUACCUGUGCUCAUCCUCUGCCCUUACACCCAUGACUGAGGACCAAUGACGUCAUGUGGCUUUUGCAAUUCACGCCCCCCUUAAGUCCUUAAUGAAGAGCCAGCCCAAGUAGAGGGGCCCCUGAUCCUCACACUUCAGUAUAGCAUUGGUUCCCCCUGACCACUUUGGAGCACUGUUCUGGGACUCCAGGUCUUGAGGAGAGAGACAGAGAGAGAGAAUGGAUCCUCAUAGGUCAGGGAGUGGGGGAGGGGGCAAAUGAGCCUUAAGAAAUGGUUUUUAAACAACCAAACAAAAAGCAGGAAAAACAAAUGGGAAAUGGGGGGGCGGGGGGGAGGAAGAGGCUGCACUGCAGCCACAGGGGAUUCUUAGGAUUUUUCUACAUUCUGUAUAUUUCUUCUCAAACCUCCAAAUGUCCUUAAAUGUUUAAUAAACACUGACAUUUCCAGAA-3'- Poly-A tail

Coding region

NCBI Matured mRNA sequence viewer

;

More about the NCBI sViewer.

DNA

DNA (Gene ID: 4359)

HGNC Gene symbol

MPZ

HGNC Gene name

myelin protein zero

Chr. RefSeq ID

NC_000001.11

Chromosome N°

1 161305876.. 161309905

CDS location

161305876.. 161309905

DNA strand

strand -

CCDS ID

CCDS1229.2

Mouse ortholog gene

MGI:103177

Gene Variant

ClinVar, dbVar

DNA Ensembl ID

ENSG00000158887

HGNC other symbol

HMSNIB, CMT2I, CMT2J, P0

UCSC ID

uc001gaf.4

GeneBank

INSDC: BC006491

GeneCards

7225

MIM

159440

VEGA ID

OTTHUMG00000034341

Either no PDB or existing PDB of non-glycosylated form

How to cite: