Protein
Protein (XP_035717074)
C-type lectin domain family 20 member A
Putative C-type lectin domain family 20 member A
CLEC20A
C-type lectin domain containing 20A
Undefined
Very low evidence
C-type lectin
Undefined
Undefined
a/b mixed / C-type lectin-like
Uncharacterised
Undefined
0.151
Undefined
Protein sequence and protein families (fasta) (414 amino acids) Download
MDLFRILQAASPAPHTLLAATDTGPRQLRGLVPCPASTQPSPSQCPAMLPRALLLSFCAAALQLVSSKRDLVLVKEALSWYDAQQHCRLHYTDLADLQPSGLWKLYSLMTSTPAWIGLFFDASTSGLRWSSGSTFTALEWGQKLPEFGVGFCATLYTWLKLPSIGAASCTAQKPFLCYCDPDVGHLISTKPSLSLTTSPKPAVVQISGQTFMRFDQVMTWSSALLYCRSHHTDLADLQMVTDETGKEALRSIMSETEAWIGLYLNANSGSLSWSSDLGASIPSWLQVPMMVRGLCTALGIYMTYSPKVYSVNCSSLLPFFCFYAVASVGSGTDRRDTAAATEAQHLSSESKEKTSAQKSGHPFGILKADFTISTLMDPEEMKDQFLRQIQEVLKLTLGHEQFRLKWVSFEVNKK
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [ err > 2 Å]Download
The location of the lectin domain structural model is: 159-275
We infer [ err > 2 Å] as the interval of error of this structural model.
Template 1: 6BBD chain: A, Q9N1X4, NP_999275.1, sequence identity: 15.4%, coverage: 83.8%, location in sequence: 225-378, (205-358 in PDB).
Template 2: 3WHD chain: C, Q8WXI8, NP_525126.2, sequence identity: 12.8%, coverage: 81.2%, location in sequence: 63-215, (63-215 in PDB).
Template 3: 6JJJ chain: A, P70194, NP_058031.2, sequence identity: 15.4%, coverage: 72.6%, location in sequence: 393-543, (393-543 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
UniProt Main References (2 PubMed Identifiers)
  • The DNA sequence and biological annotation of human chromosome 1. [16710414]
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
RNA
RNA (Transcript ID: XM_035861181.1)
C-type lectin domain containing 20A, transcript variant X1
m7G-5')ppp(5'-GAGGAAAAAGGAGGCCAGUCCAAAUCCCAAAGCUGAAGAACUCGGAGUCCGAUGUUCAAGGGCAGGAAGCAUCGAGCACGGGAGAACGAUGGAUCUCUUCCGCAUCCUCCAGGCCGCAUCUCCAGCACCUCACACCCUGCUGGCAGCGACAGACACUGGUCCCCGCCAGCUCCGGGGUCUUGUCCCGUGCCCAGCCAGCACCCAGCCAUCGCCCAGCCAGUGCCCAGCCAUGCUGCCCCGGGCGCUGCUGCUCUCCUUCUGCGCAGCAGCCCUGCAGCUGGUGAGCAGUAAGAGGGACUUGGUUCUGGUGAAGGAGGCGCUGAGCUGGUACGACGCCCAGCAGCACUGCCGGCUGCACUACACAGACCUCGCUGACCUGCAGCCAAGUGGCCUGUGGAAGCUCUACUCCCUCAUGACCAGCACCCCGGCUUGGAUUGGCCUCUUCUUCGACGCAAGCACUUCUGGCCUGAGAUGGUCCAGCGGCUCCACCUUCACAGCCCUGGAGUGGGGCCAGAAGCUACCUGAAUUUGGGGUGGGCUUCUGUGCCACGCUGUACACUUGGCUGAAAUUACCCAGCAUAGGGGCUGCCUCCUGCACAGCCCAGAAGCCCUUCCUCUGCUACUGUGACCCUGACGUCGGGCACCUCAUCUCCACGAAGCCCUCUCUCAGCCUGACCACCUCUCCAAAGCCAGCUGUGGUCCAGAUCAGUGGUCAGACCUUCAUGCGAUUUGACCAAGUGAUGACAUGGUCCUCGGCCCUGCUGUACUGCCGCAGCCACCACACGGAUCUGGCCGACCUGCAGAUGGUGACGGAUGAGACAGGCAAGGAGGCCUUGAGAUCCAUCAUGAGUGAGACUGAAGCCUGGAUUGGCCUCUACCUCAAUGCAAACUCCGGAUCUCUGAGCUGGUCCAGUGACCUGGGGGCCAGCAUCCCCUCCUGGCUGCAGGUGCCGAUGAUGGUGAGAGGACUGUGCACAGCUCUUGGCAUCUAUAUGACCUACUCCCCAAAAGUGUACUCAGUGAACUGCUCUUCCCUGCUGCCCUUCUUCUGCUUCUAUGCUGUGGCCAGUGUAGGGAGUGGCACUGAUAGAAGAGAUACAGCUGCUGCCACGGAGGCCCAACAUCUGAGUUCAGAAUCUAAAGAAAAAACAUCAGCACAAAAAUCAGGGCACCCUUUUGGAAUCUUGAAAGCAGACUUUACCAUCUCAACUCUGAUGGACCCAGAAGAGAUGAAAGACCAAUUUCUGAGACAGAUCCAGGAAGUCUUAAAGCUUACAUUAGGUCACGAACAAUUUAGACUGAAAUGGGUCAGCUUCGAAGUGAACAAAAAAUAGCACAAUUCUUGGAUAUGCAGUUUCUGUUUCAUGCAAUCUUCUCUGGAUUUUGAGUAAAUUUUAAUUUUUUAAUCCCUAGUAGAACAAGAUUAGGAAGAACUCGACAUGUGCCAAAAAGCACAGACCUACAACUAACACAAAACAAGACUACACAUGAAACCUGCAUCCCUGGAUUUUACAGAAUGAAACAGGGAUGCAGGAGAAGAUGGGUGUAUUUGGGAACAAUCAUGUUGGGAAUGACAAAUGAACUUCUAUUAAGAAAUUAAAAUAAAAAACCUGAACCAAACAUCAAAAAUCCUGAAAACAAACCCCAUUAAUCUAACUGGAAAAUUACAAGAGGAUGGUAGUGGUCUAGGAAGCUAAGUGGGGCUACAUUUCCUAAUAAACCAGAUGAAACUUUCUUUACCUGUCACAAGUUAUUAAAGAGAUUUCAAAUUCUGCAGAAUUCGAAAGUAACAGUUUUAUCACAAUACAUGCUAAUGCUAGUUAUUUUUCCUAAAUUGAAAUCUUAUUACAUGGAAGUUGGGAAAUUCUAGGACAGACUGUUCUUAAUGUUAAAAUAUAUUUUUAGAAGAAUAUUCCGGCAUACAUUUCCUUUCUUGUUUCUCUUCAAGUGUCCUAGUCACCCAGGUGCAUGCUAGAAGACAGCAAUAUGUCAAAUAUAGUAGCAACUUUAGUCUGAAAUGUUUAAAGUUAAAGUUUAUUUGUAUUCUUUGUAGGAAUAUCAAUAAAAGACCUCAAACGUAUCUAUAUCUGUACAUGUACAAGAACUGUCAAAAAUUAUUCACAGAACAAAAAUAAAUCUUCUUUAGAACAAACCCAGGUAAUGAAAUGCUGAUACGGAUCUCACAUACGGAAUAAUCUAAAUGCUACUAGCACAAAAAUAUGGCUUUAAAAAUAAAAUAAAAUCUUGGGUUUUGUUUUUCUAAGGUGUAUUUCUCUUUCUUGAAAUAAAAAAUAAAUUAUUUAGAGCUAUCAUUGUAAAAUAGUCGUGUGUUAACACACUCUUAUUAAGGCCCUGGAGAUGAAAAACAAAAUCAAAUUUAGAAGGUCAUUUCCUCACAGGUGUAACUCAGGUUAAUGUGCUGCUGUCUGCUUAAGUUAAUAUAACUAGGAAAUGUCUAAGCACCAGUCAAAAUUUAACCUAAUUUACUAUUUAACUUUCCUGAAGGUGGUCAUUGAGUCAAUUAGUAUUUAACCUUUUGUUGAACUGGGAAUUGAAAUGUUUCCCUCGAAAAUUUGGAAAUCACAUAAAAUGAUAUUUACACAUAAAUAUCUGUACCCCCACAAAGAUGAUGGAGGUCCCUAAAACACAACUUCUGUGGAAAUCUCUCUACAACAACAAAUAAAUCUGGUUUUAAGUCUCAAACUAAAAAAAAAAA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 400797)
C-type lectin domain containing 20A
strand -
FLJ44005, RP4-593C16.2
NCBI CDS gene sequence (1245 bp)
5'-ATGGATCTCTTCCGCATCCTCCAGGCCGCATCTCCAGCACCTCACACCCTGCTGGCAGCGACAGACACTGGTCCCCGCCAGCTCCGGGGTCTTGTCCCGTGCCCAGCCAGCACCCAGCCATCGCCCAGCCAGTGCCCAGCCATGCTGCCCCGGGCGCTGCTGCTCTCCTTCTGCGCAGCAGCCCTGCAGCTGGTGAGCAGTAAGAGGGACTTGGTTCTGGTGAAGGAGGCGCTGAGCTGGTACGACGCCCAGCAGCACTGCCGGCTGCACTACACAGACCTCGCTGACCTGCAGCCAAGTGGCCTGTGGAAGCTCTACTCCCTCATGACCAGCACCCCGGCTTGGATTGGCCTCTTCTTCGACGCAAGCACTTCTGGCCTGAGATGGTCCAGCGGCTCCACCTTCACAGCCCTGGAGTGGGGCCAGAAGCTACCTGAATTTGGGGTGGGCTTCTGTGCCACGCTGTACACTTGGCTGAAATTACCCAGCATAGGGGCTGCCTCCTGCACAGCCCAGAAGCCCTTCCTCTGCTACTGTGACCCTGACGTCGGGCACCTCATCTCCACGAAGCCCTCTCTCAGCCTGACCACCTCTCCAAAGCCAGCTGTGGTCCAGATCAGTGGTCAGACCTTCATGCGATTTGACCAAGTGATGACATGGTCCTCGGCCCTGCTGTACTGCCGCAGCCACCACACGGATCTGGCCGACCTGCAGATGGTGACGGATGAGACAGGCAAGGAGGCCTTGAGATCCATCATGAGTGAGACTGAAGCCTGGATTGGCCTCTACCTCAATGCAAACTCCGGATCTCTGAGCTGGTCCAGTGACCTGGGGGCCAGCATCCCCTCCTGGCTGCAGGTGCCGATGATGGTGAGAGGACTGTGCACAGCTCTTGGCATCTATATGACCTACTCCCCAAAAGTGTACTCAGTGAACTGCTCTTCCCTGCTGCCCTTCTTCTGCTTCTATGCTGTGGCCAGTGTAGGGAGTGGCACTGATAGAAGAGATACAGCTGCTGCCACGGAGGCCCAACATCTGAGTTCAGAATCTAAAGAAAAAACATCAGCACAAAAATCAGGGCACCCTTTTGGAATCTTGAAAGCAGACTTTACCATCTCAACTCTGATGGACCCAGAAGAGATGAAAGACCAATTTCTGAGACAGATCCAGGAAGTCTTAAAGCTTACATTAGGTCACGAACAATTTAGACTGAAATGGGTCAGCTTCGAAGTGAACAAAAAATAG-3'
NCBI CDS gene sequence with introns (location: 178479535.. 178499535) (20001 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 178478153.. 178499623) (21471 bp)Download
NCBI gene sequence (location: [178478153.. 178499623 + 1000]) (22471 bp)Download
Cite How to cite