Protein
Protein (XP_005270723)
Adhesion G protein-coupled receptor L2
Adhesion G protein-coupled receptor L2 (Calcium-independent alpha-latrotoxin receptor 2) (CIRL-2) (Latrophilin homolog 1) (Latrophilin-2) (Lectomedin-1)
ADGRL2
adhesion G protein-coupled receptor L2
Undefined
Very low evidence
L-rhamnose binding lectin
Undefined
b-sandwich / CUB-like
Uncharacterised
Undefined
0.634
Undefined
Protein sequence and protein families (fasta) (1459 amino acids) Download
MVSSGCRMRSLWFIIVISFLPNTEGFSRAALPFGLVRRELSCEGYSIDLRCPGSDVIMIESANYGRTDDKICDADPFQMENTDCYLPDAFKIMTQRCNNRTQCIVVTGSDVFPDPCPGTYKYLEVQYECVPYIFVCPGTLKAIVDSPCIYEAEQKAGAWCKDPLQAADKIYFMPWTPYRTDTLIEYASLEDFQNSRQTTTYKLPNRVDGTGFVVYDGAVFFNKERTRNIVKFDLRTRIKSGEAIINYANYHDTSPYRWGGKTDIDLAVDENGLWVIYATEQNNGMIVISQLNPYTLRFEATWETVYDKRAASNAFMICGVLYVVRSVYQDNESETGKNSIDYIYNTRLNRGEYVDVPFPNQYQYIAAVDYNPRDNQLYVWNNNFILRYSLEFGPPDPAQVPTTAVTITSSAELFKTIISTTSTTSQKGPMSTTVAGSQEGSKGTKPPPAVSTTKIPPITNIFPLPERFCEALDSKGIKWPQTQRGMMVERPCPKGTRGTASYLCMISTGTWNPKGPDLSNCTSHWVNQLAQKIRSGENAASLANELAKHTKGPVFAGDVSSSVRLMEQLVDILDAQLQELKPSEKDSAGRSYNKLQKREKTCRAYLKAIVDTVDNLLRPEALESWKHMNSSEQAHTATMLLDTLEEGAFVLADNLLEPTRVSMPTENIVLEVAVLSTEGQIQDFKFPLGIKGAGSSIQLSANTVKQNSRNGLAKLVFIIYRSLGQFLSTENATIKLGADFIGRNSTIAVNSHVISVSINKESSRVYLTDPVLFTLPHIDPDNYFNANCSFWNYSERTMMGYWSTQGCKLVDTNKTRTTCACSHLTNFAILMAHREIAYKDGVHELLLTVITWVGIVISLVCLAICIFTFCFFRGLQSDRNTIHKNLCINLFIAEFIFLIGIDKTKYAIACPIFAGLLHFFFLAAFAWMCLEGVQLYLMLVEVFESEYSRKKYYYVAGYLFPATVVGVSAAIDYKSYGTEKACWLHVDNYFIWSFIGPVTFIILLNIIFLVITLCKMVKHSNTLKPDSSRLENIKSWVLGAFALLCLLGLTWSFGLLFINEETIVMAYLFTIFNAFQGVFIFIFHCALQKKVRKEYGKCFRHSYCCGGLPTESPHSSVKASTTRTSARYSSGTQSRIRRMWNDTVRKQSESSFISGDINSTSTLNQGMTGNYLLTNPLLRPHGTNNPYNTLLAETVVCNAPSAPVFNSPGHSLNNARDTSAMDTLPLNGNFNNSYSLHKGDYNDSVQVVDCGLSLNDTAFEKMIISELVHNNLRGSSKTHNLELTLPVKPVIGGSSSEDDAIVADASSLMHSDNPGLELHHKELEAPLIPQRTHSLLYQPQKKVKSEGTDSYVSQLTAEAEDHLQSPNRDSLYTSMPNLRDSPYPESSPDMEEDLSPSRRSENEDIYYKSMPNLGAGHQLQMCYQISRGNSDGYIIPINKEGCIPEGDVREGQMQLVTSL
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [0.47, 0.87] ÅDownload
The location of the lectin domain structural model is: 40-132
We infer [0.47, 0.87] Å as the interval of error of this structural model.
Template: 2JX9 chain: A, Q80TR1, NP_851382.2, sequence identity: 87.1%, coverage: 100.0%, location in sequence: 29-134, (29-134 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
UniProt Main References (11 PubMed Identifiers)
  • Isolation and characterization of a human homologue of the latrophilin gene from a region of 1p31.1 implicated in breast cancer. [10030676]
  • Genomic structure and expression profile of LPHH1, a 7TM gene variably expressed in breast cancer cell lines. [10760572]
  • The DNA sequence and biological annotation of human chromosome 1. [16710414]
  • Prediction of the coding sequences of unidentified human genes. XI. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. [9872452]
  • Discovery of tissue-specific exons using comprehensive human exon microarrays. [17456239]
  • Glycoproteomics analysis of human liver tissue by combination of multiple enzyme digestion and hydrazide chemistry. [19159218]
  • Initial characterization of the human central proteome. [21269460]
  • System-wide temporal characterization of the proteome and phosphoproteome of human embryonic stem cell differentiation. [21406692]
  • An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. [24275569]
  • Exome sequencing reveals new causal mutations in children with epileptic encephalopathies. [23647072]
  • Show more
All isoforms of this gene containing a lectin domain
XP_006710548.1, XP_006710551.1, XP_006710552.1, XP_016856273.1, NP_001284635.1, NP_001337628.1, NP_001380283.1, XP_024310127.1, NP_001380282.1, XP_016856286.1, NP_001352938.1, NP_001284634.1, NP_001352937.1, XP_024310125.1, XP_024310126.1, NP_001352936.1, NP_001284633.1, NP_001352931.1, NP_001380280.1, NP_001380281.1, NP_036434.1, NP_001317574.1, NP_001380279.1, XP_024310123.1, XP_005270725.1, XP_016856278.1, XP_005270723.1, NP_001337627.1, NP_001352932.1, NP_001352933.1, NP_001380278.1, XP_016856275.1, XP_024310118.1, NP_001352934.1, NP_001352935.1
RNA
RNA (Transcript ID: XM_005270666.4)
adhesion G protein-coupled receptor L2, transcript variant X7
m7G-5')ppp(5'-AGGACUUCGCAUUCCCCCGUCUCUCUCUCUCUCCCUCUCGCUCCCUCUCACUCUCUCUCCGCUCACACACACGCAGAGGUGCUGGGGCGAAAUCGGGAGCUUACCAGAGAAUUCCUUGGGAUUGUUGGGGGGCAUCUCCCCUCCGCUGCUGUGUGUGGCGUGGCUCUUCCCGGCUACUCCUUGCUUCCCCGAGCCCGAGUCUGCGCCGCCAGCCUUCCUUGGGGCAGCGGCCACCGCUCAGCCCCGGCCGGGAGAUCCGAAAUGUGAGGAGGGGUCGCCGCCGCCUCCCGCCCCAGGCCGCAGGGUCGGCGCGAGGGAUGCUAUUCCGGCCGGGCGCUCGGGGGGCUGAGGGGCUUCGCCUGACAAACUGAGUUGGCCUCGCGCCCCCGGCGCCCUCCCGCCCGUCGCUUCGAAGGGACUCCCAAGUCUGCGCACCUCUGUCAGGCUUUUGCUUCCACCACCCCUUUCGCUCUGAUUCCCGAUUUUUUUUUCCUAAGGGAGCGUGCGGUCUGGGGGUGUGUGCGUGUGUGUGAAAGACCUCUCUCGAAGAGCGGCGUGUGGGAAACUGCGGGAAAAUGUUGACUUAACCCCAGGAGCCGCCCGGCGCUGGCUGCUCGGCUGGAGGCGGCGGCGGCCGAGCAGGAGGACGCGCCGAGCUGCGGCGCCGUGUCCGGCCGGGGAGCUGCGGCGCUGCCUCCCGCGCGGACUCGGCGGCCGAGGACCCGCUCGCGGCCGGCCUCGGCCCUCUCCGGCCGGGGUAGCCGCUGCCCUCCGCGCCUGUCCCCGCGCGGCCCCCACGCCAGACGGCCCUCCCUCGGGGCGCGCUCGCAGACGGAGAUAUGAAGAUCAAUGAUGCAGACUGAUGGUUUUGAUGAAGCUGGGCAUUUAUAACUAGAUUCAUUAAGGAAUACAAAGAAAAUACUUAAAGGGAUCAAUAAUGGUGUCUUCUGGUUGCAGAAUGCGAAGUCUGUGGUUUAUCAUUGUAAUCAGCUUCUUACCAAAUACAGAAGGUUUCAGCAGAGCAGCUUUACCAUUUGGGCUGGUGAGGCGAGAAUUAUCCUGUGAAGGUUAUUCUAUAGAUCUGCGAUGCCCGGGCAGUGAUGUCAUCAUGAUUGAGAGCGCUAACUAUGGUCGGACGGAUGACAAGAUUUGUGAUGCUGACCCAUUUCAGAUGGAGAAUACAGACUGCUACCUCCCCGAUGCCUUCAAAAUUAUGACUCAAAGGUGCAACAAUCGAACACAGUGUAUAGUAGUUACUGGGUCAGAUGUGUUUCCUGAUCCAUGUCCUGGAACAUACAAAUACCUUGAAGUCCAAUAUGAAUGUGUCCCUUACAUUUUUGUGUGUCCUGGGACCUUGAAAGCAAUUGUGGACUCACCAUGUAUAUAUGAAGCUGAACAAAAGGCGGGUGCUUGGUGCAAGGACCCUCUUCAGGCUGCAGAUAAAAUUUAUUUCAUGCCCUGGACUCCCUAUCGUACCGAUACUUUAAUAGAAUAUGCUUCUUUAGAAGAUUUCCAAAAUAGUCGCCAAACAACAACAUAUAAACUUCCAAAUCGAGUAGAUGGUACUGGAUUUGUGGUGUAUGAUGGUGCUGUCUUCUUUAACAAAGAAAGAACGAGGAAUAUUGUGAAAUUUGACUUGAGGACUAGAAUUAAGAGUGGCGAGGCCAUAAUUAACUAUGCCAACUACCAUGAUACCUCACCAUACAGAUGGGGAGGAAAGACUGAUAUCGACCUAGCAGUUGAUGAAAAUGGUUUAUGGGUCAUUUACGCCACUGAACAGAACAAUGGAAUGAUAGUUAUUAGCCAGCUGAAUCCAUACACUCUUCGAUUUGAAGCAACGUGGGAGACUGUAUACGACAAACGUGCCGCAUCAAAUGCUUUUAUGAUAUGCGGAGUCCUCUAUGUGGUUAGGUCAGUUUAUCAAGACAAUGAAAGUGAAACAGGCAAGAACUCAAUUGAUUACAUUUAUAAUACCCGAUUAAACCGAGGAGAAUAUGUAGAUGUUCCCUUCCCCAACCAGUAUCAGUAUAUUGCUGCAGUGGAUUACAAUCCAAGAGAUAACCAACUUUACGUGUGGAACAAUAACUUCAUUUUACGAUAUUCUCUGGAGUUUGGUCCACCUGAUCCUGCCCAAGUGCCUACCACAGCUGUGACAAUAACUUCUUCAGCUGAGCUGUUCAAAACCAUAAUAUCAACCACAAGCACUACUUCACAGAAAGGCCCCAUGAGCACAACUGUAGCUGGAUCACAGGAAGGAAGCAAAGGGACAAAACCACCUCCAGCAGUUUCUACAACCAAAAUUCCACCUAUAACAAAUAUUUUUCCCCUGCCAGAGAGAUUCUGUGAAGCAUUAGACUCCAAGGGGAUAAAGUGGCCUCAGACACAAAGGGGAAUGAUGGUUGAACGACCAUGCCCUAAGGGAACAAGAGGAACUGCCUCAUAUCUCUGCAUGAUUUCCACUGGAACAUGGAACCCUAAGGGCCCCGAUCUUAGCAACUGUACCUCACACUGGGUGAAUCAGCUGGCUCAGAAGAUCAGAAGCGGAGAAAAUGCUGCUAGUCUUGCCAAUGAACUGGCUAAACAUACCAAAGGGCCAGUGUUUGCUGGGGAUGUAAGUUCUUCAGUGAGAUUGAUGGAGCAGUUGGUGGACAUCCUUGAUGCACAGCUGCAGGAACUGAAACCUAGUGAAAAAGAUUCAGCUGGACGGAGUUAUAACAAGCUCCAAAAACGAGAGAAGACAUGCAGGGCUUACCUUAAGGCAAUUGUUGACACAGUGGACAACCUUCUGAGACCCGAAGCUUUGGAAUCAUGGAAACAUAUGAAUUCUUCUGAACAAGCACAUACUGCAACAAUGUUACUCGAUACAUUGGAAGAAGGAGCUUUUGUCCUAGCUGACAAUCUUUUAGAACCAACAAGGGUCUCAAUGCCCACAGAAAAUAUUGUCCUGGAAGUUGCCGUACUCAGUACAGAAGGACAGAUCCAAGACUUUAAAUUUCCUCUGGGCAUCAAAGGAGCAGGCAGCUCAAUCCAACUGUCCGCAAAUACCGUCAAACAGAACAGCAGGAAUGGGCUUGCAAAGUUGGUGUUCAUCAUUUACCGGAGCCUGGGACAGUUCCUUAGUACAGAAAAUGCAACCAUUAAACUGGGUGCUGAUUUUAUUGGUCGUAAUAGCACCAUUGCAGUGAACUCUCACGUCAUUUCAGUUUCAAUCAAUAAAGAGUCCAGCCGAGUAUACCUGACUGAUCCUGUGCUUUUUACCCUGCCACACAUUGAUCCUGACAAUUAUUUCAAUGCAAACUGCUCCUUCUGGAACUACUCAGAGAGAACUAUGAUGGGAUAUUGGUCUACCCAGGGCUGCAAGCUGGUUGACACUAAUAAAACUCGAACAACGUGUGCAUGCAGCCACCUAACCAAUUUUGCAAUUCUCAUGGCCCACAGGGAAAUUGCAUAUAAAGAUGGCGUUCAUGAAUUACUUCUUACAGUCAUCACCUGGGUGGGAAUUGUCAUUUCCCUUGUUUGCCUGGCUAUCUGCAUCUUCACCUUCUGCUUUUUCCGUGGCCUACAGAGUGACCGAAAUACUAUUCACAAGAACCUUUGUAUCAACCUUUUCAUUGCUGAAUUUAUUUUCCUAAUAGGCAUUGAUAAGACAAAAUAUGCGAUUGCAUGCCCAAUAUUUGCAGGACUUCUACACUUUUUCUUUUUGGCAGCUUUUGCUUGGAUGUGCCUAGAAGGUGUGCAGCUCUACCUAAUGUUAGUUGAAGUUUUUGAAAGUGAAUAUUCAAGGAAAAAAUAUUACUAUGUUGCUGGUUACUUGUUUCCUGCCACAGUGGUUGGAGUUUCAGCUGCUAUUGACUAUAAGAGCUAUGGAACAGAAAAAGCUUGCUGGCUUCAUGUUGAUAACUACUUUAUAUGGAGCUUCAUUGGACCUGUUACCUUCAUUAUUCUGCUAAAUAUUAUCUUCUUGGUGAUCACAUUGUGCAAAAUGGUGAAGCAUUCAAACACUUUGAAACCAGAUUCUAGCAGGUUGGAAAACAUUAAGUCUUGGGUGCUUGGCGCUUUCGCUCUUCUGUGUCUUCUUGGCCUCACCUGGUCCUUUGGGUUGCUUUUUAUUAAUGAGGAGACUAUUGUGAUGGCAUAUCUCUUCACUAUAUUUAAUGCUUUCCAGGGAGUGUUCAUUUUCAUCUUUCACUGUGCUCUCCAAAAGAAAGUACGAAAAGAAUAUGGCAAGUGCUUCAGACACUCAUACUGCUGUGGAGGCCUCCCAACUGAGAGUCCCCACAGUUCAGUGAAGGCAUCAACCACCAGAACCAGUGCUCGCUAUUCCUCUGGCACACAGAGUCGUAUAAGAAGAAUGUGGAAUGAUACUGUGAGAAAACAAUCAGAAUCUUCUUUUAUCUCAGGUGACAUCAAUAGCACUUCAACACUUAAUCAAGGAAUGACUGGCAAUUACCUACUAACAAACCCUCUUCUUCGACCCCACGGCACUAACAACCCCUAUAACACAUUGCUCGCUGAAACAGUUGUAUGUAAUGCCCCUUCAGCUCCUGUAUUUAACUCACCAGGACAUUCACUGAACAAUGCCAGGGAUACAAGUGCCAUGGAUACUCUACCGCUAAAUGGUAAUUUUAACAACAGCUACUCGCUGCACAAGGGUGACUAUAAUGACAGCGUGCAAGUUGUGGACUGUGGACUAAGUCUGAAUGAUACUGCUUUUGAGAAAAUGAUCAUUUCAGAAUUAGUGCACAACAACUUACGGGGCAGCAGCAAGACUCACAACCUCGAGCUCACGCUACCAGUCAAACCUGUGAUUGGAGGUAGCAGCAGUGAAGAUGAUGCUAUUGUGGCAGAUGCUUCAUCUUUAAUGCACAGCGACAACCCAGGGCUGGAGCUCCAUCACAAAGAACUCGAGGCACCACUUAUUCCUCAGCGGACUCACUCCCUUCUGUACCAACCCCAGAAGAAAGUGAAGUCCGAGGGAACUGACAGCUAUGUCUCCCAACUGACAGCAGAGGCUGAAGAUCACCUACAGUCCCCCAACAGAGACUCUCUUUAUACAAGCAUGCCCAAUCUUAGAGACUCUCCCUAUCCGGAGAGCAGCCCUGACAUGGAAGAAGACCUCUCUCCCUCCAGGAGGAGUGAGAAUGAGGACAUUUACUAUAAAAGCAUGCCAAAUCUUGGAGCUGGCCAUCAGCUUCAGAUGUGCUACCAGAUCAGCAGGGGCAAUAGUGAUGGUUAUAUAAUCCCCAUUAACAAAGAAGGGUGUAUUCCAGAAGGAGAUGUUAGAGAAGGACAAAUGCAGCUGGUUACAAGUCUUUAAUCAUACAGCUAAGGAAUUCCAAGGGCCACAUGCGAGUAUUAAUAAAUAAAGACACCAUUGGCCUGACGCAGCUCCCUCAAACUCUGCUUGAAGAGAUGACUCUUGACCUGUGGUUCUCUGGUGUAAAAAAGAUGACUGAACCUUGCAGUUCUGUGAAUUUUUAUAAAACAUACAAAAACUUUGUAUAUACACAGAGUAUACUAAAGUGAAUUAUUUGUUACAAAGAAAAGAGAUGCCAGCCAGGUAUUUUAAGAUUCUGCUGCUGUUUAGAGAAAUUGUGAAACAAGCAAAACAAAACUUUCCAGCCAUUUUACUGCAGCAGUCUGUGAACUAAAUUUGUAAAUAUGGCUGCACCAUUUUUGUAGGCCUGCAUUGUAUUAUAUACAAGACGUAGGCUUUAAAAUCCUGUGGGACAAAUUUACUGUACCUUACUAUUCCUGACAAGACUUGGAAAAGCAGGAGAGAUAUUCUGCAUCAGUUUGCAGUUCACUGCAAAUCUUUUACAUUAAGGCAAAGAUUGAAAACAUGCUUAACCACUAGCAAUCAAGCCACAGGCCUUAUUUCAUAUGUUUCCUCAACUGUACAAUGAACUAUUCUCAUGAAAAAUGGCUAAAGAAAUUAUAUUUUGUUCUAUUGCUAGGGUAAAAUAAAUACAUUUGUGUCCAACUGAAAUAUAAUUGUCAUUAAAAUAAUUUUAAAGAGUGAAGAAAAUAUUGUGAAAAGCUCUUGGUUGCACAUGUUAUGAAAUGUUUUUUCUUACACUUUGUCAUGGUAAGUUCUACUCAUUUUCACUUCUUUUCCACUGUAUACAGUGUUCUGCUUUGACAAAGUUGGUCUUUAUUACUUACAUUUAAAUUUCUUAUUGCCAAAAGAACGUGUUUUAUGGGGAGAAACAAACUCUUUGAAGCCAGUUAUGUCAUGCCUUGCACAAAAGUGAUGAAAUCUAGAAAAGAUUGUGUGUCACCCCUGUUUAUUCUUGAACAGAGGGCAAAGAGGGCACUGGGCACUUCUCACAAACUUUCUAGUGAACAAAAGGUGCCUAUUCUUUUUUAAAAAAAUAAAAUAAAACAUAAAUAUUACUCUUCCAUAUUCCUUCUGCCUAUAUU-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 23266)
adhesion G protein-coupled receptor L2
strand +
KIAA0786, LEC1, CIRL2
NCBI CDS gene sequence (4380 bp)
5'-ATGGTGTCTTCTGGTTGCAGAATGCGAAGTCTGTGGTTTATCATTGTAATCAGCTTCTTACCAAATACAGAAGGTTTCAGCAGAGCAGCTTTACCATTTGGGCTGGTGAGGCGAGAATTATCCTGTGAAGGTTATTCTATAGATCTGCGATGCCCGGGCAGTGATGTCATCATGATTGAGAGCGCTAACTATGGTCGGACGGATGACAAGATTTGTGATGCTGACCCATTTCAGATGGAGAATACAGACTGCTACCTCCCCGATGCCTTCAAAATTATGACTCAAAGGTGCAACAATCGAACACAGTGTATAGTAGTTACTGGGTCAGATGTGTTTCCTGATCCATGTCCTGGAACATACAAATACCTTGAAGTCCAATATGAATGTGTCCCTTACATTTTTGTGTGTCCTGGGACCTTGAAAGCAATTGTGGACTCACCATGTATATATGAAGCTGAACAAAAGGCGGGTGCTTGGTGCAAGGACCCTCTTCAGGCTGCAGATAAAATTTATTTCATGCCCTGGACTCCCTATCGTACCGATACTTTAATAGAATATGCTTCTTTAGAAGATTTCCAAAATAGTCGCCAAACAACAACATATAAACTTCCAAATCGAGTAGATGGTACTGGATTTGTGGTGTATGATGGTGCTGTCTTCTTTAACAAAGAAAGAACGAGGAATATTGTGAAATTTGACTTGAGGACTAGAATTAAGAGTGGCGAGGCCATAATTAACTATGCCAACTACCATGATACCTCACCATACAGATGGGGAGGAAAGACTGATATCGACCTAGCAGTTGATGAAAATGGTTTATGGGTCATTTACGCCACTGAACAGAACAATGGAATGATAGTTATTAGCCAGCTGAATCCATACACTCTTCGATTTGAAGCAACGTGGGAGACTGTATACGACAAACGTGCCGCATCAAATGCTTTTATGATATGCGGAGTCCTCTATGTGGTTAGGTCAGTTTATCAAGACAATGAAAGTGAAACAGGCAAGAACTCAATTGATTACATTTATAATACCCGATTAAACCGAGGAGAATATGTAGATGTTCCCTTCCCCAACCAGTATCAGTATATTGCTGCAGTGGATTACAATCCAAGAGATAACCAACTTTACGTGTGGAACAATAACTTCATTTTACGATATTCTCTGGAGTTTGGTCCACCTGATCCTGCCCAAGTGCCTACCACAGCTGTGACAATAACTTCTTCAGCTGAGCTGTTCAAAACCATAATATCAACCACAAGCACTACTTCACAGAAAGGCCCCATGAGCACAACTGTAGCTGGATCACAGGAAGGAAGCAAAGGGACAAAACCACCTCCAGCAGTTTCTACAACCAAAATTCCACCTATAACAAATATTTTTCCCCTGCCAGAGAGATTCTGTGAAGCATTAGACTCCAAGGGGATAAAGTGGCCTCAGACACAAAGGGGAATGATGGTTGAACGACCATGCCCTAAGGGAACAAGAGGAACTGCCTCATATCTCTGCATGATTTCCACTGGAACATGGAACCCTAAGGGCCCCGATCTTAGCAACTGTACCTCACACTGGGTGAATCAGCTGGCTCAGAAGATCAGAAGCGGAGAAAATGCTGCTAGTCTTGCCAATGAACTGGCTAAACATACCAAAGGGCCAGTGTTTGCTGGGGATGTAAGTTCTTCAGTGAGATTGATGGAGCAGTTGGTGGACATCCTTGATGCACAGCTGCAGGAACTGAAACCTAGTGAAAAAGATTCAGCTGGACGGAGTTATAACAAGCTCCAAAAACGAGAGAAGACATGCAGGGCTTACCTTAAGGCAATTGTTGACACAGTGGACAACCTTCTGAGACCCGAAGCTTTGGAATCATGGAAACATATGAATTCTTCTGAACAAGCACATACTGCAACAATGTTACTCGATACATTGGAAGAAGGAGCTTTTGTCCTAGCTGACAATCTTTTAGAACCAACAAGGGTCTCAATGCCCACAGAAAATATTGTCCTGGAAGTTGCCGTACTCAGTACAGAAGGACAGATCCAAGACTTTAAATTTCCTCTGGGCATCAAAGGAGCAGGCAGCTCAATCCAACTGTCCGCAAATACCGTCAAACAGAACAGCAGGAATGGGCTTGCAAAGTTGGTGTTCATCATTTACCGGAGCCTGGGACAGTTCCTTAGTACAGAAAATGCAACCATTAAACTGGGTGCTGATTTTATTGGTCGTAATAGCACCATTGCAGTGAACTCTCACGTCATTTCAGTTTCAATCAATAAAGAGTCCAGCCGAGTATACCTGACTGATCCTGTGCTTTTTACCCTGCCACACATTGATCCTGACAATTATTTCAATGCAAACTGCTCCTTCTGGAACTACTCAGAGAGAACTATGATGGGATATTGGTCTACCCAGGGCTGCAAGCTGGTTGACACTAATAAAACTCGAACAACGTGTGCATGCAGCCACCTAACCAATTTTGCAATTCTCATGGCCCACAGGGAAATTGCATATAAAGATGGCGTTCATGAATTACTTCTTACAGTCATCACCTGGGTGGGAATTGTCATTTCCCTTGTTTGCCTGGCTATCTGCATCTTCACCTTCTGCTTTTTCCGTGGCCTACAGAGTGACCGAAATACTATTCACAAGAACCTTTGTATCAACCTTTTCATTGCTGAATTTATTTTCCTAATAGGCATTGATAAGACAAAATATGCGATTGCATGCCCAATATTTGCAGGACTTCTACACTTTTTCTTTTTGGCAGCTTTTGCTTGGATGTGCCTAGAAGGTGTGCAGCTCTACCTAATGTTAGTTGAAGTTTTTGAAAGTGAATATTCAAGGAAAAAATATTACTATGTTGCTGGTTACTTGTTTCCTGCCACAGTGGTTGGAGTTTCAGCTGCTATTGACTATAAGAGCTATGGAACAGAAAAAGCTTGCTGGCTTCATGTTGATAACTACTTTATATGGAGCTTCATTGGACCTGTTACCTTCATTATTCTGCTAAATATTATCTTCTTGGTGATCACATTGTGCAAAATGGTGAAGCATTCAAACACTTTGAAACCAGATTCTAGCAGGTTGGAAAACATTAAGTCTTGGGTGCTTGGCGCTTTCGCTCTTCTGTGTCTTCTTGGCCTCACCTGGTCCTTTGGGTTGCTTTTTATTAATGAGGAGACTATTGTGATGGCATATCTCTTCACTATATTTAATGCTTTCCAGGGAGTGTTCATTTTCATCTTTCACTGTGCTCTCCAAAAGAAAGTACGAAAAGAATATGGCAAGTGCTTCAGACACTCATACTGCTGTGGAGGCCTCCCAACTGAGAGTCCCCACAGTTCAGTGAAGGCATCAACCACCAGAACCAGTGCTCGCTATTCCTCTGGCACACAGAGTCGTATAAGAAGAATGTGGAATGATACTGTGAGAAAACAATCAGAATCTTCTTTTATCTCAGGTGACATCAATAGCACTTCAACACTTAATCAAGGAATGACTGGCAATTACCTACTAACAAACCCTCTTCTTCGACCCCACGGCACTAACAACCCCTATAACACATTGCTCGCTGAAACAGTTGTATGTAATGCCCCTTCAGCTCCTGTATTTAACTCACCAGGACATTCACTGAACAATGCCAGGGATACAAGTGCCATGGATACTCTACCGCTAAATGGTAATTTTAACAACAGCTACTCGCTGCACAAGGGTGACTATAATGACAGCGTGCAAGTTGTGGACTGTGGACTAAGTCTGAATGATACTGCTTTTGAGAAAATGATCATTTCAGAATTAGTGCACAACAACTTACGGGGCAGCAGCAAGACTCACAACCTCGAGCTCACGCTACCAGTCAAACCTGTGATTGGAGGTAGCAGCAGTGAAGATGATGCTATTGTGGCAGATGCTTCATCTTTAATGCACAGCGACAACCCAGGGCTGGAGCTCCATCACAAAGAACTCGAGGCACCACTTATTCCTCAGCGGACTCACTCCCTTCTGTACCAACCCCAGAAGAAAGTGAAGTCCGAGGGAACTGACAGCTATGTCTCCCAACTGACAGCAGAGGCTGAAGATCACCTACAGTCCCCCAACAGAGACTCTCTTTATACAAGCATGCCCAATCTTAGAGACTCTCCCTATCCGGAGAGCAGCCCTGACATGGAAGAAGACCTCTCTCCCTCCAGGAGGAGTGAGAATGAGGACATTTACTATAAAAGCATGCCAAATCTTGGAGCTGGCCATCAGCTTCAGATGTGCTACCAGATCAGCAGGGGCAATAGTGATGGTTATATAATCCCCATTAACAAAGAAGGGTGTATTCCAGAAGGAGATGTTAGAGAAGGACAAATGCAGCTGGTTACAAGTCTTTAA-3'
NCBI CDS gene sequence with introns (location: 81836985.. 81991145) (154161 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 81801393.. 81992251) (190859 bp)Download
NCBI gene sequence (location: [81801393 - 1000].. 81992251) (191859 bp)Download
How to cite: Schnider B., M'Rad Y., el Ahmadie J., de Brevern AG., Imberty A., Lisacek F., HumanLectome, an update of UniLectin for the annotation and prediction of human lectins, Nucleic Acids Reasearch doi.org/10.1093/nar/gkad905