NCBI Summary
The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments and RNAseq data.
Protein
Protein (NP_705833)
Very large A-kinase anchor protein
Very large A-kinase anchor protein (vlAKAP) (Beta/gamma crystallin domain-containing protein 3)
CRYBG3
crystallin beta-gamma domain containing 3
Undefined
Very low evidence
Ricin-like
Undefined
b-trefoil
Uncharacterised
0.388
Undefined
Protein sequence and protein families (fasta) (2970 amino acids) Download
MSSGRRRGSAPWHSFSRFFAPRSPSRDKEEEEEERPGTSPPPAPGRSAASVENEPMSTSQKKENVLSSEAVKIRQSEDKRNHAEKPVTLPVQEDPKKAYDLSSSTSDTKIGESDRQPKESFFQFLGNLFNISGKSSLGEAKQSSFKDDQDKTEKDLQNPSDHHEDGIKREREIFSGSLRTQTHPTEEQDSNSSELSDAFSLDTTQDSDQETTNLLKQIDGKPEKPSVTYATYRGPRHIGKYLKQQTGLATVNTLDRENESSDSSTNRHIDPGSEIEAGVLPLLLSASTDSSMKGNLLEGPLEDSDCSKTSFNKENSLTNNPELQNIASSNNLLNKNAWGSIERNRSSPSSVTNSSYDGESDSQHHLSCEPVSQTNRNLVCSALLTGSNHRKVPCSPDFQRVTTTENTIKENSTVMSNRTLVQREELVEPQGPAISDFSCSKSDGSDTTEQESTNLPSPNKSIRHEHLQLPESECSDKQTIDSSSKQAATHTNIIALQRHAVTDTEFVNEGKRLSAQDSQKNVAVREIRRETESASAGESIASSHVKAPEDKIESLPKDTDQYFETKAKKLDFRSHDKIPHIRMNKKDLASLNYISESAVVASLGNENAPELKFELNRSHISETPLDSESPQQAEVSPDAKTSLSLDCKKLNFSISPPTFVSGVGMLSKLDIPDLMNEGSPVPIETGNVNIVGISYQPRKCKEENVKNHVEAAGRKSPPPSFCLEYTSAIFEFKEVLSNSEKCQVLPGSEASGPHLTGLELLSFDSGNLSKDCSSILSQDPNRVELVSSNTKANMSIIEKSDSLSLEAKTANIVSKAEIDGQNNVLVESHSGRGKTISLSKVSLSKVEPRNISQDKMSSFPLKITHVPEKPILSELTFLEVEQGKRFQSINHNEIGEKCSDAGLKENCQAELSPAASKYEDKPEPEVDALGSPPALLKSNISWILPPIHDEKISRQMAQNCEAHTCVFHQSLDICGTKKISGHSEMAELSLTNISPKFQETGSMKVNSPFLDSDSSLEKNSSASEDSSFLKVPSVLKLEKKSSSYRKKENIHFLNGGIDSVSSSSSYPEEVSMIVNSHKPQNNLDSIQVTKDLTHEGTSVTNLLYPTTSYLEFETSVSIGTEVTPFQEHFGIYTGKISIDFPTAAQFDNLVEAETGAVAGPAASVNSSGQQCSEASAEHIEARRRAHDQLLDLKSSLLKKADTLIGEIFNSVREELKFKHTVSTCQEHIAIEGIMNLGTLKEDISEKNPSEVTLTEIQQTEGLEEQGMENMSEVKEKPCVSPTVGEKNLLVDPNSMNVSCLLEDKARELVNEIIYVAQEKLRNDTFEDTEDTWDSELQANTSKILNSDSVKPHDVVREFLVSEQPVNQSTQISENKVLNEFFSLSNLASGTESIKGGEIVLYQKSLFSGNGSGLSDSINLQESDTVLLAEDMSHKRLDDRVKTHLFRSEDCNETMEIENVDNNKTETEDRRTLVLNFKWPPLVNDDIHAPGTSKSSLSDSLVCISEKNLPGHSKNTPLAMSDVGKVHKKDNEINIGKIELIPSMLETGKTNKKDAELNILKYEAVPPMIEMGRIHKMDAELNVTKTEPKANVFKMGEVYQMDAESCIEKTEGSAVILGMEKAYKMKDTEGDIGKIEVIPMMPEVKNIHQKDAEGDIVKTEMTPVTVDMENIYQTHAEGDIGKTGTIALSEVENIHQKGGEGISEKAEVIPVTLAMENTYQKDAEGDIGKAEVMPVRLEMENTYPKDTERDGGKTEVMPLALEVVNTYQKNAKGFTGNTEGSVLKMEATYRKTAEEVIKNTEIVPCVLKVKEAHETAPAPLEMEKACKRDVKETIGATVSTPSVIEMEKISPEDRGENIGKHKVLPAVVDIEKIHGTGLELTTKQGEAMLPAFESKTPQEYAEGSVEETKEEPTEIKEGLIAHENRLPTYFRGYESPTLSKDYEGYPAPAMPDFQPGDTTVRLDKRMSLTAIYDKRRETDYSDKGYNLAFVSQDEQENSSFTILYEEPLQEEDKYASAEARQTQSVLFHDTSADSMPVLACERSESRTDLVHHFEKGTKLGETFDSDSSEMFLSVEAKRYKIYPLALSPIYEDDSSQEDILSSEVSPGHHGPRKSRDSENQSSSVLSLLQSVSERLKMNFDEDDREAADEEEEEEEAAVLHKGDLRAGSGERVTFQLPDPSITFYPDDQESVGISKNSYVMPNEPTTSNLQVGLWPEKTSFLQKSDLTSKLHSSLKSAYHQYLQTSQSHSSEKGARFGGIFQEPVSKYFRVQDSPGRLSPFIENVDKQTLRCNPRPGKMVIYDLHESTYKQEVYCNIPDATSWSFPNGVLIKVVRGCWILYEKPHFRGQKCVLEEGEKVLNRDWILQNRRHPQRNFILGSLKRVLKDCSIPEIELFPQSDPACCPVYIQRAVPNLEELNISKSVSFTVKSGVWLAYPDINFKGQATVLEEDHGLFEISTAEMKSLHPLQMGGLKVEMPMNLKVIIYEKPHFHGQAKEFSEHIDSVPNFLKNNGDFHRIGSIRVIGGVWVAYEKEHFKGQQFLLEEGDFEDSNACGALSSPILSFRYLQANFIESSVTLFESDLESGKFIDITNQEISDLEEIGFGSKTRSIHVKSGVWVAYQQKFFCGEQYILEKGKYKCFFDWGGSNNIIMSIRPIQLEPLGINEPPHLLKAFSKPGFQGECIDFTEETSDLTSLMPCSFKVLRGCWLLYYQEDMFVNHCVLEEGLYADLTSCGCPASKVKSLKPIDYVFEEPSISLFALEHCEGRELHLEEAVNSVLNKDLHFYTQSVWVKSGLWIAYEGSNFLGRQILLRPNEIPNWTAFSRWKTIGSLRPMKQPAVYIRIKNRAQGEYLTVTGSLADTRATSVCISPYSGKNTQIWYYCRGLFKSKASDTCLDVIGGRDTPGAKVALWTEHGQFRQKWRLNKNGTISSYLSDQLVLDVKGGNYCDKTHVIVNQPLEGEETQKWDIEIL
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.65, 2.18] ÅDownload
The location of the lectin domain structural model is: 2836-2968
We infer [1.65, 2.18] Å as the interval of error of this structural model.
Template: 1XHB chain: A, O08912, NP_001153876.1, sequence identity: 21.1%, coverage: 95.5%, location in sequence: 95-553, (95-553 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (3 PubMed Identifiers)
  • Long Non-Coding RNA CRYBG3 Promotes Lung Cancer Metastasis via Activating the eEF1A1/MDM2/MTBP Axis. [33809929]
  • The long noncoding RNA CRYBG3 induces aneuploidy by interfering with spindle assembly checkpoint via direct binding with Bub3. [33564066]
  • A systematic evaluation of protein kinase A-A-kinase anchoring protein interaction motifs. [25097019]
UniProt Main References (6 PubMed Identifiers)
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The DNA sequence, annotation and analysis of human chromosome 3. [16641997]
  • The full-ORF clone resource of the German cDNA Consortium. [17974005]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • A quantitative atlas of mitotic phosphorylation. [18669648]
  • An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. [24275569]
All isoforms of this gene containing a lectin domain
XP_005247174.1, NP_705833.3
RNA
RNA (Transcript ID: NM_153605.4)
crystallin beta-gamma domain containing 3
m7G-5')ppp(5'-GGCGUGAGGAGCUGCCGCGCGAGGAGCGCGUCGCGUCCGCACUUCUCCUGCCCGAGAGAGACUGAGCCGCGCUGGCAGCUCGCGUCGAGUCGGUCUGCCCUAGCCGCAUCCCGCGGCGCCCGGUCGGGCUCCGGGCACCAGGCAACACCUAGGCCGUUCCCUUCAGACAGCCCCGGGCCAGCGGCCCCCUCGGGAAAUGUCCAGCGGCCGCAGAAGGGGCAGCGCCCCCUGGCACAGCUUCUCCCGGUUCUUCGCUCCCCGAAGUCCUUCCCGGGACAAGGAAGAGGAAGAGGAGGAGAGGCCGGGGACGAGCCCGCCUCCAGCUCCAGGCCGGUCCGCUGCCAGUGUUGAAAAUGAGCCCAUGAGCACAAGUCAGAAAAAGGAAAAUGUACUUUCAUCAGAAGCAGUAAAGAUUCGCCAAAGUGAGGACAAAAGGAACCAUGCUGAGAAGCCAGUCACUCUUCCAGUGCAGGAAGAUCCCAAAAAGGCAUAUGAUCUUUCCAGUUCCACUUCAGAUACCAAAAUAGGAGAAAGUGACAGACAGCCAAAAGAAAGCUUUUUUCAGUUUCUUGGUAACUUAUUCAAUAUCUCGGGGAAAUCAUCUCUAGGUGAAGCUAAGCAGUCUUCUUUCAAAGAUGACCAGGAUAAAACUGAGAAGGAUUUACAAAAUCCCAGUGACCAUCAUGAAGACGGGAUCAAAAGGGAGAGAGAGAUUUUCAGUGGCUCCCUAAGAACCCAGACACAUCCAACAGAAGAACAAGACUCUAACUCAUCCGAACUCUCAGAUGCUUUUUCUUUGGAUACAACACAAGACAGUGACCAAGAAACCACUAAUUUGCUAAAACAAAUCGAUGGUAAACCAGAGAAGCCUUCAGUAACAUAUGCAACAUAUCGAGGCCCAAGACACAUUGGGAAAUAUUUAAAGCAACAGACAGGCUUGGCAACUGUGAAUACCUUGGACAGAGAAAAUGAAAGUUCUGACUCUAGUACAAACAGACACAUUGACCCUGGAAGUGAGAUUGAGGCUGGGGUACUGCCACUGUUGUUAUCAGCUAGUACAGACUCAUCUAUGAAAGGAAAUCUACUUGAAGGCCCAUUAGAAGACUCUGAUUGUAGCAAAACAAGUUUCAACAAGGAAAAUUCUUUGACAAAUAACCCAGAACUGCAGAAUAUUGCCUCUUCCAAUAAUCUUUUAAAUAAAAAUGCUUGGGGGAGUAUUGAGAGAAAUAGGUCAUCCCCUUCUUCUGUGACUAACUCCAGCUACGAUGGAGAAUCUGACUCACAGCACCAUUUAAGUUGUGAACCGGUUUCUCAGACUAACAGAAAUUUGGUAUGUUCAGCAUUGUUAACAGGAAGUAACCAUCGCAAAGUCCCUUGCAGCCCAGAUUUUCAGAGAGUAACUACAACAGAAAAUACGAUAAAAGAAAACAGCACUGUGAUGAGUAAUAGGACAUUGGUGCAAAGAGAGGAGCUUGUUGAGCCUCAGGGCCCUGCUAUUUCUGAUUUCUCUUGUAGUAAAUCUGAUGGGAGUGACACUACUGAGCAGGAAAGUACAAAUUUGCCAAGUCCAAAUAAAUCAAUUAGGCAUGAACAUCUGCAGUUGCCAGAGAGUGAGUGUUCUGACAAGCAAACCAUAGAUAGCUCAUCAAAGCAAGCUGCCACUCACACCAAUAUCAUUGCUCUUCAGAGACAUGCUGUGACAGACACAGAAUUUGUAAAUGAAGGAAAGAGAUUGUCUGCCCAAGACUCACAGAAAAAUGUGGCUGUUAGAGAAAUCAGGCGAGAAACAGAAAGUGCCUCAGCUGGUGAAUCCAUAGCUUCAAGUCAUGUAAAAGCUCCAGAAGAUAAAAUUGAGUCAUUACCCAAAGAUACUGACCAAUACUUUGAAACCAAAGCCAAAAAGCUUGAUUUUAGGUCACAUGAUAAAAUUCCUCAUAUUAGAAUGAAUAAAAAAGACCUGGCCUCUUUAAAUUACAUCAGUGAAUCAGCAGUUGUAGCAAGCUUAGGAAAUGAAAAUGCACCUGAGUUGAAAUUUGAACUUAAUAGAAGUCACAUUUCAGAAACUCCUCUUGACUCUGAGAGUCCUCAACAAGCUGAAGUAUCACCUGAUGCUAAAACAUCUCUUAGCCUUGACUGUAAAAAACUAAAUUUCAGUAUUUCACCUCCUACCUUUGUUUCUGGAGUUGGGAUGCUGAGCAAGUUGGAUAUUCCUGAUUUAAUGAAUGAGGGUUCUCCUGUGCCCAUUGAAACUGGGAAUGUCAACAUUGUUGGUAUUUCCUAUCAGCCUAGGAAGUGUAAAGAAGAAAAUGUGAAAAACCAUGUUGAGGCUGCAGGCAGGAAGAGUCCUCCUCCUUCCUUUUGCCUUGAAUAUACAUCUGCAAUUUUUGAAUUCAAAGAAGUUCUUUCUAAUAGUGAAAAAUGCCAGGUUCUUCCAGGUUCUGAAGCCAGUGGCCCUCACUUAACUGGGUUGGAGCUAUUGAGCUUUGACUCUGGAAACCUCUCUAAGGAUUGCAGUUCCAUUUUAUCUCAAGACCCUAAUAGAGUAGAGUUAGUGUCUUCAAACACUAAAGCAAAUAUGAGCAUAAUAGAGAAGUCUGAUUCUCUUUCCUUGGAAGCCAAAACUGCUAACAUUGUAUCAAAAGCUGAAAUUGAUGGUCAGAACAAUGUUCUUGUGGAGUCACAUUCUGGAAGAGGAAAAACUAUAUCCUUGUCCAAGGUAUCUCUUUCAAAAGUGGAGCCCAGAAACAUUUCUCAGGAUAAAAUGUCUUCUUUUCCAUUGAAAAUUACCCAUGUUCCAGAAAAGCCUAUUUUGUCAGAAUUAACCUUUCUAGAAGUUGAACAGGGCAAACGUUUUCAAUCAAUUAAUCAUAAUGAGAUAGGAGAGAAAUGUUCAGAUGCUGGCCUUAAAGAGAAUUGCCAAGCUGAGCUUUCUCCUGCUGCCUCCAAAUAUGAAGAUAAGCCAGAACCAGAGGUAGAUGCCUUAGGCUCUCCUCCUGCUCUUCUUAAAAGUAAUAUAUCUUGGAUUUUACCACCUAUUCAUGAUGAAAAAAUCAGUAGGCAAAUGGCGCAGAAUUGUGAAGCUCACACUUGUGUGUUUCAUCAAUCUUUGGAUAUUUGUGGGACUAAAAAGAUUUCUGGUCACUCAGAAAUGGCGGAACUCAGCUUAACUAAUAUUUCCCCUAAAUUCCAAGAAACUGGCAGCAUGAAAGUAAAUUCACCUUUUCUGGAUUCUGAUUCCAGUUUGGAAAAAAAUUCUUCUGCAUCUGAGGACUCAAGCUUCCUUAAAGUACCUUCUGUGCUGAAAUUGGAAAAGAAAUCCUCAUCUUACAGAAAGAAAGAGAACAUCCAUUUUUUAAAUGGUGGUAUUGAUAGUGUGUCAUCUUCCUCUAGUUACCCUGAAGAAGUUAGCAUGAUAGUAAAUUCACAUAAGCCCCAAAAUAAUUUGGAUUCUAUACAAGUUACCAAAGAUCUCACACAUGAAGGUACCUCUGUAACUAACCUGUUGUACCCUACUACCUCUUAUUUGGAAUUUGAAACGUCUGUCUCAAUUGGGACAGAAGUAACCCCAUUUCAGGAACAUUUUGGGAUUUAUACUGGGAAGAUAUCCAUUGAUUUCCCAACUGCUGCCCAAUUUGACAAUCUCGUGGAAGCAGAGACUGGAGCAGUUGCUGGGCCUGCAGCGUCAGUUAACAGCUCAGGCCAACAGUGUUCUGAAGCCUCUGCUGAGCACAUAGAAGCCAGGAGAAGAGCACAUGACCAACUUUUGGACCUCAAAAGUAGUUUACUCAAAAAGGCCGAUACAUUGAUUGGUGAGAUUUUUAAUUCUGUCAGGGAAGAACUAAAAUUCAAACACACAGUGAGUACCUGCCAGGAGCAUAUAGCCAUAGAAGGUAUAAUGAAUCUGGGUACCCUGAAAGAAGACAUCUCUGAGAAAAACCCAUCAGAAGUGACACUAACAGAAAUACAACAGACAGAGGGUUUGGAAGAGCAAGGCAUGGAAAACAUGUCAGAAGUCAAAGAGAAGCCCUGUGUUUCACCAACAGUUGGUGAGAAGAAUCUUCUUGUUGAUCCUAAUAGUAUGAAUGUAUCUUGUUUGUUAGAAGAUAAAGCUAGGGAAUUAGUCAAUGAGAUUAUUUAUGUAGCCCAAGAAAAAUUGAGAAAUGAUACUUUUGAAGAUACUGAGGAUACUUGGGAUUCUGAACUUCAGGCUAAUACUUCAAAAAUUCUGAACAGUGAUAGUGUUAAGCCACAUGAUGUAGUUAGAGAGUUCUUGGUUUCAGAACAGCCAGUAAAUCAAAGCACACAAAUUAGUGAAAAUAAAGUAUUAAAUGAAUUCUUCUCCCUAAGUAACUUAGCUAGUGGCACAGAGUCAAUUAAGGGAGGAGAAAUUGUUCUCUACCAAAAAUCCCUAUUUUCUGGAAAUGGAUCUGGACUGUCUGAUAGUAUAAAUUUGCAGGAAUCAGAUACGGUUUUACUAGCUGAAGACAUGUCACAUAAACGGUUAGAUGAUAGGGUAAAAACACAUUUAUUUCGCAGUGAGGACUGUAAUGAGACAAUGGAAAUAGAGAAUGUGGAUAAUAACAAAACUGAGACAGAGGACAGAAGAACUCUUGUAUUAAAUUUCAAAUGGCCUCCACUUGUGAAUGAUGACAUCCAUGCACCUGGUACAUCUAAAAGCAGUUUGUCUGAUAGCCUUGUAUGUAUAUCUGAAAAAAACUUGCCAGGACACAGUAAAAACACACCUCUUGCAAUGUCAGAUGUAGGGAAAGUACACAAGAAGGAUAAUGAAAUAAAUAUAGGGAAAAUUGAACUUAUACCUUCCAUGUUAGAAACAGGGAAAACAAACAAAAAGGAUGCUGAAUUGAAUAUUCUGAAAUAUGAGGCAGUCCCUCCUAUGAUAGAAAUGGGAAGAAUACAUAAAAUGGAUGCUGAAUUGAAUGUCACGAAAACUGAGCCAAAAGCUAAUGUUUUUAAAAUGGGAGAAGUAUACCAAAUGGAUGCCGAGAGCUGUAUUGAAAAAACUGAGGGAUCAGCUGUCAUUUUAGGAAUGGAAAAAGCUUAUAAGAUGAAGGAUACUGAAGGGGAUAUUGGCAAAAUUGAGGUGAUACCUAUGAUGCCAGAAGUGAAAAAUAUCCACCAAAAGGAUGCUGAAGGGGAUAUUGUAAAGACUGAGAUGACACCUGUUACAGUAGACAUGGAAAAUAUUUACCAAACGCAUGCUGAAGGGGAUAUUGGCAAGACUGGGACGAUAGCCUUGUCAGAAGUGGAAAAUAUCCACCAAAAAGGUGGUGAAGGGAUUAGUGAAAAGGCUGAAGUGAUACCCGUUACAUUAGCAAUGGAAAAUACUUACCAAAAGGAUGCUGAAGGGGAUAUUGGAAAGGCUGAAGUGAUGCCUGUGAGGUUAGAAAUGGAAAAUACUUACCCAAAGGAUACUGAAAGAGACGGUGGCAAAACUGAGGUGAUGCCCCUUGCAUUAGAGGUAGUAAAUACUUACCAAAAAAAUGCCAAAGGUUUUACCGGGAACACUGAAGGGUCUGUGUUGAAAAUGGAAGCUACUUACCGAAAGACUGCUGAAGAGGUCAUUAAGAAUACUGAAAUAGUACCGUGUGUGUUAAAAGUGAAGGAAGCACACGAGACAGCACCUGCCCCCUUAGAAAUGGAAAAAGCAUGCAAGAGAGAUGUUAAAGAGACUAUUGGAGCAACUGUGUCCACACCCUCUGUGAUAGAAAUGGAAAAAAUAUCCCCAGAAGAUCGUGGUGAGAAUAUUGGGAAACACAAAGUGUUACCCGCAGUGGUAGACAUUGAGAAAAUACAUGGAACAGGACUAGAAUUGACCACUAAACAAGGGGAGGCCAUGCUUCCUGCAUUUGAAAGUAAAACACCACAAGAGUAUGCUGAAGGGAGUGUUGAAGAAACAAAGGAAGAGCCUACAGAAAUAAAGGAAGGCUUGAUAGCACAUGAAAAUAGACUUCCUACAUAUUUCAGGGGAUAUGAAUCCCCUACAUUAAGUAAGGAUUAUGAGGGCUACCCAGCCCCAGCAAUGCCAGAUUUUCAACCUGGGGAUACCACAGUAAGACUAGACAAAAGAAUGUCUCUUACUGCAAUAUAUGACAAGAGGAGAGAGACAGAUUAUAGUGACAAAGGAUAUAAUUUAGCUUUUGUUUCUCAAGAUGAACAAGAAAAUUCUUCCUUUACUAUAUUAUACGAAGAGCCCCUUCAAGAGGAGGACAAGUAUGCUUCCGCAGAAGCAAGACAAACACAGUCUGUCUUGUUUCAUGAUACGUCCGCUGACAGCAUGCCUGUUCUGGCAUGUGAAAGGUCUGAGAGUAGAACUGACCUUGUCCAUCACUUUGAAAAAGGUACUAAAUUAGGUGAGACAUUUGAUAGUGAUAGUUCAGAAAUGUUCUUAUCAGUGGAGGCCAAAAGGUACAAAAUUUAUCCUUUAGCAUUGUCUCCCAUUUAUGAGGAUGACAGCUCACAGGAGGACAUUCUAUCUAGUGAGGUUUCACCUGGUCACCAUGGCCCCAGGAAAUCAAGAGACAGUGAAAACCAGUCCUCUUCUGUUUUAUCCCUUCUCCAGUCAGUGUCAGAACGUUUAAAGAUGAAUUUUGAUGAAGAUGACAGAGAGGCAGCUGAUGAGGAAGAAGAGGAGGAGGAGGCAGCAGUAUUGCAUAAAGGAGAUCUGAGAGCUGGAAGUGGGGAGCGUGUUACCUUCCAGUUGCCAGAUCCUUCCAUCACAUUUUACCCUGAUGACCAGGAGAGCGUUGGAAUUUCUAAGAAUUCAUAUGUGAUGCCAAAUGAACCUACUACCUCCAAUCUGCAAGUUGGUCUGUGGCCAGAAAAGACCUCGUUUCUCCAGAAAUCUGACCUUACUUCUAAACUACAUUCUUCUUUAAAGAGUGCUUAUCAUCAGUAUCUGCAGACUUCCCAAAGUCAUUCCUCAGAAAAAGGAGCCAGAUUUGGUGGAAUUUUUCAGGAACCAGUGUCAAAAUAUUUCCGUGUUCAAGACAGCCCAGGCAGAUUGAGCCCAUUUAUAGAGAAUGUUGACAAACAAACUCUGAGAUGUAACCCAAGACCUGGGAAGAUGGUUAUCUAUGAUCUCCAUGAAAGUACAUAUAAACAAGAAGUCUACUGUAAUAUUCCUGAUGCUACAUCAUGGUCUUUUCCAAAUGGAGUUCUAAUAAAAGUUGUAAGGGGCUGCUGGAUUUUAUAUGAGAAACCACAUUUCCGAGGUCAGAAAUGUGUGCUAGAAGAAGGGGAAAAGGUGUUAAAUCGUGACUGGAUUCUUCAGAACAGAAGGCAUCCACAAAGAAACUUUAUAUUGGGUUCUCUCAAACGUGUCUUAAAGGACUGCAGCAUUCCAGAAAUAGAGCUUUUCCCACAAUCUGACCCAGCCUGUUGUCCUGUCUACAUACAGAGAGCAGUCCCCAAUUUGGAAGAACUGAAUAUCUCCAAAUCUGUGUCCUUCACUGUGAAGUCAGGAGUUUGGCUUGCCUACCCAGAUAUUAAUUUUAAGGGACAAGCUACAGUUCUGGAGGAAGACCAUGGGCUCUUUGAGAUUUCUACAGCAGAAAUGAAAUCAUUACAUCCGCUUCAAAUGGGUGGACUGAAAGUGGAAAUGCCCAUGAACUUAAAGGUUAUUAUUUAUGAAAAACCUCACUUCCAUGGACAGGCUAAAGAGUUUAGUGAACAUAUAGAUUCUGUUCCUAAUUUUUUGAAAAAUAAUGGAGAUUUUCACAGAAUUGGAUCAAUUCGUGUCAUUGGUGGAGUGUGGGUUGCCUAUGAAAAAGAACAUUUUAAAGGCCAGCAGUUUCUGCUUGAAGAAGGAGACUUUGAAGACAGUAAUGCUUGUGGUGCAUUAAGUAGCCCUAUCUUGUCUUUCCGGUACUUACAAGCUAAUUUUAUAGAAUCUUCUGUCACACUAUUUGAAUCUGACCUAGAAAGUGGGAAGUUUAUUGACAUUACAAAUCAGGAAAUUUCUGAUUUGGAAGAAAUUGGCUUUGGCAGUAAAACAAGAUCCAUUCAUGUUAAAAGUGGAGUAUGGGUUGCCUACCAGCAAAAGUUCUUCUGUGGAGAACAAUACAUUUUAGAAAAAGGGAAAUACAAAUGCUUUUUUGACUGGGGAGGAUCAAAUAAUAUAAUCAUGUCGAUACGGCCAAUCCAACUGGAACCACUUGGGAUAAAUGAACCUCCGCAUUUGCUCAAAGCAUUCAGCAAACCAGGGUUCCAAGGUGAAUGUAUAGAUUUUACAGAAGAAACUUCUGAUUUGACUUCACUCAUGCCAUGUUCUUUUAAAGUUCUUCGAGGUUGCUGGCUCCUCUAUUACCAAGAAGACAUGUUUGUUAAUCACUGUGUGUUAGAAGAAGGCCUCUAUGCUGACCUUACUUCCUGCGGUUGCCCAGCAUCUAAAGUCAAAUCUCUCAAGCCCAUUGACUAUGUUUUUGAAGAACCCUCCAUCAGCCUUUUUGCUCUGGAGCAUUGUGAGGGAAGAGAGUUACAUCUAGAAGAGGCUGUGAACUCUGUUCUGAACAAGGACCUACACUUCUACACCCAGUCUGUGUGGGUAAAAAGUGGACUAUGGAUAGCUUAUGAAGGAUCCAAUUUCUUGGGAAGACAAAUCCUACUCAGGCCUAAUGAGAUCCCAAACUGGACAGCAUUCAGCAGAUGGAAAACAAUUGGUUCCCUCCGUCCUAUGAAGCAGCCUGCAGUGUACAUCAGAAUAAAGAACCGUGCCCAGGGUGAAUAUCUGACAGUCACUGGAAGUCUAGCAGACACCAGGGCAACAUCUGUGUGCAUUUCUCCCUAUAGUGGAAAGAAUACUCAGAUCUGGUACUACUGCCGAGGACUCUUUAAAUCCAAGGCCAGUGAUACAUGUCUUGAUGUGAUUGGUGGCCGGGACACACCUGGAGCUAAAGUAGCUCUAUGGACUGAACAUGGGCAAUUCAGGCAGAAGUGGAGACUGAAUAAAAAUGGAACUAUCAGCUCUUAUCUCAGUGAUCAACUUGUCCUUGAUGUUAAAGGAGGAAAUUAUUGUGACAAGACUCAUGUAAUUGUAAAUCAGCCCCUGGAGGGAGAAGAAACACAGAAAUGGGACAUUGAAAUAUUGUGAGAGAAUCAACAUCCCUAGAAAGAUCCCUAGAAAGAGCAAAGAAGGAAACACAUCUGUCAUUGUCUUGUGGACGUGGAAAGGAAGCUACUGUCCUCACACUCCUGGAUCACUGAGCAGAAUGAACAUUUUCUCCAGCCUCUGAGACUAUCGCUCUUAACCAUGGAAAAGCUCAAAAUAUUCUUGCCAUUACUCAGUGUUCCUAUAAAGAAAAUAUUAUGAUAUCUUGGAAAGGUUCUAUUCCUGAUCUCCAGCUGUGGUGAGCAAGUUUCCUGAAGUGUUUAUUUUCUCUCAUAUCCACCAAACGUGAAUCCUGUUCCUGAUGGCCCGUUAUUGGACACUGGUGAUGCUAUUAUCCUGUAUUAUUUAUUAAUAUCCUACCUAGAUGCUUGUAUGAGUACAAAGCAUAAAGAAACAGAUUUCUAUAGGUCAAGUCAUACUUUUGCAAACAGAUGAGUAAUUUUUUAGCAACACCUGAAAAUAUACUAAACUUUCCUAGAUAAACUUUAAGGUUUCUAUACUGAGGCUUUUAUAAUGAACGCACCUCGUUAAGUAUUUAUACUUGUAACUAACCCCAGGCAGGGACCUCAGCUUUGUUAGGAAUAAGGCACAAGAAGUAUUUUCUGUAGCUAUUGUUUCCUCAGUCCUUCAAACUAAAAAAGUACAAAUAAAUAACCUAUGGCCAAACUUGCACUGUUACGUGUUAACCAAGACAUCCCUUUAGGUGACAAGACUCUAUAACAGUGGUUACCUGUCUCCAUGUUGACACUUCAUCCUAGAUUUAAGGAGAGGCAUCAAUUUUUUUUUUUUUUUGCCUCAAGAGAAAUUUCAAAUAUCCAAAUUAAAACACAGUAGCAUUUGAACCUUGACCUUACCAUCUCUUUAAGUAAACGUGGAGUUGAUUUCUCUACUAAAUAACAGAAACCUCAGUUUUUCACUCCCAUUGUAAGUAACUUUUAUUUAAGUAAGUAAAAUCAGGUAGGAAAUCACCUUUGACUUAGCUUCCAGUAGUCAUUACCACCUUUUACUGCACAAUUCACAAGCAUGUUUUCCUGGUGAAUUGGACUGAAAAUUACAUUUUGACAACUUUUUUUCCUUUUAUCCCCAACUUUUGCCAGAAAGCAGAAAAAUGCUCUAUUUUUAUAAAGAAAGAUUAAAUUCUCCAAUGAUAUUUUAAAAAAUAUCAACCUACAUGCACUUUAGAAUGUAAAAUAACAAUGACUAUUUUAAACUCGAAGACCCACUAUUUUGAGUAUUUUUUAUAGACUUUAAAUACUGGGUUUUUUUCCUCCUUCAAUCUCAGGCUUUUCUCCAUCUUUUAAGCAGCCUCUGUAACUCCCUUUUGUCCAUAGGUGUUGCGUGCCUCUCAUCUGUGGGGAAGUAUUAUUUAAUAAAAUUUAUGUUACAGGAUAACUUUAUUUUAAUGGGCAUGGGCUUGUCUAUACACAAAGGUAUGUAUAUUUUCAUUAUAAAAAACCAGUUUAAAAUUUUUUCUUAUUUUAAUUGUUUGAAAUUUUUCUAGAGCCAAAGAAGCUCUUUAAAGAAGUUGUUUCUUCCAAAGAACAAAGCCAGGUUAAUGACAUUCAAUUCUAAAUGAUACAUUGGAAUUGUGCCUUUUCUACCACACUGGAUUAAAUAAACUUGUCAAAAUAUGGUUUUGUCAUUUUCUGAGA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 131544)
crystallin beta-gamma domain containing 3
strand +
DKFZp667G2110
NCBI CDS gene sequence (8913 bp)
5'-ATGTCCAGCGGCCGCAGAAGGGGCAGCGCCCCCTGGCACAGCTTCTCCCGGTTCTTCGCTCCCCGAAGTCCTTCCCGGGACAAGGAAGAGGAAGAGGAGGAGAGGCCGGGGACGAGCCCGCCTCCAGCTCCAGGCCGGTCCGCTGCCAGTGTTGAAAATGAGCCCATGAGCACAAGTCAGAAAAAGGAAAATGTACTTTCATCAGAAGCAGTAAAGATTCGCCAAAGTGAGGACAAAAGGAACCATGCTGAGAAGCCAGTCACTCTTCCAGTGCAGGAAGATCCCAAAAAGGCATATGATCTTTCCAGTTCCACTTCAGATACCAAAATAGGAGAAAGTGACAGACAGCCAAAAGAAAGCTTTTTTCAGTTTCTTGGTAACTTATTCAATATCTCGGGGAAATCATCTCTAGGTGAAGCTAAGCAGTCTTCTTTCAAAGATGACCAGGATAAAACTGAGAAGGATTTACAAAATCCCAGTGACCATCATGAAGACGGGATCAAAAGGGAGAGAGAGATTTTCAGTGGCTCCCTAAGAACCCAGACACATCCAACAGAAGAACAAGACTCTAACTCATCCGAACTCTCAGATGCTTTTTCTTTGGATACAACACAAGACAGTGACCAAGAAACCACTAATTTGCTAAAACAAATCGATGGTAAACCAGAGAAGCCTTCAGTAACATATGCAACATATCGAGGCCCAAGACACATTGGGAAATATTTAAAGCAACAGACAGGCTTGGCAACTGTGAATACCTTGGACAGAGAAAATGAAAGTTCTGACTCTAGTACAAACAGACACATTGACCCTGGAAGTGAGATTGAGGCTGGGGTACTGCCACTGTTGTTATCAGCTAGTACAGACTCATCTATGAAAGGAAATCTACTTGAAGGCCCATTAGAAGACTCTGATTGTAGCAAAACAAGTTTCAACAAGGAAAATTCTTTGACAAATAACCCAGAACTGCAGAATATTGCCTCTTCCAATAATCTTTTAAATAAAAATGCTTGGGGGAGTATTGAGAGAAATAGGTCATCCCCTTCTTCTGTGACTAACTCCAGCTACGATGGAGAATCTGACTCACAGCACCATTTAAGTTGTGAACCGGTTTCTCAGACTAACAGAAATTTGGTATGTTCAGCATTGTTAACAGGAAGTAACCATCGCAAAGTCCCTTGCAGCCCAGATTTTCAGAGAGTAACTACAACAGAAAATACGATAAAAGAAAACAGCACTGTGATGAGTAATAGGACATTGGTGCAAAGAGAGGAGCTTGTTGAGCCTCAGGGCCCTGCTATTTCTGATTTCTCTTGTAGTAAATCTGATGGGAGTGACACTACTGAGCAGGAAAGTACAAATTTGCCAAGTCCAAATAAATCAATTAGGCATGAACATCTGCAGTTGCCAGAGAGTGAGTGTTCTGACAAGCAAACCATAGATAGCTCATCAAAGCAAGCTGCCACTCACACCAATATCATTGCTCTTCAGAGACATGCTGTGACAGACACAGAATTTGTAAATGAAGGAAAGAGATTGTCTGCCCAAGACTCACAGAAAAATGTGGCTGTTAGAGAAATCAGGCGAGAAACAGAAAGTGCCTCAGCTGGTGAATCCATAGCTTCAAGTCATGTAAAAGCTCCAGAAGATAAAATTGAGTCATTACCCAAAGATACTGACCAATACTTTGAAACCAAAGCCAAAAAGCTTGATTTTAGGTCACATGATAAAATTCCTCATATTAGAATGAATAAAAAAGACCTGGCCTCTTTAAATTACATCAGTGAATCAGCAGTTGTAGCAAGCTTAGGAAATGAAAATGCACCTGAGTTGAAATTTGAACTTAATAGAAGTCACATTTCAGAAACTCCTCTTGACTCTGAGAGTCCTCAACAAGCTGAAGTATCACCTGATGCTAAAACATCTCTTAGCCTTGACTGTAAAAAACTAAATTTCAGTATTTCACCTCCTACCTTTGTTTCTGGAGTTGGGATGCTGAGCAAGTTGGATATTCCTGATTTAATGAATGAGGGTTCTCCTGTGCCCATTGAAACTGGGAATGTCAACATTGTTGGTATTTCCTATCAGCCTAGGAAGTGTAAAGAAGAAAATGTGAAAAACCATGTTGAGGCTGCAGGCAGGAAGAGTCCTCCTCCTTCCTTTTGCCTTGAATATACATCTGCAATTTTTGAATTCAAAGAAGTTCTTTCTAATAGTGAAAAATGCCAGGTTCTTCCAGGTTCTGAAGCCAGTGGCCCTCACTTAACTGGGTTGGAGCTATTGAGCTTTGACTCTGGAAACCTCTCTAAGGATTGCAGTTCCATTTTATCTCAAGACCCTAATAGAGTAGAGTTAGTGTCTTCAAACACTAAAGCAAATATGAGCATAATAGAGAAGTCTGATTCTCTTTCCTTGGAAGCCAAAACTGCTAACATTGTATCAAAAGCTGAAATTGATGGTCAGAACAATGTTCTTGTGGAGTCACATTCTGGAAGAGGAAAAACTATATCCTTGTCCAAGGTATCTCTTTCAAAAGTGGAGCCCAGAAACATTTCTCAGGATAAAATGTCTTCTTTTCCATTGAAAATTACCCATGTTCCAGAAAAGCCTATTTTGTCAGAATTAACCTTTCTAGAAGTTGAACAGGGCAAACGTTTTCAATCAATTAATCATAATGAGATAGGAGAGAAATGTTCAGATGCTGGCCTTAAAGAGAATTGCCAAGCTGAGCTTTCTCCTGCTGCCTCCAAATATGAAGATAAGCCAGAACCAGAGGTAGATGCCTTAGGCTCTCCTCCTGCTCTTCTTAAAAGTAATATATCTTGGATTTTACCACCTATTCATGATGAAAAAATCAGTAGGCAAATGGCGCAGAATTGTGAAGCTCACACTTGTGTGTTTCATCAATCTTTGGATATTTGTGGGACTAAAAAGATTTCTGGTCACTCAGAAATGGCGGAACTCAGCTTAACTAATATTTCCCCTAAATTCCAAGAAACTGGCAGCATGAAAGTAAATTCACCTTTTCTGGATTCTGATTCCAGTTTGGAAAAAAATTCTTCTGCATCTGAGGACTCAAGCTTCCTTAAAGTACCTTCTGTGCTGAAATTGGAAAAGAAATCCTCATCTTACAGAAAGAAAGAGAACATCCATTTTTTAAATGGTGGTATTGATAGTGTGTCATCTTCCTCTAGTTACCCTGAAGAAGTTAGCATGATAGTAAATTCACATAAGCCCCAAAATAATTTGGATTCTATACAAGTTACCAAAGATCTCACACATGAAGGTACCTCTGTAACTAACCTGTTGTACCCTACTACCTCTTATTTGGAATTTGAAACGTCTGTCTCAATTGGGACAGAAGTAACCCCATTTCAGGAACATTTTGGGATTTATACTGGGAAGATATCCATTGATTTCCCAACTGCTGCCCAATTTGACAATCTCGTGGAAGCAGAGACTGGAGCAGTTGCTGGGCCTGCAGCGTCAGTTAACAGCTCAGGCCAACAGTGTTCTGAAGCCTCTGCTGAGCACATAGAAGCCAGGAGAAGAGCACATGACCAACTTTTGGACCTCAAAAGTAGTTTACTCAAAAAGGCCGATACATTGATTGGTGAGATTTTTAATTCTGTCAGGGAAGAACTAAAATTCAAACACACAGTGAGTACCTGCCAGGAGCATATAGCCATAGAAGGTATAATGAATCTGGGTACCCTGAAAGAAGACATCTCTGAGAAAAACCCATCAGAAGTGACACTAACAGAAATACAACAGACAGAGGGTTTGGAAGAGCAAGGCATGGAAAACATGTCAGAAGTCAAAGAGAAGCCCTGTGTTTCACCAACAGTTGGTGAGAAGAATCTTCTTGTTGATCCTAATAGTATGAATGTATCTTGTTTGTTAGAAGATAAAGCTAGGGAATTAGTCAATGAGATTATTTATGTAGCCCAAGAAAAATTGAGAAATGATACTTTTGAAGATACTGAGGATACTTGGGATTCTGAACTTCAGGCTAATACTTCAAAAATTCTGAACAGTGATAGTGTTAAGCCACATGATGTAGTTAGAGAGTTCTTGGTTTCAGAACAGCCAGTAAATCAAAGCACACAAATTAGTGAAAATAAAGTATTAAATGAATTCTTCTCCCTAAGTAACTTAGCTAGTGGCACAGAGTCAATTAAGGGAGGAGAAATTGTTCTCTACCAAAAATCCCTATTTTCTGGAAATGGATCTGGACTGTCTGATAGTATAAATTTGCAGGAATCAGATACGGTTTTACTAGCTGAAGACATGTCACATAAACGGTTAGATGATAGGGTAAAAACACATTTATTTCGCAGTGAGGACTGTAATGAGACAATGGAAATAGAGAATGTGGATAATAACAAAACTGAGACAGAGGACAGAAGAACTCTTGTATTAAATTTCAAATGGCCTCCACTTGTGAATGATGACATCCATGCACCTGGTACATCTAAAAGCAGTTTGTCTGATAGCCTTGTATGTATATCTGAAAAAAACTTGCCAGGACACAGTAAAAACACACCTCTTGCAATGTCAGATGTAGGGAAAGTACACAAGAAGGATAATGAAATAAATATAGGGAAAATTGAACTTATACCTTCCATGTTAGAAACAGGGAAAACAAACAAAAAGGATGCTGAATTGAATATTCTGAAATATGAGGCAGTCCCTCCTATGATAGAAATGGGAAGAATACATAAAATGGATGCTGAATTGAATGTCACGAAAACTGAGCCAAAAGCTAATGTTTTTAAAATGGGAGAAGTATACCAAATGGATGCCGAGAGCTGTATTGAAAAAACTGAGGGATCAGCTGTCATTTTAGGAATGGAAAAAGCTTATAAGATGAAGGATACTGAAGGGGATATTGGCAAAATTGAGGTGATACCTATGATGCCAGAAGTGAAAAATATCCACCAAAAGGATGCTGAAGGGGATATTGTAAAGACTGAGATGACACCTGTTACAGTAGACATGGAAAATATTTACCAAACGCATGCTGAAGGGGATATTGGCAAGACTGGGACGATAGCCTTGTCAGAAGTGGAAAATATCCACCAAAAAGGTGGTGAAGGGATTAGTGAAAAGGCTGAAGTGATACCCGTTACATTAGCAATGGAAAATACTTACCAAAAGGATGCTGAAGGGGATATTGGAAAGGCTGAAGTGATGCCTGTGAGGTTAGAAATGGAAAATACTTACCCAAAGGATACTGAAAGAGACGGTGGCAAAACTGAGGTGATGCCCCTTGCATTAGAGGTAGTAAATACTTACCAAAAAAATGCCAAAGGTTTTACCGGGAACACTGAAGGGTCTGTGTTGAAAATGGAAGCTACTTACCGAAAGACTGCTGAAGAGGTCATTAAGAATACTGAAATAGTACCGTGTGTGTTAAAAGTGAAGGAAGCACACGAGACAGCACCTGCCCCCTTAGAAATGGAAAAAGCATGCAAGAGAGATGTTAAAGAGACTATTGGAGCAACTGTGTCCACACCCTCTGTGATAGAAATGGAAAAAATATCCCCAGAAGATCGTGGTGAGAATATTGGGAAACACAAAGTGTTACCCGCAGTGGTAGACATTGAGAAAATACATGGAACAGGACTAGAATTGACCACTAAACAAGGGGAGGCCATGCTTCCTGCATTTGAAAGTAAAACACCACAAGAGTATGCTGAAGGGAGTGTTGAAGAAACAAAGGAAGAGCCTACAGAAATAAAGGAAGGCTTGATAGCACATGAAAATAGACTTCCTACATATTTCAGGGGATATGAATCCCCTACATTAAGTAAGGATTATGAGGGCTACCCAGCCCCAGCAATGCCAGATTTTCAACCTGGGGATACCACAGTAAGACTAGACAAAAGAATGTCTCTTACTGCAATATATGACAAGAGGAGAGAGACAGATTATAGTGACAAAGGATATAATTTAGCTTTTGTTTCTCAAGATGAACAAGAAAATTCTTCCTTTACTATATTATACGAAGAGCCCCTTCAAGAGGAGGACAAGTATGCTTCCGCAGAAGCAAGACAAACACAGTCTGTCTTGTTTCATGATACGTCCGCTGACAGCATGCCTGTTCTGGCATGTGAAAGGTCTGAGAGTAGAACTGACCTTGTCCATCACTTTGAAAAAGGTACTAAATTAGGTGAGACATTTGATAGTGATAGTTCAGAAATGTTCTTATCAGTGGAGGCCAAAAGGTACAAAATTTATCCTTTAGCATTGTCTCCCATTTATGAGGATGACAGCTCACAGGAGGACATTCTATCTAGTGAGGTTTCACCTGGTCACCATGGCCCCAGGAAATCAAGAGACAGTGAAAACCAGTCCTCTTCTGTTTTATCCCTTCTCCAGTCAGTGTCAGAACGTTTAAAGATGAATTTTGATGAAGATGACAGAGAGGCAGCTGATGAGGAAGAAGAGGAGGAGGAGGCAGCAGTATTGCATAAAGGAGATCTGAGAGCTGGAAGTGGGGAGCGTGTTACCTTCCAGTTGCCAGATCCTTCCATCACATTTTACCCTGATGACCAGGAGAGCGTTGGAATTTCTAAGAATTCATATGTGATGCCAAATGAACCTACTACCTCCAATCTGCAAGTTGGTCTGTGGCCAGAAAAGACCTCGTTTCTCCAGAAATCTGACCTTACTTCTAAACTACATTCTTCTTTAAAGAGTGCTTATCATCAGTATCTGCAGACTTCCCAAAGTCATTCCTCAGAAAAAGGAGCCAGATTTGGTGGAATTTTTCAGGAACCAGTGTCAAAATATTTCCGTGTTCAAGACAGCCCAGGCAGATTGAGCCCATTTATAGAGAATGTTGACAAACAAACTCTGAGATGTAACCCAAGACCTGGGAAGATGGTTATCTATGATCTCCATGAAAGTACATATAAACAAGAAGTCTACTGTAATATTCCTGATGCTACATCATGGTCTTTTCCAAATGGAGTTCTAATAAAAGTTGTAAGGGGCTGCTGGATTTTATATGAGAAACCACATTTCCGAGGTCAGAAATGTGTGCTAGAAGAAGGGGAAAAGGTGTTAAATCGTGACTGGATTCTTCAGAACAGAAGGCATCCACAAAGAAACTTTATATTGGGTTCTCTCAAACGTGTCTTAAAGGACTGCAGCATTCCAGAAATAGAGCTTTTCCCACAATCTGACCCAGCCTGTTGTCCTGTCTACATACAGAGAGCAGTCCCCAATTTGGAAGAACTGAATATCTCCAAATCTGTGTCCTTCACTGTGAAGTCAGGAGTTTGGCTTGCCTACCCAGATATTAATTTTAAGGGACAAGCTACAGTTCTGGAGGAAGACCATGGGCTCTTTGAGATTTCTACAGCAGAAATGAAATCATTACATCCGCTTCAAATGGGTGGACTGAAAGTGGAAATGCCCATGAACTTAAAGGTTATTATTTATGAAAAACCTCACTTCCATGGACAGGCTAAAGAGTTTAGTGAACATATAGATTCTGTTCCTAATTTTTTGAAAAATAATGGAGATTTTCACAGAATTGGATCAATTCGTGTCATTGGTGGAGTGTGGGTTGCCTATGAAAAAGAACATTTTAAAGGCCAGCAGTTTCTGCTTGAAGAAGGAGACTTTGAAGACAGTAATGCTTGTGGTGCATTAAGTAGCCCTATCTTGTCTTTCCGGTACTTACAAGCTAATTTTATAGAATCTTCTGTCACACTATTTGAATCTGACCTAGAAAGTGGGAAGTTTATTGACATTACAAATCAGGAAATTTCTGATTTGGAAGAAATTGGCTTTGGCAGTAAAACAAGATCCATTCATGTTAAAAGTGGAGTATGGGTTGCCTACCAGCAAAAGTTCTTCTGTGGAGAACAATACATTTTAGAAAAAGGGAAATACAAATGCTTTTTTGACTGGGGAGGATCAAATAATATAATCATGTCGATACGGCCAATCCAACTGGAACCACTTGGGATAAATGAACCTCCGCATTTGCTCAAAGCATTCAGCAAACCAGGGTTCCAAGGTGAATGTATAGATTTTACAGAAGAAACTTCTGATTTGACTTCACTCATGCCATGTTCTTTTAAAGTTCTTCGAGGTTGCTGGCTCCTCTATTACCAAGAAGACATGTTTGTTAATCACTGTGTGTTAGAAGAAGGCCTCTATGCTGACCTTACTTCCTGCGGTTGCCCAGCATCTAAAGTCAAATCTCTCAAGCCCATTGACTATGTTTTTGAAGAACCCTCCATCAGCCTTTTTGCTCTGGAGCATTGTGAGGGAAGAGAGTTACATCTAGAAGAGGCTGTGAACTCTGTTCTGAACAAGGACCTACACTTCTACACCCAGTCTGTGTGGGTAAAAAGTGGACTATGGATAGCTTATGAAGGATCCAATTTCTTGGGAAGACAAATCCTACTCAGGCCTAATGAGATCCCAAACTGGACAGCATTCAGCAGATGGAAAACAATTGGTTCCCTCCGTCCTATGAAGCAGCCTGCAGTGTACATCAGAATAAAGAACCGTGCCCAGGGTGAATATCTGACAGTCACTGGAAGTCTAGCAGACACCAGGGCAACATCTGTGTGCATTTCTCCCTATAGTGGAAAGAATACTCAGATCTGGTACTACTGCCGAGGACTCTTTAAATCCAAGGCCAGTGATACATGTCTTGATGTGATTGGTGGCCGGGACACACCTGGAGCTAAAGTAGCTCTATGGACTGAACATGGGCAATTCAGGCAGAAGTGGAGACTGAATAAAAATGGAACTATCAGCTCTTATCTCAGTGATCAACTTGTCCTTGATGTTAAAGGAGGAAATTATTGTGACAAGACTCATGTAATTGTAAATCAGCCCCTGGAGGGAGAAGAAACACAGAAATGGGACATTGAAATATTGTGA-3'
NCBI CDS gene sequence with introns (location: 97822207.. 97943314) (121108 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 97822011.. 97944984) (122974 bp)Download
NCBI gene sequence (location: [97822011 - 1000].. 97944984) (123974 bp)Download
Cite How to cite