NCBI Summary
This gene encodes a member of the doublecortin family. The protein encoded by this gene is a hydrophilic, intracellular protein. It contains a single doublecortin domain and is unable to bind microtubules and to regulate microtubule polymerization. This gene is mainly expressed in adult testis. It does not have a mouse homolog. [provided by RefSeq, Sep 2010].
Protein
Protein (NP_001374203)
Doublecortin domain-containing protein 1
Doublecortin domain-containing protein 1 (Doublecortin domain-containing 5 protein)
DCDC1
doublecortin domain containing 1
Undefined
Very low evidence
Ricin-like
Undefined
b-trefoil
Uncharacterised
Undefined
Undefined
Protein sequence and protein families (fasta) (1786 amino acids) Download
MAKTGAEDHREALSQSSLSLLTEAMEVLQQSSPEGTLDGNTVNPIYKYILNDLPREFMSSQAKAVIKTTDDYLQSQFGPNRLVHSAAVSEGSGLQDCSTHQTASDHSHDEISDLDSYKSNSKNNSCSISASKRNRPVSAPVGQLRVAEFSSLKFQSARNWQKLSQRHKLQPRVIKVTAYKNGSRTVFARVTVPTITLLLEECTEKLNLNMAARRVFLADGKEALEPEDIPHEADVYVSTGEPFLNPFKKIKDHLLLIKKVTWTMNGLMLPTDIKRRKTKPVLSIRMKKLTERTSVRILFFKNGMGQDGHEITVGKETMKKVLDTCTIRMNLNLPARYFYDLYGRKIEDISKVPLLEKCLQNSITPLRGLLWVSKGEGFSPSGAKMYIQGVLLALYQRLKSAKKYYKQLNLVMNEQKEKITEKVILSMTAKEHHKEQEEVSRLIDELQTAIKSNIGHLCKLGPQLQAEQEQFSSYVYQHIKSLPANTLVPGGLQLKVFENGKNTGEISVGISKKDLGSDSPIQTDHMMERLLLKIHQRLQGSSINPPGLNYSSMRLFDENGQEIKNPLSLKNEQKIWVSYGRAYRSPLNLALGLTFDRVSAFARGDIMVAYKTFLDPNAVLLPGCGNWEVCEGFPINFNCTSQQIPDQFEKVDLENHFLQNKVDPNIVLHASVSIGKWSFSGSEASSRSQIAPSILWPVASVWLITKTGMILSRAITQGCLAIGHPIRVKAAEGTSLEGYKLILQKRHSGDDSQKWVFGTDGCIYSKAYPQFVLTYLEELNAQVDVTQTEYHIHHGAWTTAHQEHGRNLAEEVLQESASNLGLKQLPEPSDTHLMPEGSLEETGELTVALVRKLEEKHPKASAQRWAIKHEGTSKPGQWKHSRVENPLWNKLTYMWPVLPSGQLNEEFDWPIQGLLVPSSPPMKKPICKTTEPYAPVRLRVLQNGEKNKNRSVTILGPDISPGRKTQCTEILNLPSAARRLYNEKGKEIFALKDLQRDELVYVSCGELWINPDLSIAQQKKQIFLRNLESDIAKIQIFCSTHKIEALVLEVQSDIVSGSKLAVHKPVAIFGEEKQVTEPEEKQMQEDPLTTENASSEILDSHVRAHLRMKACHTLPRYAWQETSHDFDEDDSLPKKTEKGLFENVEPQKKHSCSPKHSKLHKHCHQQFEYRDGQIISHAAPQLVLGVQGPNLRSGMEVVLVEKKSDGSHQRWIHQEDSRTFHLVSNPDLVLAVSMTKTRNEVCGYPVIVQKYKPYNNGAANQKWHYMKNIKALVAFHSTALDKEITSANYAGVCTSSVIKEENIDQPGYCYLSPDGKRKTMLCLACGQSMRTEKGLKQLLPGVPFLCISGTKTQKPFLQGPFKVISVAEVDLSCDKAEKTLSYYQARLLSLRMKTCTQAASHSGMAATHQKAVKIIAYKNGDGYRNGKLIVAGTFPMLLTECTEQLGLARAASKVYTKDGTPIFTLRDLVLWALDESFLQRDSEKQKQDAAPVGKEQIIVESMEENPRMKVKNRLFAKSVTSDSLDGIDKSLLTLILRNPIAIWVSCGEPFLPPNALQKAEKLEKQNWLKKDRILADLDTMRHKMRQLKGRRVAACQPATMVPTKSPVQPVVVEGGWTEQTQQEIKLMELIRHTEAHLSEIQEMESKINFPIATKRIAVKPSNLYKQPNTKRVWIYLNGGRPEDGTYAWGKTISELLQDCSSRLKMTHPARALYTPSGEPIQSWDDIERDMVICVSMGHGFKTPKELKQLMEIRANYARIRRQQGPQATDIVVSPSTKLLSLAHLHN
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [ err > 2 Å]Download
The location of the lectin domain structural model is: 702-800
We infer [ err > 2 Å] as the interval of error of this structural model.
Template: 1XHB chain: A, O08912, NP_001153876.1, sequence identity: 13.1%, coverage: 59.6%, location in sequence: 95-553, (95-553 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (7 PubMed Identifiers)
  • Meta-analysis identifies multiple loci associated with kidney function-related traits in east Asian populations. [22797727]
  • Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. [22504420]
  • Linking cytoplasmic dynein and transport of Rab8 vesicles to the midbody during cytokinesis by the doublecortin domain-containing 5 protein. [22159412]
  • A 556 kb deletion in the downstream region of the PAX6 gene causes familial aniridia and other eye anomalies in a Chinese family. [21321669]
  • The doublecortin gene family and disorders of neuronal structure. [20236041]
  • The evolving doublecortin (DCX) superfamily. [16869982]
  • Identification of a novel human doublecortin-domain-containing gene (DCDC1) expressed mainly in testis. [12820024]
UniProt Main References (2 PubMed Identifiers)
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • Human chromosome 11 DNA sequence and analysis including novel gene identification. [16554811]
All isoforms of this gene containing a lectin domain
XP_024304249.1, XP_024304248.1, XP_024304247.1, XP_024304246.1, XP_024304245.1, NP_001374203.1, XP_024304239.1, XP_024304240.1, XP_024304241.1, XP_024304243.1, NP_001354908.1, XP_024304244.1, XP_024304250.1
RNA
RNA (Transcript ID: NM_001387274.1)
doublecortin domain containing 1, transcript variant 6
m7G-5')ppp(5'-AUGGUAACCGGUCACCGCUUCUAUGGAGUGGCGUUUACUACCAAUUGCAAAUAAGAAAAUUCCAGAUUCCAUUCCAAGAUGGCCAAAUAGGAACAGCUCCAGCCUGCAGCUCCCAGCGUGAUUAAUGUAGAAGAUGGGUGAUUUCUGCAUUUCCAACUAAGCUGAAAAUGGCAAAAACAGGAGCAGAAGAUCACAGAGAAGCACUAUCUCAGUCUUCCUUAUCCCUCUUGACUGAAGCAAUGGAAGUAUUACAGCAAAGUAGCCCUGAAGGCACUUUGGAUGGGAAUACUGUAAACCCAAUUUACAAAUAUAUUUUGAAUGAUUUACCAAGAGAGUUUAUGUCAUCCCAGGCAAAAGCAGUUAUUAAAACUACUGAUGAUUAUUUGCAGUCUCAGUUUGGCCCCAACAGACUCGUGCAUUCAGCAGCAGUAUCAGAAGGGUCAGGACUUCAAGAUUGCUCCACACAUCAAACAGCAUCAGAUCACAGCCAUGAUGAAAUAUCAGACCUAGAUAGCUACAAAUCAAACAGUAAAAACAAUUCUUGUUCUAUAUCAGCAUCCAAGAGAAACAGACCUGUCAGUGCUCCAGUGGGUCAACUGAGGGUUGCAGAGUUCUCUUCUUUAAAAUUUCAGUCAGCCCGGAAUUGGCAGAAAUUGUCUCAAAGACACAAACUUCAACCAAGAGUGAUUAAAGUAACAGCUUACAAAAAUGGAUCUAGAACAGUCUUUGCCAGAGUUACUGUACCAACCAUCACCUUGCUGCUGGAGGAGUGCACAGAAAAGCUGAAUCUGAACAUGGCCGCAAGACGAGUGUUCUUGGCAGACGGCAAGGAAGCCCUCGAACCUGAAGAUAUACCCCAUGAAGCCGAUGUUUAUGUUUCAACGGGAGAGCCCUUUUUAAAUCCAUUCAAAAAAAUUAAAGACCAUCUGUUGUUAAUUAAGAAAGUAACUUGGACAAUGAAUGGGUUGAUGCUUCCUACUGAUAUCAAAAGACGGAAAACCAAGCCUGUUCUUUCUAUUAGAAUGAAGAAACUUACUGAGAGGACCUCAGUCCGAAUUCUGUUCUUUAAGAAUGGCAUGGGGCAGGAUGGGCAUGAGAUUACAGUGGGAAAAGAAACAAUGAAAAAGGUUUUAGAUACUUGUACAAUAAGAAUGAAUCUAAAUUUACCAGCCAGAUAUUUUUAUGAUUUGUAUGGCAGAAAAAUUGAAGAUAUUUCAAAAGUUCCUCUGCUUGAAAAAUGCCUGCAAAAUUCCAUCACACCUUUGCGAGGACUACUUUGGGUCUCUAAGGGAGAAGGUUUCAGCCCCUCAGGAGCUAAGAUGUACAUCCAAGGAGUUCUUUUGGCCCUGUACCAACGAUUAAAGUCUGCAAAAAAAUAUUAUAAACAGUUGAACCUGGUCAUGAAUGAACAGAAGGAGAAAAUUACAGAAAAAGUCAUUCUUUCAAUGACGGCAAAGGAACACCAUAAGGAACAGGAAGAAGUGAGCAGGCUGAUUGAUGAAUUGCAGACAGCUAUCAAAAGUAACAUAGGUCAUCUCUGUAAACUUGGCCCCCAAUUACAGGCUGAGCAGGAGCAAUUCUCCUCUUAUGUCUACCAACACAUUAAAAGCCUUCCAGCAAACACGCUUGUCCCAGGAGGCCUGCAGCUUAAGGUAUUUGAAAAUGGUAAAAACACUGGAGAGAUCUCUGUUGGUAUCAGUAAAAAAGAUUUGGGAUCGGAUAGCCCAAUUCAAACUGACCAUAUGAUGGAAAGAUUACUUCUCAAGAUUCAUCAAAGGCUUCAAGGUUCUUCCAUCAACCCACCAGGCCUCAAUUAUUCUUCAAUGCGGCUUUUUGAUGAGAAUGGCCAAGAAAUUAAGAAUCCACUUUCGCUGAAGAAUGAGCAAAAAAUUUGGGUCUCUUAUGGUAGAGCAUACAGAUCUCCACUAAAUCUUGCUUUGGGUUUGACCUUUGACCGAGUGAGUGCAUUUGCCAGAGGUGAUAUCAUGGUUGCAUAUAAGACCUUUUUGGAUCCUAAUGCUGUUCUGCUACCUGGAUGUGGCAAUUGGGAAGUUUGUGAGGGAUUUCCAAUUAAUUUCAACUGUACCAGUCAACAGAUACCUGACCAGUUUGAAAAGGUGGACUUGGAGAACCAUUUUCUACAGAACAAGGUAGAUCCCAAUAUUGUCCUUCAUGCCUCUGUUUCCAUUGGAAAGUGGAGUUUCUCAGGCAGUGAAGCAAGCAGCAGGAGUCAAAUAGCGCCAUCGAUCCUGUGGCCUGUAGCCAGUGUGUGGCUGAUCACCAAGACUGGAAUGAUCCUGAGCCGAGCGAUAACUCAGGGCUGCCUGGCUAUUGGUCAUCCUAUCAGAGUCAAGGCUGCUGAGGGAACAUCACUAGAAGGAUAUAAAUUAAUCUUACAGAAAAGACAUAGUGGAGAUGACUCUCAGAAGUGGGUGUUUGGAACUGAUGGUUGCAUUUAUUCAAAGGCUUAUCCUCAGUUUGUUCUGACCUACCUAGAGGAGCUAAAUGCACAAGUAGAUGUGACCCAGACAGAGUAUCACAUUCACCAUGGUGCCUGGACCACAGCUCAUCAGGAACAUGGCAGAAACUUAGCAGAAGAGGUUCUGCAAGAAAGUGCCAGCAACCUUGGUCUGAAGCAACUGCCAGAACCCUCAGACACCCAUUUAAUGCCAGAAGGUUCUCUUGAGGAGACGGGGGAGCUGACAGUAGCACUGGUGAGGAAACUGGAAGAGAAACAUCCUAAGGCUUCUGCUCAGAGGUGGGCCAUAAAACAUGAAGGAACCAGUAAGCCAGGCCAGUGGAAACAUUCUAGAGUUGAAAAUCCUCUAUGGAACAAGCUUACCUACAUGUGGCCUGUCCUUCCCAGUGGCCAACUUAAUGAGGAGUUUGAUUGGCCAAUACAAGGACUGCUUGUUCCGAGCAGUCCUCCCAUGAAGAAACCCAUCUGUAAGACAACAGAGCCAUAUGCCCCUGUGCGACUCAGAGUUUUGCAGAAUGGAGAGAAGAAUAAAAACAGAUCCGUUACUAUCCUUGGUCCAGAUAUCUCACCUGGACGGAAAACGCAGUGCACUGAGAUUUUAAAUUUACCUUCUGCAGCUCGGAGAUUGUACAAUGAAAAGGGGAAGGAAAUAUUUGCCUUAAAAGACCUGCAAAGAGAUGAACUGGUGUAUGUUUCAUGUGGAGAACUCUGGAUCAAUCCUGACCUGUCCAUUGCUCAGCAAAAGAAACAAAUAUUCCUGAGGAACCUAGAAUCAGACAUUGCCAAAAUUCAAAUCUUCUGCAGCACACAUAAAAUAGAAGCUCUUGUUUUAGAAGUCCAAAGUGACAUUGUAUCUGGAAGCAAGCUUGCUGUGCAUAAACCUGUAGCAAUUUUUGGAGAAGAGAAGCAAGUUACAGAACCGGAAGAAAAGCAAAUGCAAGAAGAUCCUCUAACAACGGAAAAUGCUUCCAGUGAAAUUCUAGAUUCACACGUAAGAGCUCAUCUUCGAAUGAAGGCUUGUCACACACUUCCCAGGUAUGCCUGGCAGGAAACUUCACAUGACUUUGAUGAGGAUGACAGUCUUCCAAAGAAAACGGAAAAAGGGCUCUUUGAAAAUGUGGAACCACAGAAGAAACACAGCUGUUCACCAAAGCAUAGUAAAUUGCACAAGCAUUGUCAUCAGCAGUUCGAAUACAGAGAUGGGCAGAUUAUAAGCCAUGCUGCUCCUCAGCUAGUCUUGGGGGUUCAAGGUCCCAAUCUCCGAUCAGGCAUGGAGGUGGUUUUGGUGGAGAAGAAAUCUGAUGGUAGUCAUCAGCGCUGGAUACACCAGGAAGACAGCAGGACCUUUCACCUUGUGAGUAACCCUGACCUUGUGCUGGCAGUGUCUAUGACCAAGACUAGAAAUGAAGUUUGUGGCUAUCCAGUUAUUGUUCAGAAAUAUAAGCCGUACAACAAUGGAGCUGCCAAUCAAAAGUGGCAUUACAUGAAAAAUAUAAAAGCACUUGUGGCCUUUCAUAGCACUGCCUUGGAUAAGGAAAUUACAUCAGCAAAUUAUGCUGGUGUCUGUACAUCAUCUGUGAUUAAAGAAGAAAACAUUGAUCAACCAGGAUACUGUUAUCUCUCACCUGAUGGAAAGAGAAAAACUAUGCUCUGCUUGGCUUGUGGACAAUCCAUGAGAACAGAGAAAGGACUGAAACAAUUGCUUCCAGGGGUUCCAUUCCUCUGUAUUUCAGGCACCAAGACUCAGAAGCCCUUCUUACAAGGGCCCUUCAAGGUCAUCAGUGUGGCUGAGGUUGAUUUGUCGUGUGACAAGGCUGAAAAAACUCUAAGUUACUACCAAGCACGUCUAUUGUCUUUACGGAUGAAGACCUGCACGCAAGCUGCAUCUCACAGUGGCAUGGCAGCCACACACCAGAAGGCAGUGAAAAUAAUUGCAUACAAAAAUGGGGAUGGGUAUCGUAAUGGGAAGUUAAUUGUGGCUGGAACAUUCCCCAUGCUUCUUACAGAAUGCACGGAACAACUUGGGCUUGCCAGAGCAGCCUCCAAAGUAUAUACCAAAGAUGGAACCCCAAUCUUUACCUUGCGUGAUUUGGUUUUAUGGGCUCUAGAUGAAUCCUUUCUCCAGAGAGACUCUGAGAAACAAAAGCAAGAUGCAGCUCCUGUUGGAAAAGAACAGAUAAUUGUUGAAAGUAUGGAAGAAAAUCCAAGAAUGAAAGUGAAAAACAGAUUAUUUGCAAAAUCUGUGACAUCCGAUAGUUUGGAUGGUAUAGACAAGUCUUUGCUUACCCUCAUCCUCAGAAAUCCUAUUGCCAUCUGGGUGUCUUGUGGUGAACCAUUUCUACCUCCAAAUGCUUUGCAGAAAGCAGAAAAAUUAGAGAAACAGAACUGGCUAAAAAAGGACAGAAUUUUGGCUGAUCUAGAUACCAUGAGACACAAAAUGAGACAGUUAAAAGGGCGGCGAGUAGCGGCAUGUCAGCCAGCCACCAUGGUUCCUACCAAGAGCCCUGUGCAGCCCGUGGUGGUUGAAGGAGGCUGGACCGAACAGACUCAACAGGAAAUUAAACUCAUGGAACUUAUAAGACAUACAGAGGCACACCUUUCUGAAAUCCAAGAAAUGGAAUCCAAAAUAAAUUUUCCAAUUGCAACCAAACGUAUAGCAGUCAAGCCGAGCAACCUGUAUAAGCAGCCCAACACAAAACGAGUGUGGAUUUAUCUAAAUGGAGGCAGACCUGAAGAUGGCACUUAUGCCUGGGGCAAAACUAUUUCAGAGCUGCUGCAAGACUGCUCCUCUCGUCUCAAAAUGACCCACCCAGCUAGAGCACUGUACACCCCCAGUGGAGAGCCAAUUCAGUCCUGGGACGACAUAGAGCGAGAUAUGGUCAUCUGUGUGUCUAUGGGACAUGGUUUCAAAACCCCAAAAGAGUUAAAACAACUGAUGGAGAUCAGAGCAAAUUAUGCCAGAAUCCGAAGGCAGCAGGGCCCUCAAGCCACAGACAUUGUGGUGUCACCAUCCACGAAGCUGCUGUCUCUGGCACAUCUCCACAAUUAACUCCUAUCAGAACCAUCGGAUUUUCUGCUGUAUUUUUCUGGAAAGAAAACUUUCUUUACCCACUUAUAAACAGAAGACUGUGACAAGAAGGCCAAUUAUUUCCAUCGCUGAAGACUCUAAAUUUGGCAAAUCUUCUAAAUAACAAUCCUGCAUAGUUUAUUAAAAAAAAUUAGUCGUAAAAUUUAUCCUUCAAAAAUCUGCAUUUUAAAUAAACCCUGACAGUGAUUUCUCAAGACUGUAAAGAUAUUAGUCUGAGAAUGCAACUCUAACAGACUGCUCUGGGCAUCUUUUCUCUUUGCCUUGGCCAGGCCUCUCAGAAUUGAGUGAGCGUGUGACUCCAUUUGCACAGUGGGACAGAUGAGUACAACUGAAAUAAAAAGUGGAGGCCUCUGCAAAAAAUAAAAAAUAAAAAAUAAAUUUAUCCUUCAAAAUAACUCAGUUUUUUCAAUGGGCCUAUUUUGAAGAAUGAACAUUGAAAAAUGAGACAAUAUAUCCAUAAAUUCAUAGUAUGACAUACCAUAAUCGAGAGCAUUGUUAGCCAUAGACAUUUUGUAUGCCAGUGAAAUCUGUAUACAUUCUCUAAAUUUUUCCAGUUUAUCGUGUGGCUUAUUGGAAAAAAAAAAGCAUAUACACUGACUGCAUGUUUUGUCUCCCCAACUAAAUGAUAAGUGCCUAGAGGGCAGGAACACCCUUGGUUUUAUUUACUUGGGACAGAGCUCUACCCACAAGGGCUCACUGAUAAAACUCAUCAGUCCCACCCCACAGCAACAUGAUGGGGACAUGAGGUUCAGUUCUUCUACUCUUGGCCUGAGCCGCAAACCAAAAUUACAACAGUACAAUGGGAAUAGAGGAUCUGCUUUAUAGAAUUUCCUUUCAGUCAGCUGCUCAGAAACUACAAUCCUCAGAGUGAAAUUAAAUGGAGUUAUACUGGGAUAGUCCUCUCUGCUUUUCAGAGGAAAGAAACACUUCUCGAAAUUGUGCAAAUGAAAGAAAUGUCAUGGUAUAAACUAGACAUCUUAUAUCCUUAAAAUAUAUCUUUGAUGAUUAUACAUAUUGGUUUCAAAUCCCAAGUUUGAAGAAACAUCCAAAAGUUAUGUGAAAUUACUUAUAGAUGAAUUGACAACAUUUGAGACUUCGACAGGCAAUCAUGAAGCAGUUCUCAAGUUGAUUUGGUUUAUAUAGCUCUUUAAGAAUCUUUUGGAAAGCCAUAAUCUCACAAAAUACAGAUAUGCAAUUUUUUUUUUUUGAGAUGGAGUCUCACUCUGUUGCCCAGUCUGGAGUUCAGUGGCGCGAUCUCAGCUCACUACAAGCUCCCCUUCCCAGGUUCAAGCAAUUCUCCUGUCUCAGCCUCCUGAGUAGCUGGGACUACAGGCGCCUGCCACCACACCCAGCUAACUUUUGUAUUUUUAGUAGAGAUGGGGUUUCACCUUGUUGGUCAAGCUGGUCUCAAACUCCUGACCUCAGGUGAUCCACUCGCCUCUGCCUCCCAAAGUGCUGGGAUUACAGGCGUAAGCCACCACACCCAGCCCAAAAAAUGUUUGUGCACAGAACUGUGGAUGUUUGUCACAGAACUUUCCAAAUAAAGAAGUUCUGAUAAAAGAGAAGAUAUUUCUCAUUUCCAUAAUCUUUAAGGUGUGGGGGAUACGUAAUCUGGACUUCUCAAAUGGAUGAUUUCUAAAUACGCGUCAGAUGAAGUGAUUCUAACUUUCUCUGUAGUAAUAUCUUAUUUUGUUUUAUUCAAAAACAAUAAACCAUGUAGAUUUAUUAGCA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 341019)
doublecortin domain containing 1
strand -
FLJ46154
NCBI CDS gene sequence (5361 bp)
5'-ATGGCAAAAACAGGAGCAGAAGATCACAGAGAAGCACTATCTCAGTCTTCCTTATCCCTCTTGACTGAAGCAATGGAAGTATTACAGCAAAGTAGCCCTGAAGGCACTTTGGATGGGAATACTGTAAACCCAATTTACAAATATATTTTGAATGATTTACCAAGAGAGTTTATGTCATCCCAGGCAAAAGCAGTTATTAAAACTACTGATGATTATTTGCAGTCTCAGTTTGGCCCCAACAGACTCGTGCATTCAGCAGCAGTATCAGAAGGGTCAGGACTTCAAGATTGCTCCACACATCAAACAGCATCAGATCACAGCCATGATGAAATATCAGACCTAGATAGCTACAAATCAAACAGTAAAAACAATTCTTGTTCTATATCAGCATCCAAGAGAAACAGACCTGTCAGTGCTCCAGTGGGTCAACTGAGGGTTGCAGAGTTCTCTTCTTTAAAATTTCAGTCAGCCCGGAATTGGCAGAAATTGTCTCAAAGACACAAACTTCAACCAAGAGTGATTAAAGTAACAGCTTACAAAAATGGATCTAGAACAGTCTTTGCCAGAGTTACTGTACCAACCATCACCTTGCTGCTGGAGGAGTGCACAGAAAAGCTGAATCTGAACATGGCCGCAAGACGAGTGTTCTTGGCAGACGGCAAGGAAGCCCTCGAACCTGAAGATATACCCCATGAAGCCGATGTTTATGTTTCAACGGGAGAGCCCTTTTTAAATCCATTCAAAAAAATTAAAGACCATCTGTTGTTAATTAAGAAAGTAACTTGGACAATGAATGGGTTGATGCTTCCTACTGATATCAAAAGACGGAAAACCAAGCCTGTTCTTTCTATTAGAATGAAGAAACTTACTGAGAGGACCTCAGTCCGAATTCTGTTCTTTAAGAATGGCATGGGGCAGGATGGGCATGAGATTACAGTGGGAAAAGAAACAATGAAAAAGGTTTTAGATACTTGTACAATAAGAATGAATCTAAATTTACCAGCCAGATATTTTTATGATTTGTATGGCAGAAAAATTGAAGATATTTCAAAAGTTCCTCTGCTTGAAAAATGCCTGCAAAATTCCATCACACCTTTGCGAGGACTACTTTGGGTCTCTAAGGGAGAAGGTTTCAGCCCCTCAGGAGCTAAGATGTACATCCAAGGAGTTCTTTTGGCCCTGTACCAACGATTAAAGTCTGCAAAAAAATATTATAAACAGTTGAACCTGGTCATGAATGAACAGAAGGAGAAAATTACAGAAAAAGTCATTCTTTCAATGACGGCAAAGGAACACCATAAGGAACAGGAAGAAGTGAGCAGGCTGATTGATGAATTGCAGACAGCTATCAAAAGTAACATAGGTCATCTCTGTAAACTTGGCCCCCAATTACAGGCTGAGCAGGAGCAATTCTCCTCTTATGTCTACCAACACATTAAAAGCCTTCCAGCAAACACGCTTGTCCCAGGAGGCCTGCAGCTTAAGGTATTTGAAAATGGTAAAAACACTGGAGAGATCTCTGTTGGTATCAGTAAAAAAGATTTGGGATCGGATAGCCCAATTCAAACTGACCATATGATGGAAAGATTACTTCTCAAGATTCATCAAAGGCTTCAAGGTTCTTCCATCAACCCACCAGGCCTCAATTATTCTTCAATGCGGCTTTTTGATGAGAATGGCCAAGAAATTAAGAATCCACTTTCGCTGAAGAATGAGCAAAAAATTTGGGTCTCTTATGGTAGAGCATACAGATCTCCACTAAATCTTGCTTTGGGTTTGACCTTTGACCGAGTGAGTGCATTTGCCAGAGGTGATATCATGGTTGCATATAAGACCTTTTTGGATCCTAATGCTGTTCTGCTACCTGGATGTGGCAATTGGGAAGTTTGTGAGGGATTTCCAATTAATTTCAACTGTACCAGTCAACAGATACCTGACCAGTTTGAAAAGGTGGACTTGGAGAACCATTTTCTACAGAACAAGGTAGATCCCAATATTGTCCTTCATGCCTCTGTTTCCATTGGAAAGTGGAGTTTCTCAGGCAGTGAAGCAAGCAGCAGGAGTCAAATAGCGCCATCGATCCTGTGGCCTGTAGCCAGTGTGTGGCTGATCACCAAGACTGGAATGATCCTGAGCCGAGCGATAACTCAGGGCTGCCTGGCTATTGGTCATCCTATCAGAGTCAAGGCTGCTGAGGGAACATCACTAGAAGGATATAAATTAATCTTACAGAAAAGACATAGTGGAGATGACTCTCAGAAGTGGGTGTTTGGAACTGATGGTTGCATTTATTCAAAGGCTTATCCTCAGTTTGTTCTGACCTACCTAGAGGAGCTAAATGCACAAGTAGATGTGACCCAGACAGAGTATCACATTCACCATGGTGCCTGGACCACAGCTCATCAGGAACATGGCAGAAACTTAGCAGAAGAGGTTCTGCAAGAAAGTGCCAGCAACCTTGGTCTGAAGCAACTGCCAGAACCCTCAGACACCCATTTAATGCCAGAAGGTTCTCTTGAGGAGACGGGGGAGCTGACAGTAGCACTGGTGAGGAAACTGGAAGAGAAACATCCTAAGGCTTCTGCTCAGAGGTGGGCCATAAAACATGAAGGAACCAGTAAGCCAGGCCAGTGGAAACATTCTAGAGTTGAAAATCCTCTATGGAACAAGCTTACCTACATGTGGCCTGTCCTTCCCAGTGGCCAACTTAATGAGGAGTTTGATTGGCCAATACAAGGACTGCTTGTTCCGAGCAGTCCTCCCATGAAGAAACCCATCTGTAAGACAACAGAGCCATATGCCCCTGTGCGACTCAGAGTTTTGCAGAATGGAGAGAAGAATAAAAACAGATCCGTTACTATCCTTGGTCCAGATATCTCACCTGGACGGAAAACGCAGTGCACTGAGATTTTAAATTTACCTTCTGCAGCTCGGAGATTGTACAATGAAAAGGGGAAGGAAATATTTGCCTTAAAAGACCTGCAAAGAGATGAACTGGTGTATGTTTCATGTGGAGAACTCTGGATCAATCCTGACCTGTCCATTGCTCAGCAAAAGAAACAAATATTCCTGAGGAACCTAGAATCAGACATTGCCAAAATTCAAATCTTCTGCAGCACACATAAAATAGAAGCTCTTGTTTTAGAAGTCCAAAGTGACATTGTATCTGGAAGCAAGCTTGCTGTGCATAAACCTGTAGCAATTTTTGGAGAAGAGAAGCAAGTTACAGAACCGGAAGAAAAGCAAATGCAAGAAGATCCTCTAACAACGGAAAATGCTTCCAGTGAAATTCTAGATTCACACGTAAGAGCTCATCTTCGAATGAAGGCTTGTCACACACTTCCCAGGTATGCCTGGCAGGAAACTTCACATGACTTTGATGAGGATGACAGTCTTCCAAAGAAAACGGAAAAAGGGCTCTTTGAAAATGTGGAACCACAGAAGAAACACAGCTGTTCACCAAAGCATAGTAAATTGCACAAGCATTGTCATCAGCAGTTCGAATACAGAGATGGGCAGATTATAAGCCATGCTGCTCCTCAGCTAGTCTTGGGGGTTCAAGGTCCCAATCTCCGATCAGGCATGGAGGTGGTTTTGGTGGAGAAGAAATCTGATGGTAGTCATCAGCGCTGGATACACCAGGAAGACAGCAGGACCTTTCACCTTGTGAGTAACCCTGACCTTGTGCTGGCAGTGTCTATGACCAAGACTAGAAATGAAGTTTGTGGCTATCCAGTTATTGTTCAGAAATATAAGCCGTACAACAATGGAGCTGCCAATCAAAAGTGGCATTACATGAAAAATATAAAAGCACTTGTGGCCTTTCATAGCACTGCCTTGGATAAGGAAATTACATCAGCAAATTATGCTGGTGTCTGTACATCATCTGTGATTAAAGAAGAAAACATTGATCAACCAGGATACTGTTATCTCTCACCTGATGGAAAGAGAAAAACTATGCTCTGCTTGGCTTGTGGACAATCCATGAGAACAGAGAAAGGACTGAAACAATTGCTTCCAGGGGTTCCATTCCTCTGTATTTCAGGCACCAAGACTCAGAAGCCCTTCTTACAAGGGCCCTTCAAGGTCATCAGTGTGGCTGAGGTTGATTTGTCGTGTGACAAGGCTGAAAAAACTCTAAGTTACTACCAAGCACGTCTATTGTCTTTACGGATGAAGACCTGCACGCAAGCTGCATCTCACAGTGGCATGGCAGCCACACACCAGAAGGCAGTGAAAATAATTGCATACAAAAATGGGGATGGGTATCGTAATGGGAAGTTAATTGTGGCTGGAACATTCCCCATGCTTCTTACAGAATGCACGGAACAACTTGGGCTTGCCAGAGCAGCCTCCAAAGTATATACCAAAGATGGAACCCCAATCTTTACCTTGCGTGATTTGGTTTTATGGGCTCTAGATGAATCCTTTCTCCAGAGAGACTCTGAGAAACAAAAGCAAGATGCAGCTCCTGTTGGAAAAGAACAGATAATTGTTGAAAGTATGGAAGAAAATCCAAGAATGAAAGTGAAAAACAGATTATTTGCAAAATCTGTGACATCCGATAGTTTGGATGGTATAGACAAGTCTTTGCTTACCCTCATCCTCAGAAATCCTATTGCCATCTGGGTGTCTTGTGGTGAACCATTTCTACCTCCAAATGCTTTGCAGAAAGCAGAAAAATTAGAGAAACAGAACTGGCTAAAAAAGGACAGAATTTTGGCTGATCTAGATACCATGAGACACAAAATGAGACAGTTAAAAGGGCGGCGAGTAGCGGCATGTCAGCCAGCCACCATGGTTCCTACCAAGAGCCCTGTGCAGCCCGTGGTGGTTGAAGGAGGCTGGACCGAACAGACTCAACAGGAAATTAAACTCATGGAACTTATAAGACATACAGAGGCACACCTTTCTGAAATCCAAGAAATGGAATCCAAAATAAATTTTCCAATTGCAACCAAACGTATAGCAGTCAAGCCGAGCAACCTGTATAAGCAGCCCAACACAAAACGAGTGTGGATTTATCTAAATGGAGGCAGACCTGAAGATGGCACTTATGCCTGGGGCAAAACTATTTCAGAGCTGCTGCAAGACTGCTCCTCTCGTCTCAAAATGACCCACCCAGCTAGAGCACTGTACACCCCCAGTGGAGAGCCAATTCAGTCCTGGGACGACATAGAGCGAGATATGGTCATCTGTGTGTCTATGGGACATGGTTTCAAAACCCCAAAAGAGTTAAAACAACTGATGGAGATCAGAGCAAATTATGCCAGAATCCGAAGGCAGCAGGGCCCTCAAGCCACAGACATTGTGGTGTCACCATCCACGAAGCTGCTGTCTCTGGCACATCTCCACAATTAA-3'
NCBI CDS gene sequence with introns (location: 30878584.. 31328280) (449697 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 30863603.. 31369739) (506137 bp)Download
NCBI gene sequence (location: [30863603.. 31369739 + 1000]) (507137 bp)Download
Cite How to cite