NCBI Summary
This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_001309331)
Adhesion G protein-coupled receptor L3
Adhesion G protein-coupled receptor L3 (Calcium-independent alpha-latrotoxin receptor 3) (CIRL-3) (Latrophilin-3) (Lectomedin-3)
ADGRL3
adhesion G protein-coupled receptor L3
Undefined
Very low evidence
L-rhamnose binding lectin
Undefined
b-sandwich / CUB-like
Uncharacterised
Undefined
0.659
Undefined
Protein sequence and protein families (fasta) (1537 amino acids) Download
MWPSQLLIFMMLLAPIIHGGKHSERHPALAAPLRHAERSPGGALPPRHLLQQPAAERTAAHRGQGPRGATRGVRGPGAQGAQIAAQAFSRAPIPMAVVRRELSCESYPIELRCPGTDVIMIESANYGRTDDKICDSDPAQMENIRCYLPDAYKIMSQRCNNRTQCAVVAGPDVFPDPCPGTYKYLEVQYECVPYKVEQKVFLCPGLLKGVYQSEHLFESDHQSGAWCKDPLQASDKIYYMPWTPYRTDTLTEYSSKDDFIAGRPTTTYKLPHRVDGTGFVVYDGALFFNKERTRNIVKFDLRTRIKSGEAIIANANYHDTSPYRWGGKSDIDLAVDENGLWVIYATEQNNGKIVISQLNPYTLRIEGTWDTAYDKRSASNAFMICGILYVVKSVYEDDDNEATGNKIDYIYNTDQSKDSLVDVPFPNSYQYIAAVDYNPRDNLLYVWNNYHVVKYSLDFGPLDSRSGQAHHGQVSYISPPIHLDSELERPSVKDISTTGPLGMGSTTTSTTLRTTTLSPGRSTTPSVSGRRNRSTSTPSPAVEVLDDMTTHLPSASSQIPALEESCEAVEAREIMWFKTRQGQIAKQPCPAGTIGVSTYLCLAPDGIWDPQGPDLSNCSSPWVNHITQKLKSGETAANIARELAEQTRNHLNAGDITYSVRAMDQLVGLLDVQLRNLTPGGKDSAARSLNKLQKRERSCRAYVQAMVETVNNLLQPQALNAWRDLTTSDQLRAATMLLHTVEESAFVLADNLLKTDIVRENTDNIKLEVARLSTEGNLEDLKFPENMGHGSTIQLSANTLKQNGRNGEIRVAFVLYNNLGPYLSTENASMKLGTEALSTNHSVIVNSPVITAAINKEFSNKVYLADPVVFTVKHIKQSEENFNPNCSFWSYSKRTMTGYWSTQGCRLLTTNKTHTTCSCNHLTNFAVLMAHVEVKHSDAVHDLLLDVITWVGILLSLVCLLICIFTFCFFRGLQSDRNTIHKNLCISLFVAELLFLIGINRTDQPIACAVFAALLHFFFLAAFTWMFLEGVQLYIMLVEVFESEHSRRKYFYLVGYGMPALIVAVSAAVDYRSYGTDKVCWLRLDTYFIWSFIGPATLIIMLNVIFLGIALYKMFHHTAILKPESGCLDNINYEDNRPFIKSWVIGAIALLCLLGLTWAFGLMYINESTVIMAYLFTIFNSLQGMFIFIFHCVLQKKVRKEYGKCLRTHCCSGKSTESSIGSGKTSGSRTPGRYSTGSQSRIRRMWNDTVRKQSESSFITGDINSSASLNREGLLNNARDTSVMDTLPLNGNHGNSYSIASGEYLSNCVQIIDRGYNHNETALEKKILKELTSNYIPSYLNNHERSSEQNRNLMNKLVNNLGSGREDDAIVLDDATSFNHEESLGLELIHEESDAPLLPPRVYSTENHQPHHYTRRRIPQDHSESFFPLLTNEHTEDLQSPHRDSLYTSMPTLAGVAATESVTTSTQTEPPPAKCGDAEDVYYKSMPNLGSRNHVHQLHTYYQLGRGSSDGFIVPPNKDGTPPEGSSKGPAHLVTSL
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Expression of the adult ADHD-associated gene ADGRL3 is dysregulated by risk variants and environmental risk factors. [32787626]
  • CDH13 and LPHN3 Gene Polymorphisms in Attention-Deficit/Hyperactivity Disorder: Their Relation to Clinical Characteristics. [32691279]
  • Brain structural and functional substrates of ADGRL3 (latrophilin 3) haplotype in attention-deficit/hyperactivity disorder. [33504901]
  • G12/13 is activated by acute tethered agonist exposure in the adhesion GPCR ADGRL3. [32778842]
  • Tissue Expression Of LPHN3 in Breast Cancer: An Immunohistochemistry Method. [33247693]
  • The multiple actions of black widow spider toxins and their selective use in neurosecretion studies. [15066411]
  • alpha-Latrotoxin and its receptors: neurexins and CIRL/latrophilins. [11520923]
  • The calcium-independent receptor for alpha-latrotoxin from human and rodent brains interacts with members of the ProSAP/SSTRIP/Shank family of multidomain proteins. [10964907]
  • A family of heptahelical receptors with adhesion-like domains: a marriage between two super families. [10994649]
  • Construction and characterization of a normalized cDNA library. [7937745]
UniProt Main References (5 PubMed Identifiers)
  • Generation and annotation of the DNA sequences of human chromosomes 2 and 4. [15815621]
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • Prediction of the coding sequences of unidentified human genes. XI. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. [9872452]
  • Structural Basis of Latrophilin-FLRT-UNC5 Interaction in Cell Adhesion. [26235030]
  • Screening of human LPHN3 for variants with a potential impact on ADHD susceptibility. [21184580]
All isoforms of this gene containing a lectin domain
NP_001374478.1, NP_001374477.1, XP_016863431.1, NP_001309175.1, NP_001374476.1, XP_016863430.1, NP_001374474.1, XP_016863429.1, NP_001374464.1, NP_001374465.1, NP_001374462.1, NP_001374463.1, NP_001374459.1, NP_001374460.1, NP_001374461.1, NP_001374458.1, NP_056051.2, NP_001374470.1, NP_001374457.1, NP_001374469.1, NP_001374466.1, NP_001374467.1, NP_001374468.1, NP_001374456.1, NP_001374455.1, XP_016863426.1, NP_001358273.1, NP_001374451.1, XP_016863424.1, XP_016863423.1, XP_016863422.1, NP_001309331.1, XP_016863421.1, NP_001374481.1, XP_011530090.1, NP_001358272.1, NP_001374454.1, XP_016863427.1, NP_001358274.1, XP_011530093.1, NP_001374452.1, XP_016863425.1, XP_016863420.1, XP_016863418.1, XP_016863419.1, NP_001374475.1, NP_001374471.1, NP_001358275.1, NP_001358271.1, XP_016863428.1, NP_001374453.1
RNA
RNA (Transcript ID: NM_001322402.3)
adhesion G protein-coupled receptor L3, transcript variant 1
m7G-5')ppp(5'-AUUCUGGCCUCCGCUCCGGCCCCGGCUGCGCCUACCCCGCGCGCAGGCUGCACGGUCCCCGCGCGCCCGCGCUCUGACCCGCUGUCUGCGCGUCGCCCCCCUCGCCUGCUGGCCCGGCACCGCUCGCUCCAGUUCCCAGGAGCGGGGAUGCAGAUGCUGCAGCUGGUCGGGGUGGGCGCCGCCGCCGCCGCCGCCGCCGCUGCUGCUGGUUUUUCUCGGACUGCUCGUUGCCUCCGCUCCGGCAGCUGCUGCCGCCGCCACCGCCGCCUGUGACUCGCCCCCUCCCCUUUCUUUCUUCUCUUUUUGCCUUGGUCCUCUUCCUACGGGUGUGCGCGCGCGCGGGUUGCACGGUUUGCUUUGGCAGGAGCUCGCUCGUGUGUGCGCGUGUGUGAGUGUGCGUGUCUGGAGAGCGCCAGUGCCUCGCUCGCUCUUGGGGAGUCGAAGAAGAGAAAGAACCGAAGAGACAGCGGCGGCGGCGCAGAGCCCGGGGCCGCGCGAUGAAGCUCCCACAUGCCCGCAGCUGCCCGGCCCGGCCGGCGAGCUAAUCAUCCACCCCACGGGCUCGGGGUUCGCCGGCCCCCGGGACGCAGCCCUCGGCGGCCGGGCGCCCGCUCUGUCUGCGCGCCCCCUCCGUGCACCGGGGAAGGAGUUUGUGUGGCUCUCGCUCCGGCUGUCCGCGGAGGUUGCGGGCUUGAGAGGGGACCCUCGGCUGGGAGAGAGCCUCGGGAGGACGAAGAGGAGGACGGUUUGGCGGAGAAGCCACCCCUGGCCCUCGCGGCUCCCCCUACCUAUUCCAUCGCUCCCGCUCCGAGGCGGAAAGGGGAGGACGUGGAAGAAGAAAAAGAAAGAGAAGGGGGGUGGGGUGGGAGAACUGGAUAUAAAGAUCGGCUGGGGGGAUGGUGGAAGAUUUUUGGUCUCUUCGGCAGCGUCUUUUCUUAAGCGGCGGCGGCAGCAGCAGCAGCAAGAGAAGGAGAAGCAGCCCCAGCUAUGACUGCCGCAUGUUAAUAGCUGCCGCUGGGUCCCUCGGCUGCUGCUGGAGACAGAGCCUGACUCCGAAGUUGUGCAACUGUGGACUGGGAGAGACAUUUGAACCCUCUUUUCUUUUCGCUCCCCUUUUGCCCCCUUGGGGUGUGUGAAGCGAGGAACGUAAAGGAAGGCGAACAUUUGGCUCUCUUUUUCCUUCCCCUUUCUCCGUGGCUGUGUAGCGGAAGAAAGGGAAGAGAGACUUUUUGUUGUUGUUUCCUUGACUGGGGUCUCCACCCUCCUGCUGCUUUCUCUGCGCUUCGAUUCUCGUUAUUUGCCGCGUGUGGUUGGGGGUGUCUGCACAGGGGCCGGCCGGUCUUUUGCCCCGGGCUCAAUGGCUGGAUUGUGGAAACUGCACCCGCCUUCAGGUUGUUGAGCAACUGAUGGGACGAUCUCAGGGACCGGCGUUUACGAAAGAAAUGUUUAAUUUGGUAAAUUGGAGGAAAAAAACAUGGAUUUUUAGCAAUUGAAGAGCAAAUUAAGGUUUCAGAUUUGGGAUAUUGGUGUUUCUGUUUUGGAGAAAUUAUUCUUUUUCUUUUUAAUUUGAAGAAAAAUCAUCAGUCUUGGAAUACAGAAGAGAAACUAGAAAUAUACGUAUUUUGUUUCACAUUUGAACAGUCAUUCUUGAGGAAUACUCCAUACCUGAGUAGACAGCCAUGUGGCCAUCGCAGCUACUAAUUUUCAUGAUGCUCUUAGCUCCAAUAAUUCAUGGUGGCAAGCACAGUGAACGACAUCCUGCCCUUGCUGCUCCAUUGCGACACGCUGAGCGCAGCCCAGGAGGCGCUCUUCCACCCAGACAUCUGCUUCAGCAGCCAGCUGCAGAGCGCACCGCUGCUCAUCGUGGACAAGGGCCCCGUGGAGCUACCAGAGGAGUUCGCGGUCCAGGUGCCCAAGGAGCACAGAUUGCAGCGCAAGCUUUCAGCCGUGCCCCAAUUCCAAUGGCUGUGGUCCGCAGAGAGCUAUCCUGUGAGAGCUAUCCUAUAGAGCUUCGCUGUCCAGGAACAGACGUCAUCAUGAUAGAAAGUGCCAACUAUGGCAGGACUGAUGACAAAAUUUGUGACUCUGACCCUGCUCAGAUGGAGAAUAUCCGAUGUUAUCUGCCAGAUGCCUAUAAGAUUAUGUCUCAAAGAUGCAAUAACAGAACCCAGUGUGCAGUGGUGGCAGGUCCUGAUGUUUUUCCAGACCCGUGUCCAGGAACCUAUAAAUACCUUGAAGUGCAGUAUGAAUGUGUCCCUUACAAAGUGGAACAAAAAGUUUUUCUUUGUCCUGGACUACUAAAAGGAGUAUACCAGAGUGAACAUUUGUUUGAGUCCGACCACCAAUCUGGGGCGUGGUGCAAAGACCCUCUGCAGGCAUCUGACAAGAUUUAUUAUAUGCCCUGGACUCCCUACAGAACUGAUACCCUGACUGAGUAUUCAUCCAAGGAUGACUUCAUUGCUGGAAGACCAACUACAACCUACAAGCUCCCUCACAGGGUGGAUGGCACAGGAUUUGUAGUGUAUGAUGGAGCUUUGUUCUUCAACAAAGAGCGCACCAGGAACAUAGUAAAGUUUGAUUUGCGGACUAGGAUAAAGAGUGGAGAGGCUAUCAUAGCAAAUGCCAAUUACCAUGAUACCUCCCCUUACCGAUGGGGAGGCAAAUCUGACAUAGACCUGGCAGUAGAUGAGAAUGGGCUAUGGGUAAUCUAUGCAACAGAACAAAACAAUGGUAAAAUUGUCAUUAGUCAAUUGAACCCUUACACCCUACGGAUCGAAGGAACAUGGGAUACUGCAUAUGAUAAAAGGUCAGCUUCCAAUGCCUUUAUGAUUUGUGGAAUUCUGUAUGUGGUCAAAUCUGUAUAUGAGGAUGAUGACAAUGAGGCUACUGGAAAUAAGAUUGACUACAUUUACAACACUGACCAAAGCAAGGAUAGUUUGGUGGAUGUACCCUUUCCUAAUUCAUACCAGUACAUUGCAGCUGUGGAUUACAACCCCAGGGACAACCUACUUUAUGUAUGGAAUAACUAUCACGUCGUGAAAUAUUCUUUGGAUUUUGGACCUCUGGAUAGUAGAUCAGGGCAGGCACAUCAUGGACAAGUUUCAUACAUUUCUCCGCCAAUUCACCUUGACUCUGAGCUAGAAAGACCCUCUGUUAAAGAUAUCUCUACCACAGGACCUCUUGGCAUGGGAAGCACUACCACCAGUACCACCCUUCGGACCACAACUUUGAGCCCAGGAAGGAGUACCACCCCGUCAGUGUCAGGAAGAAGAAACCGGAGUACUAGUACCCCAUCUCCAGCUGUCGAGGUACUUGAUGACAUGACCACACACCUUCCAUCAGCAUCGUCCCAAAUCCCAGCUCUCGAAGAGAGCUGUGAGGCUGUGGAAGCCCGAGAAAUCAUGUGGUUUAAGACUCGUCAAGGACAGAUAGCAAAGCAGCCAUGCCCUGCAGGAACUAUAGGUGUAUCAACUUAUCUAUGCCUUGCUCCUGAUGGAAUUUGGGAUCCCCAAGGUCCAGAUCUCAGCAACUGUUCUUCUCCUUGGGUCAAUCAUAUAACACAGAAGUUGAAAUCUGGUGAAACAGCUGCCAACAUUGCUAGAGAGCUGGCUGAACAGACAAGAAAUCACUUGAAUGCUGGGGACAUCACCUACUCUGUCCGGGCCAUGGACCAGCUGGUAGGCCUCCUAGAUGUACAGCUUCGGAACUUGACCCCAGGUGGAAAAGAUAGUGCUGCCCGGAGUUUGAACAAGCUUCAGAAAAGAGAGCGCUCUUGCAGAGCCUAUGUCCAGGCAAUGGUCGAGACAGUUAACAACCUCCUUCAGCCACAAGCUUUGAAUGCAUGGAGAGACCUGACUACGAGUGAUCAGCUGCGUGCGGCCACCAUGUUGCUUCAUACUGUGGAGGAAAGUGCUUUUGUGCUGGCUGAUAACCUUUUGAAGACUGACAUUGUCAGGGAGAAUACAGACAAUAUUAAAUUGGAAGUUGCAAGACUGAGCACAGAAGGAAACUUAGAAGACCUAAAAUUUCCAGAAAACAUGGGCCAUGGAAGCACUAUCCAGCUGUCUGCAAAUACCUUAAAGCAAAAUGGCCGAAAUGGAGAGAUCAGAGUGGCCUUUGUCCUGUAUAACAACUUGGGUCCUUAUUUAUCCACGGAGAAUGCCAGUAUGAAGUUGGGAACGGAAGCUUUGUCCACAAAUCAUUCUGUUAUUGUCAAUUCCCCUGUUAUUACGGCAGCAAUAAACAAAGAGUUCAGUAACAAGGUUUAUUUGGCUGAUCCUGUGGUAUUUACUGUUAAACAUAUCAAGCAGUCAGAGGAAAAUUUCAACCCUAACUGUUCAUUUUGGAGCUACUCCAAGCGUACAAUGACAGGUUAUUGGUCAACACAAGGCUGUCGGCUCCUGACAACAAAUAAGACACAUACUACAUGCUCUUGUAACCACCUAACAAAUUUUGCAGUACUGAUGGCACAUGUGGAAGUUAAGCACAGUGAUGCGGUCCAUGACCUCCUUCUGGAUGUGAUCACGUGGGUUGGAAUUUUGCUGUCCCUUGUUUGUCUCCUGAUUUGCAUCUUCACAUUUUGCUUUUUCCGGGGGCUCCAGAGUGACCGUAACACCAUCCACAAGAACCUCUGCAUCAGUCUCUUUGUAGCAGAGCUGCUCUUCCUGAUUGGGAUCAACCGAACUGACCAACCAAUUGCCUGUGCUGUUUUCGCUGCCCUGUUACAUUUCUUCUUCUUGGCUGCCUUCACCUGGAUGUUCCUGGAGGGGGUGCAGCUUUAUAUCAUGCUGGUGGAGGUUUUUGAGAGUGAACAUUCACGUAGGAAAUACUUUUAUCUGGUCGGCUAUGGGAUGCCUGCACUCAUUGUGGCUGUGUCAGCUGCAGUAGACUACAGGAGUUAUGGAACAGAUAAAGUAUGUUGGCUCCGACUUGACACCUACUUCAUUUGGAGUUUUAUAGGACCAGCAACUUUGAUAAUUAUGCUUAAUGUAAUCUUCCUUGGGAUUGCUUUAUAUAAAAUGUUUCAUCAUACUGCUAUACUGAAACCUGAAUCAGGCUGUCUUGAUAACAUCAACUAUGAGGAUAACAGACCCUUCAUCAAGUCAUGGGUUAUAGGUGCAAUAGCUCUUCUCUGCCUAUUAGGAUUGACCUGGGCCUUUGGACUCAUGUAUAUUAAUGAAAGCACAGUCAUCAUGGCCUAUCUCUUCACCAUUUUCAAUUCUCUACAGGGAAUGUUUAUAUUUAUUUUCCAUUGUGUCCUACAGAAGAAGGUACGAAAAGAGUAUGGGAAAUGCCUGCGAACACAUUGCUGUAGUGGCAAAAGUACAGAGAGUUCCAUUGGUUCAGGGAAAACAUCUGGUUCUCGAACUCCUGGACGCUACUCCACAGGCUCACAGAGCCGAAUCCGUAGAAUGUGGAAUGACACGGUUCGAAAGCAGUCAGAGUCUUCCUUUAUUACUGGAGACAUAAACAGUUCAGCGUCACUCAACAGAGAGGGGCUUCUGAACAAUGCCAGGGAUACAAGUGUCAUGGAUACUCUACCACUGAAUGGUAACCAUGGCAAUAGUUACAGCAUUGCCAGCGGCGAAUACCUGAGCAACUGUGUGCAAAUCAUAGACCGUGGCUAUAACCAUAACGAGACCGCCCUAGAGAAAAAGAUUCUGAAGGAACUCACUUCCAACUAUAUCCCUUCUUACCUGAACAACCAUGAGCGCUCCAGUGAACAGAACAGGAAUCUGAUGAACAAGCUGGUGAAUAACCUUGGCAGUGGAAGGGAAGAUGAUGCCAUUGUCCUGGAUGAUGCCACCUCGUUUAACCACGAGGAGAGUUUGGGCCUGGAACUCAUUCAUGAGGAAUCUGAUGCUCCUUUGCUGCCCCCAAGAGUAUACUCCACCGAGAACCACCAGCCACACCAUUAUACCAGAAGGCGGAUCCCCCAAGACCACAGUGAGAGCUUUUUCCCUUUGCUAACCAACGAGCACACAGAAGAUCUCCAGUCACCCCAUAGAGACUCUCUCUAUACCAGCAUGCCGACACUGGCUGGUGUGGCCGCCACAGAGAGUGUUACCACCAGCACCCAGACCGAACCCCCACCGGCCAAAUGUGGUGAUGCCGAAGAUGUUUACUACAAAAGCAUGCCAAACCUAGGCUCCAGAAACCACGUCCAUCAGCUGCAUACUUACUACCAGCUAGGUCGCGGCAGCAGUGAUGGAUUUAUAGUUCCUCCAAACAAAGAUGGGACCCCUCCCGAGGGAAGUUCAAAAGGACCGGCUCAUUUGGUCACUAGUCUAUAGAAGAUGACACAGAAAUUGGAACCAACAAAACUGCUAACACCUUGUUGACUGUUCUGAGUUGAUAUAAGCAGUGGUAAUAAUGUGUGUACUCCUAAAUCUUUAUGCUGUCCUCUAAAGACAAACACAAACUCUCAGACUUUUUUUUUUUUAAUGGGAUUUUUAGGUCAGCCCAGGGGAGAAAGAUAACUGCUAAAAUUCCCCUGUACCCCAUCCUUUCUUGUCCUUUCCCCUUCAGAUGGAGACUUCAUUAUGUUAAUGAACAAGAUAUGAAGAAAAUGGCACUCAUUGUGGCCUUGUUGAAUUAUGUUGUGUAUGUUUUAACAUCUCUGAUGCUGUGUUACUAAAAUUACAAGGACCUGCUUUUUAAAAGGCCAGAACAAUUGUCUGAAAUUAGUAACAAUGCUGCAUCUAGAUUGGAGUGCUGCACAAACAAACAUAAGAGCAAAGCAAAACUGUAUCACAUAGGGUUUUUGGUCACUCACAACCUGAAUUCACCACAGCUGGAAUAGCUGUGGAAAACAAAAUAAAACAACAAAAUUAAUAAUGAAAUGGAGGGGAAUUCUAGAAUUAUAUGCUAAAUGCAUAUUUUAUGAUUUGCUGUAUUAACUGAUGAUAAAACUAAUGGCAGAAAAAGAAGUUGAGCAAUUUCUAUGUAAUGUACAGAUACUAGCAUUGCACAUAUAGUCUGCUUUCUGUUCCUCCAGAAUUUGAGUCCUGUUAAUGUAGUAGAAAAAAAAAAAAGAAAUUUUCUUUUUCUUUUGUGCUGGUCUUGCAAGUUUGUCUACCAGUAAGAGAGCAAAGUUUCCUUCCUUUCUUCUCUUUCUUCAUUUUCUUUUUUUCUUUUUUGCCUUUUAUUCCUUUAAAAUUUCGCCUGGCAAAAAAUAAAUAAAUGGAACUAUCACUUUAUAAGAAUCAUUUUCUAGUAAUGCAAACAAAUUAUUUUUUACAAAAAAACAAAAUAAAUAAAAUUAGACUUCCUUCCCUCACUAUAUAUCUUUAUGCAGUCAGAAUAUUUCCAACAGUGUUUUUUGCAAAUUAGAGCAGGACAAACUUUUAUGUUUACAGGGCACGUCUGUUGUAAUGCAAAGCAUAUUUGGCAAGCAGUUCAUCACCAGGACACUAGCUAUGAUUCUAGAAGUCAAAAGGUGUCUAUAGAACUAGUGGGGCUUCUGCAUGUGAAAAACGGUUUUCCAUAGGCAUUAAAGUGCUGAAUGCUCAGUCUGAUCAACAAGUGGGCACCUGCACUACCACUUUUUAGAGGAAAUUCACUCCCUCGUAAGCAUUGGAAGGUCAAAUUAUUUUGAAGUGAUUUUUUUAAAAAAAAGUCUUCUGUUUAUUAACAGGAAAAUUUAUUUAUUUGACAGGAUUUUGAGUAAUGUAGGAAUACAAAAGGUAAAUUAGCAGCACAUAUAAUUUUUUUUUAAUUUAUGAUCCAUUUUGUAUGGUCUCAAAGUUGGAUGACCUCAUUACUAAUAUUUGUUGUAAAAGUGAAACUUGUUUGCCAACCAAUAAACAACUGAUUGAGAUUUAGAAGAUAUUGUAUUGAUGUAUGUACUAUAUGAUUAAUCAGUCUUUUUAUUUUUCUCGCCUUUCUUUCUUUCUGUUUUCAAUACAUAAACUUUGCUAAUCCUCUGUGGCCCAAAUGAGCCAUGCAAAAGAAAUCAAUCUGCCUAGAUGAAUAAGCUAAGCACAAAAUCAUACAGGUUUGCAGACAAAGUAAACCAGAAAAAUGGAAUGGGCAUGUUUAUUUUGGAUGAAAUCAGAUGCAUAACUUAAUGUUGAGCAGGUUAACAUAUAUGUUACUAUUUGCUUAUCUAUAAACCAGCUGCAGUCACUAUGCUUACCUUUAAAACCAGAUUCAAUCAGAGAUAUAAAUAUGAAAUUUGGGGGCUGGGUGAGUCAUAUUUUUUCCUCCUUUGUACAUUGCAUUUUGAUGUUAGAAAUUCAAAUUCCCUCAAUUUGCUAAAAGCUGCAAAGAGAAUAUUCAUUUUAUAAAGAUAUAAUAAGACUUUUAUUGUGUUUUUUUCUUAUUCUAUAUAUGAGGGAAAUCGGAAAAGAUAAAGAAGUUCUUUCAAAGAAACUUUCUAGAUCUCUCAUUACUGCAGAUCCUUUAUAGCAGUGUCCAAGUACAGAUCCCCUGUUAGGGCAAAGCUAAAAGGAACCUGCCAAAUUAUAAUUUCUCCUGUAGUGUGUUUUAUCUCGGGGUUUCCUUUUUCAAAAAUCUAAACACUAUCCAUCUAUAAAUGACUAUCUUAAAUCAAGUUUAGAGAAUGGCCAAUAAUCUGUAUAUAGUUUAUAAAUACAUGACAAAAAAAUUUCUGCUGAGCCAGAGUGCAUCAUAACCUUCACAUCACCUCAAAAUAUUUUAUGUCUCAUUCUUUUUUAGUGAAUUGGCAUGAAUAUUUUUUAAGUCUACAGAUUUUAUGUUAGAGGAGAAUCACAAGCGUUAAUGAUAAUUAGGUUUUCUCACACCACACUAUGGCAAUAUUAGCACGUCCAAGGCUUUUAACCCACCCGAUACAUAGAAUACAUUUGGCAAUAAAAGAAUCCUUUUUAGAUGUGUUUAUGGUAACUUCAGAAACACAAAUGUGGUCUGUGGAUUAUGAGCACUUAUGCUUGUUUUGUCAAACAGUAACCUACAUGAAAGCAACUCUAUCAGUAAGAAGCUGGUUUCACAGAAAAAUGGGGAAACUACCUCAAUUCAGCUUGCUGAUUUUCUGACAUUGCUACCUCCCUGCCCAUUAUUUUUGUGUUUCUAUAUGGAAAUUUGAAGCAGGUAGCUUCUCAAGCUCUACAUAGACCAAACUGAAGAAAGAUCACUUGAAUACACAAACUGGUGCAGAAGAACAUUCAGCAUAUAAAGUUACUACCAAGCUCUUGCAUCAAGAAAAAAGAGUGAGAUUUUUGAACUCUAUACAUCAUAAAUGGCAUGCUUUCAGAGAGACUUAAGAUCCCAAAGAUUAUAACAGAGAGAAAUUUCCCCUGCAAGUAUUAUGUAACCGUAAUUAAAAAAAAUGGAUAAAGGAGCUAAUUUUACAUACAUUUCAAUAGAAAUUUGCAUAUAUCUAACAUAUUCAUUUUGUCCUGUUUACACUAGCAAGGGUUGAAUUCCUGAACUUGAAUCUUUUUCUUCAUAUACAUUUUCUUAUAGAGCUAUUGAUGAAUUAAUUAAUGAUUUUUUAAUUGUUCUUUUUUCUACCACCUUUUGUGACUCAAUUUUUUAAGAUCCUGAGACAUUUAUGACCUGCUUAUCUGUAUAUUUUUAUGUGUUCAUCUGAAUUUCCAGUAAGAAGUAAAUUUCCGUCAAACAGAUGUAGUAUACCGCUAUAAUACAGCUUAUUUAGCCAGCUAGAAGUAAAACUUAUGCCACCGAAACAAACAAAUGAUUACUUUCUUGUCAAAUAAUAUUUUUGUCACAUUUUUAGACUUGGUUGUUUUUCCUCUUUGAAAUCUAGUUCACAUGACACUUUAUCAGGGACACUAGCUAAUGGACCUCAUGUUUAGUUAAUUCUGAAACUGAUGGAUUGUUGCACAGCCUCUGCUCCUAACUGAUAAAUAUUUGCGGCAAAGUCCAAAUUUUGUGAAGGAGAAAUUGGUUGGAAUUAAAUUUUAUGGGCGUCCCUUCUUGUUUCCACUAUAUUAUAAUUAAACACACUGAAGUUGAAUAAUAAAUUACUGUGCUAAAAUAAUUGUAAUAACAAAAAUGAACUGACAGAACAAUUAUCUUGAAGUAACAAUAAUCAGGAAAAUAUCUAACAAAAAGCACGUAAGGGAAAUAUCCUUAACUUCCUGUAAAAAAAAUUCACAUUGACUCUAAAUUAAGAUGUAGUUUAUCAUCUGUAUUUUAAAAUAUCCAUCAUAACUAAAAAUGUUGACAUAUUAAGGAAAGGAUCUUUAAGAUCUAGGUUUAAGAUUCUUAUUAGUAUUAACUUAAUUGGUAUGACAAAACUUUUCAUAAUAGAUAUAAGCAUAUAAGGGAAUUAGUAACAUUUAUAAAGGACCCACAUAUUUAAUUUUAGGCAUUGUCUUCAGCUUCCCUGGACCCCCAACACAUGUUGAAAUGUUAUUGACUAGCUUGCUUUUUUUAAGGAAUGACAUUAAAAAUUUCGACUGACUUUCUACAUUACUGUAAAGAUCAAAAGGGAGAGGAAAAAUAGUUUACAAGUUUUCUAAAGAUCAACUCCAGACUAAUCUAUAUCAUCCCCUAAUAAUGAAAAAACAAUUAGUUUUUAGAAGUUGUCUAUCAGUACUGUACCGAAGUGCUACUGCUUGGAUUUUUUUGUUGUGGUUUUAAAGAGAUGGGGUCUUGCUCUGUCACAAAGACUGAAGGGCAGUGGCACAAUCCCAGCUCACUGCAGCCUCAGACUCUUGGGCUCAAGUGAUCCUGCUGUCUCAGCCUUCUGCGUAGCCAUGAUCACAGGUUUGAGCCACAGCACUUGGCCUGUGAUGUAUUGCAGAGGGAAAAAAACCAACACUACAGAAGUAUAAUGCAUGUCAAUUCAGAUUUAGAGAGUGUAAAAAACAAAAACCCAAAGUCCAACUAUUUAGUUUUGAGCAAAUCUGAAGAUAUUGGCAUGAAUAUCCUUUCUUCUCUAAGAAAAUUUUUGAGAUAACAAUAUAUAUGAAGUUCCCAGUACAUUGUAGACCAAGGUGUUAAAAUUUAAUUAGUUCAUUUUUAGUAAUUCAUAAUUUUAACUUACCACAUAAACAAUUACUAUGCAUUUCUAAGUAACGUUUUCAAUAUAGCUUAUAUUAGAUUUCUGCACAUCAUUAAAUUACGAAGAUGGCACAAAAGCAAAGCAGCAACAUUGCACAAUAGCUUAUGGAAGCAUUUUUGUGCGAAUGGAUUUUACAUAAGAAGCUUUUCUGAGCUCAUAAAAUAUAUUCAAUGGAUCCCAACAUUAAAUUUAACUUUGCAAUCAGCAAAUAUGUUCUUUAUAACAUCUUAAAAAUAUUAAACAAUUAAAUUUUCAUUUGUAGGCUAGCAGAACUUAAAUGUGUUGGUAGUUGCUUCUUUCCUGAUUAGGCCAUAAGAAGAAACUUUCCUAUUUACUAAUUAACACUGAUUACACUCUCUUUGGUUUAAAAGGGAAACUUUCACCUGUACACAUACACACUCUGAUUCCAUUUAUUUACAGCCUGCAGAAGAAGUAGCUUGUUUACGAUAUUUAAAACUUUGUGAUUUCUGCAAUAAAACAGGUAGUUAAUAUAGUUUCGCAUAAUCUCAUUGAAAGAUAUUGCUAUUCCUUCUUUAUUUAAAAAAAAAUUUAAAAGUCAGCACUUCUUUCACAUCUAGCACCUAUAAGUUACUAUUCAAAUGUCUUGAUUUCAGCUAAGUUUUGAUGUUUCUUUUUCUCUUAAUAGUAUGUCAAAAGCAUUGUUCUCAUUUGAUAAUUUGUGUCCCGUUACAGUAUUUCAAAGGUAAAUGCAAACUAAUUUUUAGGAAGGCUUGUGAAAGAACUUUGAUUUAUGUGAAGAAAUCAAGAAAGACUAUACAUGAACAAAUCUCUAUUGGGAUAAACAAGUCUCUUCAACCACAAUAUGAACAACGGAAGAGCAGAAACCAAACAAGUUAGCAAACUUAUGGUAAGGUGACAGGACCUAAACUAGAGUUACAGAGAAAAGUUUUCCAGGAAAGAAUAAUGAAGUCAUUUGUAGUGAUAAAAAUCUUAUACACUACACCAAAUGUUACAGAUGUAUUCCGAAAAGUAAAAUGGGAGUUUCCUAUAUUCUGAUUUCAUUCUGCUAAUUCCACGGGAAACAUUAAAUACUUUAAACACUCUUGAGAUAUUUCGUAUCUAGCUAUACCUUGUCUCAAGGAAACAUCAAUAUUUUAUAAAUGUUUCUUAAAUAUAAGUAUUUUGUCUGAAUUCAUCUUCACUCUCUAAUCUGCUGGCUCUAUUGAACACCAACAGAGUUAAUGCUUUUAGUAGCUUUGUACCUUUUAAAGCUCUAUUAUGAAUCUUUCUAAUACAUAUGAAAUUAAUAUUAUAUUAGAAUUAUGUACAUUAUACAAAAUAAUUCAUAACCAAGAAAUAUUCAUACUAUAGAAUAAUUUAUUAUUAUAUAUAUGAAUAUUACAUUGAGACUGAACAAAUAACCACUCUGCUCCAAAUAUUACUCUCAAGUUCUCUGCCUUUAAUUAUUAUAGUCAAUUCAUAAAAUUCUACAUACAGUUGUACAUGGUGGGUUAUCAAAGUACUCCAUAAUCCAAAUGCAUCUAAAAGUAUUCCAAAUGCGCCUUUCAUUCUAGAAUACUAAAGGAAAGCGUUUGAAAGAAGAGGAAAGUAAAGCAGACUUCUAACUAUUUAAUUUAAACAUUGCCAUUCAGAUUGAAUAAUUUUUAAAUGAUGAUGCUCCACUCUUUGAUCUACAGACAAGGUUACAAAAGAUUUACAAUUAGUCCAAAAUCAGAGGAUUUUAAAUCUUAAAGGAGUUAAGUUUGUCUCAAUGAUCCAAGACUACAAAAUUUCUUGCUACAUUGGCAAGGAAAUAUGUUUAAAGCCGAGAACUAAAAUAGCUUUUUAAAAUUUAAAAAUUCCUCUGUUUCUUCUGAAUGUAAAACAGGCAAAAUGAUCCUGACUUCAAAAUGAAAUAUAUUGAUUGCUCUCAAAAGAUGUUUGACAAAGUUAAGUCAGUAUCUUCAAUGCUUUAACAGUAGGUAGAGGUCUUUGGGGUUGGAACUCAGGAUACAGUGACUAGGACAGAGUGCAUUCUUAGGCUAAUUAGUGCCUAGUCCUCUGGAGUAUUUUUUAAUGCCCUGAAUUUCAAGUUGUCAAACUGGUUUACAUAUUGAAUGACAUUUUGAAUCAAUAAAAAUGAGAAAAAAACAUUUAAAUUUGGUUUUCAUGACUCAUUUGAGAAUAAAGAUUUCCUUCAUCACCCUAAGUAAUAAAAGCUGAUAUGUCUUGAAACAACUAUAGACAAUCAGAAUGUGUUCAUUUAUAAAGUAUCACUGGUUUGUAUAUUUUAAUGCUGACCUUUGCCUGUGAACUAGAAAAUCAAGAUUUGUAGAGUCAGGUUGAUUUGCCUUCAUUUAAUUCCUGCAAAUGCAUUGGAAGUGGAUGGAUAACUUGGAACUUUUUCCAUACUGUUUUCCCCCUCACCAAGCAUUAAAUCUAAUUCAAAAUAUGUCUUUCUAAAAAACAAUAGUUUAUUUUUAAAACUAACAACUAAUUGUGUUAUUCCUUGUUGAUAAGAAAGUCACUUUUUAGAAACAAGAAUAUAGCUAUUGUGGCUUUGGUCGCUUAGGAUUCUCAUAUAUUUACACAUGGCAUUAUUCUUUUCAUAUACACCUACCAGAUUUCAAGCUAUUGGAUAUUUCCCUUGUACAACCUUUACAUCCUUUUUUUUUCCUUAAAUGCUCUGUACAAUCACAUGUAAAGUCAUGAGCUACAAACCUCAAUAAAAAUAUCAGUAAACAAGAA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 23284)
adhesion G protein-coupled receptor L3
strand +
KIAA0768, LEC3
NCBI CDS gene sequence (4614 bp)
5'-ATGTGGCCATCGCAGCTACTAATTTTCATGATGCTCTTAGCTCCAATAATTCATGGTGGCAAGCACAGTGAACGACATCCTGCCCTTGCTGCTCCATTGCGACACGCTGAGCGCAGCCCAGGAGGCGCTCTTCCACCCAGACATCTGCTTCAGCAGCCAGCTGCAGAGCGCACCGCTGCTCATCGTGGACAAGGGCCCCGTGGAGCTACCAGAGGAGTTCGCGGTCCAGGTGCCCAAGGAGCACAGATTGCAGCGCAAGCTTTCAGCCGTGCCCCAATTCCAATGGCTGTGGTCCGCAGAGAGCTATCCTGTGAGAGCTATCCTATAGAGCTTCGCTGTCCAGGAACAGACGTCATCATGATAGAAAGTGCCAACTATGGCAGGACTGATGACAAAATTTGTGACTCTGACCCTGCTCAGATGGAGAATATCCGATGTTATCTGCCAGATGCCTATAAGATTATGTCTCAAAGATGCAATAACAGAACCCAGTGTGCAGTGGTGGCAGGTCCTGATGTTTTTCCAGACCCGTGTCCAGGAACCTATAAATACCTTGAAGTGCAGTATGAATGTGTCCCTTACAAAGTGGAACAAAAAGTTTTTCTTTGTCCTGGACTACTAAAAGGAGTATACCAGAGTGAACATTTGTTTGAGTCCGACCACCAATCTGGGGCGTGGTGCAAAGACCCTCTGCAGGCATCTGACAAGATTTATTATATGCCCTGGACTCCCTACAGAACTGATACCCTGACTGAGTATTCATCCAAGGATGACTTCATTGCTGGAAGACCAACTACAACCTACAAGCTCCCTCACAGGGTGGATGGCACAGGATTTGTAGTGTATGATGGAGCTTTGTTCTTCAACAAAGAGCGCACCAGGAACATAGTAAAGTTTGATTTGCGGACTAGGATAAAGAGTGGAGAGGCTATCATAGCAAATGCCAATTACCATGATACCTCCCCTTACCGATGGGGAGGCAAATCTGACATAGACCTGGCAGTAGATGAGAATGGGCTATGGGTAATCTATGCAACAGAACAAAACAATGGTAAAATTGTCATTAGTCAATTGAACCCTTACACCCTACGGATCGAAGGAACATGGGATACTGCATATGATAAAAGGTCAGCTTCCAATGCCTTTATGATTTGTGGAATTCTGTATGTGGTCAAATCTGTATATGAGGATGATGACAATGAGGCTACTGGAAATAAGATTGACTACATTTACAACACTGACCAAAGCAAGGATAGTTTGGTGGATGTACCCTTTCCTAATTCATACCAGTACATTGCAGCTGTGGATTACAACCCCAGGGACAACCTACTTTATGTATGGAATAACTATCACGTCGTGAAATATTCTTTGGATTTTGGACCTCTGGATAGTAGATCAGGGCAGGCACATCATGGACAAGTTTCATACATTTCTCCGCCAATTCACCTTGACTCTGAGCTAGAAAGACCCTCTGTTAAAGATATCTCTACCACAGGACCTCTTGGCATGGGAAGCACTACCACCAGTACCACCCTTCGGACCACAACTTTGAGCCCAGGAAGGAGTACCACCCCGTCAGTGTCAGGAAGAAGAAACCGGAGTACTAGTACCCCATCTCCAGCTGTCGAGGTACTTGATGACATGACCACACACCTTCCATCAGCATCGTCCCAAATCCCAGCTCTCGAAGAGAGCTGTGAGGCTGTGGAAGCCCGAGAAATCATGTGGTTTAAGACTCGTCAAGGACAGATAGCAAAGCAGCCATGCCCTGCAGGAACTATAGGTGTATCAACTTATCTATGCCTTGCTCCTGATGGAATTTGGGATCCCCAAGGTCCAGATCTCAGCAACTGTTCTTCTCCTTGGGTCAATCATATAACACAGAAGTTGAAATCTGGTGAAACAGCTGCCAACATTGCTAGAGAGCTGGCTGAACAGACAAGAAATCACTTGAATGCTGGGGACATCACCTACTCTGTCCGGGCCATGGACCAGCTGGTAGGCCTCCTAGATGTACAGCTTCGGAACTTGACCCCAGGTGGAAAAGATAGTGCTGCCCGGAGTTTGAACAAGCTTCAGAAAAGAGAGCGCTCTTGCAGAGCCTATGTCCAGGCAATGGTCGAGACAGTTAACAACCTCCTTCAGCCACAAGCTTTGAATGCATGGAGAGACCTGACTACGAGTGATCAGCTGCGTGCGGCCACCATGTTGCTTCATACTGTGGAGGAAAGTGCTTTTGTGCTGGCTGATAACCTTTTGAAGACTGACATTGTCAGGGAGAATACAGACAATATTAAATTGGAAGTTGCAAGACTGAGCACAGAAGGAAACTTAGAAGACCTAAAATTTCCAGAAAACATGGGCCATGGAAGCACTATCCAGCTGTCTGCAAATACCTTAAAGCAAAATGGCCGAAATGGAGAGATCAGAGTGGCCTTTGTCCTGTATAACAACTTGGGTCCTTATTTATCCACGGAGAATGCCAGTATGAAGTTGGGAACGGAAGCTTTGTCCACAAATCATTCTGTTATTGTCAATTCCCCTGTTATTACGGCAGCAATAAACAAAGAGTTCAGTAACAAGGTTTATTTGGCTGATCCTGTGGTATTTACTGTTAAACATATCAAGCAGTCAGAGGAAAATTTCAACCCTAACTGTTCATTTTGGAGCTACTCCAAGCGTACAATGACAGGTTATTGGTCAACACAAGGCTGTCGGCTCCTGACAACAAATAAGACACATACTACATGCTCTTGTAACCACCTAACAAATTTTGCAGTACTGATGGCACATGTGGAAGTTAAGCACAGTGATGCGGTCCATGACCTCCTTCTGGATGTGATCACGTGGGTTGGAATTTTGCTGTCCCTTGTTTGTCTCCTGATTTGCATCTTCACATTTTGCTTTTTCCGGGGGCTCCAGAGTGACCGTAACACCATCCACAAGAACCTCTGCATCAGTCTCTTTGTAGCAGAGCTGCTCTTCCTGATTGGGATCAACCGAACTGACCAACCAATTGCCTGTGCTGTTTTCGCTGCCCTGTTACATTTCTTCTTCTTGGCTGCCTTCACCTGGATGTTCCTGGAGGGGGTGCAGCTTTATATCATGCTGGTGGAGGTTTTTGAGAGTGAACATTCACGTAGGAAATACTTTTATCTGGTCGGCTATGGGATGCCTGCACTCATTGTGGCTGTGTCAGCTGCAGTAGACTACAGGAGTTATGGAACAGATAAAGTATGTTGGCTCCGACTTGACACCTACTTCATTTGGAGTTTTATAGGACCAGCAACTTTGATAATTATGCTTAATGTAATCTTCCTTGGGATTGCTTTATATAAAATGTTTCATCATACTGCTATACTGAAACCTGAATCAGGCTGTCTTGATAACATCAACTATGAGGATAACAGACCCTTCATCAAGTCATGGGTTATAGGTGCAATAGCTCTTCTCTGCCTATTAGGATTGACCTGGGCCTTTGGACTCATGTATATTAATGAAAGCACAGTCATCATGGCCTATCTCTTCACCATTTTCAATTCTCTACAGGGAATGTTTATATTTATTTTCCATTGTGTCCTACAGAAGAAGGTACGAAAAGAGTATGGGAAATGCCTGCGAACACATTGCTGTAGTGGCAAAAGTACAGAGAGTTCCATTGGTTCAGGGAAAACATCTGGTTCTCGAACTCCTGGACGCTACTCCACAGGCTCACAGAGCCGAATCCGTAGAATGTGGAATGACACGGTTCGAAAGCAGTCAGAGTCTTCCTTTATTACTGGAGACATAAACAGTTCAGCGTCACTCAACAGAGAGGGGCTTCTGAACAATGCCAGGGATACAAGTGTCATGGATACTCTACCACTGAATGGTAACCATGGCAATAGTTACAGCATTGCCAGCGGCGAATACCTGAGCAACTGTGTGCAAATCATAGACCGTGGCTATAACCATAACGAGACCGCCCTAGAGAAAAAGATTCTGAAGGAACTCACTTCCAACTATATCCCTTCTTACCTGAACAACCATGAGCGCTCCAGTGAACAGAACAGGAATCTGATGAACAAGCTGGTGAATAACCTTGGCAGTGGAAGGGAAGATGATGCCATTGTCCTGGATGATGCCACCTCGTTTAACCACGAGGAGAGTTTGGGCCTGGAACTCATTCATGAGGAATCTGATGCTCCTTTGCTGCCCCCAAGAGTATACTCCACCGAGAACCACCAGCCACACCATTATACCAGAAGGCGGATCCCCCAAGACCACAGTGAGAGCTTTTTCCCTTTGCTAACCAACGAGCACACAGAAGATCTCCAGTCACCCCATAGAGACTCTCTCTATACCAGCATGCCGACACTGGCTGGTGTGGCCGCCACAGAGAGTGTTACCACCAGCACCCAGACCGAACCCCCACCGGCCAAATGTGGTGATGCCGAAGATGTTTACTACAAAAGCATGCCAAACCTAGGCTCCAGAAACCACGTCCATCAGCTGCATACTTACTACCAGCTAGGTCGCGGCAGCAGTGATGGATTTATAGTTCCTCCAAACAAAGATGGGACCCCTCCCGAGGGAAGTTCAAAAGGACCGGCTCATTTGGTCACTAGTCTATAG-3'
NCBI CDS gene sequence with introns (location: 61497294.. 62070908) (573615 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 61200326.. 62078335) (878010 bp)Download
NCBI gene sequence (location: [61200326 - 1000].. 62078335) (879010 bp)Download
Cite How to cite