Protein
Protein (NP_001030017)
CBM13-ppGalNAc-TL6
Polypeptide N-acetylgalactosaminyltransferase-like 6 (EC 2.4.1.41) (Polypeptide GalNAc transferase 17) (GalNAc-T17) (pp-GaNTase 17) (Protein-UDP acetylgalactosaminyltransferase 17) (Putative polypeptide N-acetylgalactosaminyltransferase 17) (UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 17)
GALNTL6
polypeptide N-acetylgalactosaminyltransferase like 6
Undefined
Curated
Ricin-like
Undefined
b-trefoil
GalNAc / Mucin-type glycopeptide
Undefined
Protein sequence and protein families (fasta) (601 amino acids) Download
MKRKQKRFLQMTLLFTVALIFLPNVGLWSLYKDKHLVKSAEPGEQQTFPLGLGDGQFYSWTDGLRRKDWHDYESIQKEAMRSGKGEHGKPYPLTEEDHDDSAYRENGFNIFVSNNIALERSLPDIRHANCKHKMYLERLPNTSIIIPFHNEGWTSLLRTIHSIINRTPGSLIAEIILVDDFSEREHLKDKLEEYMARFSKVRIVRTKKREGLIRTRLLGASMARGEVLTFLDSHCEVNVNWLPPLLNQIALNHKTIVCPMIDVIDHNHFGYEAQAGDAMRGAFDWEMYYKRIPIPPELQRADPSDPFESPVMAGGLFAVDRKWFWELGGYDPGLEIWGGEQYEISFKVWMCGGEMFDVPCSRVGHIYRKYVPYKVPSGTSLARNLKRVAETWMDEFAEYIYQRRPEYRHLSTGDISAQKELRKQLKCKDFKWFMAAVAWDVPKYYPPVEPPPAAWGEIRNVAANLCVDSKHGATGTELRLDICVKDGSERTWSHEQLFTFGWREDIRPGEPLHTRKFCFDAISHNSPVTLYDCHGMKGNQLWGYRKDRTLFHPVSNSCMDCNPAEKKIFMARCDPLSETQQWIFEHINMTVLEKFNHHANS
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.52, 1.95] ÅDownload
The location of the lectin domain structural model is: 453-586
We infer [1.52, 1.95] Å as the interval of error of this structural model.
Template: 1XHB chain: A, O08912, NP_001153876.1, sequence identity: 30.6%, coverage: 91.0%, location in sequence: 95-553, (95-553 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (4 PubMed Identifiers)
  • The GALNTL6 Gene rs558129 Polymorphism Is Associated With Power Performance. [33105351]
  • UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferases: completion of the family tree. [22186971]
  • Identification of a novel human UDP-GalNAc transferase with unique catalytic activity and expression profile. [20977886]
  • Molecular genetics of successful smoking cessation: convergent genome-wide association study results. [18519826]
UniProt Main References (2 PubMed Identifiers)
  • Generation and annotation of the DNA sequences of human chromosomes 2 and 4. [15815621]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
All isoforms of this gene containing a lectin domain
XP_011530299.1, XP_011530296.1, XP_011530297.1, XP_011530298.1, XP_011530295.1, NP_001030017.2, XP_016863733.1
RNA
RNA (Transcript ID: NM_001034845.3)
polypeptide N-acetylgalactosaminyltransferase like 6
m7G-5')ppp(5'-GCAGACACCAGCGACGUCUCCGCGGAAGGCAGGCGCCGGGGAGUGGGGCGCGGGCGACCGUGUGCAGCCGCGGCGCAUCUCCGCCUUCCGCUCCUCCUCGCAGCGCCCUCGUCCGCUUCCAAGCCCAGCACAGACUUCGGUUUCUCCGCCUCCAUCCCCUUUACGAGAAGAGGAGAUCAAAAAAUAUUGCCCUUUAGGUGCUCGUGAUGGUCCUGUGGGUUCGUUCAGUUGCCAGAAAAGAAUGGUAACAUGAACAGCGGAGCGUGAGAGCGUCACCGGGGGAAGGGACGAGAUUGAUGGGCAGAGCGCUCACUUCUCAGAGGAUCGCAUUCCGAGGACCGCGCGAGGAAGGGACGUCGCGGCGCCACCACUUCCUGGCUGGACUCCGCUGACAUCUGUAGCCUCCUUUCCACCAGGUUCCCGGGGCUCCCAGCCGCUGCCUGCAGAGGAGCGUGUAGACAGCGCGCGAGGGUCCGGCACUUCGUGGACCUCCAUCCGAACCGGAGUUCUGCCCGGAUCCCGAGUCCCUGGAUCCCGGUGGAGCCCGCCGGCAAGCUGGCUCCGGAGGGAGUUGAACUUGAGUUCAGAUGGCCAACUCCCUCUGAAUCCUGCAGAUUGGUGCUGAGCACGCAACAAAAGUUUGUAGCUUCUCAGUUUCUGGUGCUUCGCAGGGGAGAGGAAAGGAAUUUGACAUUAAACACAAGAAGCAGUCAGGGAGCCAUCUCCUUUAACUUUUCUUCUCUGUUACCAUUUGCAAUGAAGAGGAAACAGAAGAGAUUUCUGCAGAUGACUUUGUUGUUCACGGUGGCUUUAAUUUUCCUGCCUAACGUUGGUCUCUGGUCUCUGUACAAGGAUAAGCACCUGGUGAAGUCAGCGGAGCCCGGGGAGCAGCAGACAUUUCCACUGGGCCUGGGAGAUGGGCAAUUCUAUUCAUGGACAGAUGGUUUGAGAAGAAAGGACUGGCAUGACUAUGAAAGCAUUCAGAAAGAGGCUAUGCGCUCAGGGAAAGGUGAACAUGGGAAACCUUACCCCCUUACUGAAGAGGACCAUGAUGACUCAGCUUACAGGGAAAAUGGUUUUAAUAUUUUCGUCAGCAACAAUAUUGCUCUAGAGAGGUCUCUGCCAGAUAUUCGUCAUGCUAACUGUAAGCAUAAGAUGUAUCUGGAAAGGCUGCCAAACACCAGCAUCAUUAUCCCAUUUCAUAAUGAAGGUUGGACUUCACUCCUGCGGACCAUACACAGUAUAAUUAACCGAACCCCAGGGAGUCUGAUAGCAGAAAUCAUUCUAGUAGAUGACUUCAGUGAGAGAGAACACCUGAAGGAUAAAUUGGAAGAAUACAUGGCCCGAUUUUCCAAAGUGAGGAUUGUUCGCACCAAGAAAAGAGAAGGACUCAUCCGGACCCGUCUCCUGGGGGCAUCUAUGGCCAGAGGAGAAGUCCUGACAUUCCUGGACUCCCACUGCGAGGUCAAUGUGAACUGGCUGCCCCCACUCCUCAACCAAAUUGCACUAAACCACAAAACCAUCGUGUGUCCCAUGAUCGAUGUCAUUGACCACAAUCACUUCGGGUAUGAGGCACAAGCUGGGGAUGCCAUGCGAGGAGCCUUCGACUGGGAAAUGUACUACAAAAGAAUCCCCAUCCCUCCAGAGCUCCAGAGGGCAGAUCCCAGCGACCCUUUUGAGUCUCCUGUUAUGGCUGGAGGUCUCUUUGCUGUGGAUCGGAAAUGGUUUUGGGAAUUGGGUGGCUAUGAUCCAGGUUUAGAAAUCUGGGGAGGAGAACAGUAUGAAAUCUCUUUUAAGGUUUGGAUGUGUGGAGGAGAAAUGUUUGAUGUUCCAUGUUCUAGAGUUGGUCAUAUCUACAGGAAGUACGUUCCAUACAAAGUUCCAUCUGGGACAAGCCUGGCAAGAAACCUGAAGCGGGUAGCUGAGACCUGGAUGGAUGAAUUUGCCGAGUACAUUUACCAGCGGCGGCCGGAGUACAGGCAUCUCUCCACGGGGGACAUCUCUGCCCAGAAGGAGCUGCGCAAGCAGCUCAAGUGCAAGGACUUCAAAUGGUUCAUGGCUGCUGUGGCCUGGGACGUGCCUAAAUACUACCCUCCAGUGGAGCCCCCGCCUGCUGCCUGGGGGGAGAUCCGAAAUGUGGCAGCAAAUCUCUGUGUGGACAGCAAGCAUGGAGCCACCGGAACAGAGCUGAGGCUGGACAUCUGUGUCAAGGAUGGUUCUGAAAGAACAUGGUCUCAUGAACAGCUUUUUACCUUUGGAUGGAGAGAAGAUAUUCGACCCGGUGAGCCACUGCAUACCCGGAAAUUCUGCUUUGAUGCGAUCUCACACAACAGCCCCGUUACACUCUAUGACUGUCAUGGCAUGAAGGGGAACCAGCUCUGGGGAUACCGGAAGGACAGAACAUUAUUCCAUCCUGUGAGCAACAGCUGCAUGGAUUGCAACCCCGCAGAGAAGAAGAUUUUCAUGGCCAGAUGUGACCCUCUCUCUGAGACUCAGCAGUGGAUUUUUGAACACAUUAAUAUGACUGUUUUAGAAAAAUUUAACCACCAUGCCAACUCCUAGAAAGAAGAAAGGAAGAAAGAGUGAUUACCUACAGGUUAUAAAUUAAAUUUUAGCCAGCAUCUGGGUCGAAGGAGUCAGGAAUAACAUUUCCUCGAUCCAGGAAGGCUGGUUUAAAAAUUUGCAAAUGCCAUGUCAAAGUAGGUUGUUUUGAAGAACUUCCUGCAUCUGAAGAACUUGGCUGAGAAUCUCACCAGCUGCUUCUGAGAACUCGAGACUAGCAGUUCCCUUGCUGGCCAAGGGCAAAGAUAAUUUAGGGACUUUUCAAAACAACUGCUGAGCUAAUAAAUCCUAGCAUUUCUCAGGUCAAAUCCUGCAGUAGUGAGUAGCUAUGAAUGGAUCCUAUUAACUGGGUGGGAGGGGGGUGAAAAUGGAGUGCAUGACUGCUCUGACAACCUGAGGAUAUCACAGGUUUAGAACUAGCCAAGCUUAAGGGGUGAGCUGUACUCUUUGGUGCCAUUCUCUGACUAAGAAUGGGUUCAGCAGGUUUAACCCUUAAAAGUGCUGCAGAUGAUUUCAGAGUGCUCACACUAUUCUGUUUUUUUUAUUUUUAUUUUUAAAUGAGGGUGCAAUAUCUAAUGUAAGACUUAAAUUACAUAAUGAAAUGGACAUCCAGUGUUCCCAUUCUUUCGUUUAUAUUUGCCAUUUUUUUUUCAGAGCAAAGUUUCUUUUUUAUGAAAGUUCAUGCUCCAUGAAUCCACUGAAUUUCUAAUUCAGUGCCCUUCUAUGAAUCCAGUUAAAAACAAAAGCAAAAGCAAAAAUCUAUGCUAUCAAGUUACUCCAAAGAAAGAUUUCACAGAAGCAGCAAAACCAUAUAAGAUUUAGGAGAGGGACUUCCCUGGGAAAUCUAUUUUUACUUUUCUAUUAUUUUUAAAAUCUUAAAAGUCUGAUAUUUGUCCAGUCAUAAUUUUUAUUAAGCAAGGAAAUGGAGUGAGUUUGAUGUAAUUUGUUUAGGAGAUUCUUAAACCCAAAUAAAUCUACACUCCAAGUGAUAUGUGAAAAUGGCUUAGUUCACUUCAAUUCUGUUUAGUCAGUGGUGGGAGCUUAGAAGUGGUUUUAUUUGUUCGUUUGUUUGGGUUUUGCUUUUGUUUUUUAUUUUUUUCUUGUUUUUUUUUUGUAGUGUUGAAUUAAUGAUGUUCUUUUAUUUGGAAGCUCAUAAAAGGAAUUACCAUUAAUAAAGUGUUUCUGACACCAUUUUCUGUUAAUGGGACAAUAUUUCGGGGAUGAAGAAAGGAAUGCUCCGAAAACUAAAUGGAACACUUAAUCCUUAAAGCAAUUUUUUACUGUUCAAUAAUAUCACAUUGGGGGAAGAAAACACAGGUAUCAAGGUGGUUCUUGGGAAAAAAGAAUCAUGUUUAUUAUAUAUCUCUCAAGUUUUUUUGGUAUAAAAAUGUUUUAACUUUGCUUUCUUUUUGGUUUUUGUUUGAAGUUGGUUUUCCUGUUAAUAAAAAUUUAUAUAACA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 442117)
polypeptide N-acetylgalactosaminyltransferase like 6
strand +
GALNT17, GalNAc-T6L
NCBI CDS gene sequence (1806 bp)
5'-ATGAAGAGGAAACAGAAGAGATTTCTGCAGATGACTTTGTTGTTCACGGTGGCTTTAATTTTCCTGCCTAACGTTGGTCTCTGGTCTCTGTACAAGGATAAGCACCTGGTGAAGTCAGCGGAGCCCGGGGAGCAGCAGACATTTCCACTGGGCCTGGGAGATGGGCAATTCTATTCATGGACAGATGGTTTGAGAAGAAAGGACTGGCATGACTATGAAAGCATTCAGAAAGAGGCTATGCGCTCAGGGAAAGGTGAACATGGGAAACCTTACCCCCTTACTGAAGAGGACCATGATGACTCAGCTTACAGGGAAAATGGTTTTAATATTTTCGTCAGCAACAATATTGCTCTAGAGAGGTCTCTGCCAGATATTCGTCATGCTAACTGTAAGCATAAGATGTATCTGGAAAGGCTGCCAAACACCAGCATCATTATCCCATTTCATAATGAAGGTTGGACTTCACTCCTGCGGACCATACACAGTATAATTAACCGAACCCCAGGGAGTCTGATAGCAGAAATCATTCTAGTAGATGACTTCAGTGAGAGAGAACACCTGAAGGATAAATTGGAAGAATACATGGCCCGATTTTCCAAAGTGAGGATTGTTCGCACCAAGAAAAGAGAAGGACTCATCCGGACCCGTCTCCTGGGGGCATCTATGGCCAGAGGAGAAGTCCTGACATTCCTGGACTCCCACTGCGAGGTCAATGTGAACTGGCTGCCCCCACTCCTCAACCAAATTGCACTAAACCACAAAACCATCGTGTGTCCCATGATCGATGTCATTGACCACAATCACTTCGGGTATGAGGCACAAGCTGGGGATGCCATGCGAGGAGCCTTCGACTGGGAAATGTACTACAAAAGAATCCCCATCCCTCCAGAGCTCCAGAGGGCAGATCCCAGCGACCCTTTTGAGTCTCCTGTTATGGCTGGAGGTCTCTTTGCTGTGGATCGGAAATGGTTTTGGGAATTGGGTGGCTATGATCCAGGTTTAGAAATCTGGGGAGGAGAACAGTATGAAATCTCTTTTAAGGTTTGGATGTGTGGAGGAGAAATGTTTGATGTTCCATGTTCTAGAGTTGGTCATATCTACAGGAAGTACGTTCCATACAAAGTTCCATCTGGGACAAGCCTGGCAAGAAACCTGAAGCGGGTAGCTGAGACCTGGATGGATGAATTTGCCGAGTACATTTACCAGCGGCGGCCGGAGTACAGGCATCTCTCCACGGGGGACATCTCTGCCCAGAAGGAGCTGCGCAAGCAGCTCAAGTGCAAGGACTTCAAATGGTTCATGGCTGCTGTGGCCTGGGACGTGCCTAAATACTACCCTCCAGTGGAGCCCCCGCCTGCTGCCTGGGGGGAGATCCGAAATGTGGCAGCAAATCTCTGTGTGGACAGCAAGCATGGAGCCACCGGAACAGAGCTGAGGCTGGACATCTGTGTCAAGGATGGTTCTGAAAGAACATGGTCTCATGAACAGCTTTTTACCTTTGGATGGAGAGAAGATATTCGACCCGGTGAGCCACTGCATACCCGGAAATTCTGCTTTGATGCGATCTCACACAACAGCCCCGTTACACTCTATGACTGTCATGGCATGAAGGGGAACCAGCTCTGGGGATACCGGAAGGACAGAACATTATTCCATCCTGTGAGCAACAGCTGCATGGATTGCAACCCCGCAGAGAAGAAGATTTTCATGGCCAGATGTGACCCTCTCTCTGAGACTCAGCAGTGGATTTTTGAACACATTAATATGACTGTTTTAGAAAAATTTAACCACCATGCCAACTCCTAG-3'
NCBI CDS gene sequence with introns (location: 171814581.. 173040100) (1225520 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 171813404.. 173041559) (1228156 bp)Download
NCBI gene sequence (location: [171813404 - 1000].. 173041559) (1229156 bp)Download
Cite How to cite