Protein
Protein (NP_001136147)
SI-CLP
Chitinase domain-containing protein 1 (Stabilin-1-interacting chitinase-like protein) (SI-CLP)
CHID1
chitinase domain containing 1
Undefined
Curated
chi-lectin TIM
Chilectins
a/b barrel / TIM
GlcNAc(b1-4)GlcNAc / Chitooligosaccharides
Undefined
Undefined
Protein sequence and protein families (fasta) (393 amino acids) Download
MRTLFNLLWLALACSPVHTTLSKSDAKKAASKTLLEKSQFSDKPVQDRGLVVTDLKAESVVLEHRSYCSAKARDRHFAGDVLGYVTPWNSHGYDVTKVFGSKFTQISPVWLQLKRRGREMFEVTGLHDVDQGWMRAVRKHAKGLHIVPRLLFEDWTYDDFRNVLDSEDEIEELSKTVVQVAKNQHFDGFVVEVWNQLLSQKRVGLIHMLTHLAEALHQARLLALLVIPPAITPGTDQLGMFTHKEFEQLAPVLDGFSLMTYDYSTAHQPGPNAPLSWVRACVQVLDPKSKWRSKILLGLNFYGMDYATSKDAREPVVGARYIQTLKDHRPRMVWDSQASEHFFEYKKSRSGRHVVFYPTLKSLQVRLELARELGVGVSIWELGQGLDYFYDLL
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Brain CHID1 Expression Correlates with NRGN and CALB1 in Healthy Subjects and AD Patients. [33924468]
  • CHID1 Is a Novel Prognostic Marker of Non-Small Cell Lung Cancer. [33466316]
  • CHID1 positively regulates RLR antiviral signaling by targeting the RIG-I/VISA signalosome. [31106867]
  • Role of chitinase-like proteins in cancer. [26733160]
  • Genetic susceptibility for chronic bronchitis in chronic obstructive pulmonary disease. [25241909]
  • Structure of human stabilin-1 interacting chitinase-like protein (SI-CLP) reveals a saccharide-binding cleft with lower sugar-binding selectivity. [20724479]
  • Defining the membrane proteome of NK cells. [19946888]
  • Proteomic analysis of human parotid gland exosomes by multidimensional protein identification technology (MudPIT). [19199708]
  • Crystallization and preliminary X-ray crystallographic studies on SI-CLP, a novel human Glyco_18 domain-containing protein. [19275751]
  • Novel stabilin-1 interacting chitinase-like protein (SI-CLP) is up-regulated in alternatively activated macrophages and secreted via lysosomal pathway. [16357325]
UniProt Main References (5 PubMed Identifiers)
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. [16303743]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Initial characterization of the human central proteome. [21269460]
  • N-terminome analysis of the human mitochondrial proteome. [25944712]
RNA
RNA (Transcript ID: NM_001142675.2)
chitinase domain containing 1, transcript variant 1
m7G-5')ppp(5'-AGAGCCGCCGCGACCCCACCCAGGAGCACUGGCCAGCCUGGGGAAGACACAAACCCAGCCCCAAAGGCCCCACAGCCACCAGGCACCUCCAACAACCAGGUCCCUCUGGACCCCGAGGUUGGACCCUACUGUGACACACCUACCAUGCGGACACUCUUCAACCUCCUCUGGCUUGCCCUGGCCUGCAGCCCUGUUCACACUACCCUGUCAAAGUCAGAUGCCAAAAAAGCCGCCUCAAAGACGCUGCUGGAGAAGAGUCAGUUUUCAGAUAAGCCGGUGCAAGACCGGGGUUUGGUGGUGACGGACCUCAAAGCUGAGAGUGUGGUUCUUGAGCAUCGCAGCUACUGCUCGGCAAAGGCCCGGGACAGACACUUUGCUGGGGAUGUACUGGGCUAUGUCACUCCAUGGAACAGCCAUGGCUACGAUGUCACCAAGGUCUUUGGGAGCAAGUUCACACAGAUCUCACCCGUCUGGCUGCAGCUGAAGAGACGUGGCCGUGAGAUGUUUGAGGUCACGGGCCUCCACGACGUGGACCAAGGGUGGAUGCGAGCUGUCAGGAAGCAUGCCAAGGGCCUGCACAUAGUGCCUCGGCUCCUGUUUGAGGACUGGACUUACGAUGAUUUCCGGAACGUCUUAGACAGUGAGGAUGAGAUAGAGGAGCUGAGCAAGACCGUGGUCCAGGUGGCAAAGAACCAGCAUUUCGAUGGCUUCGUGGUGGAGGUCUGGAACCAGCUGCUAAGCCAGAAGCGCGUGGGCCUCAUCCACAUGCUCACCCACUUGGCCGAGGCUCUGCACCAGGCCCGGCUGCUGGCCCUCCUGGUCAUCCCGCCUGCCAUCACCCCCGGGACCGACCAGCUGGGCAUGUUCACGCACAAGGAGUUUGAGCAGCUGGCCCCCGUGCUGGAUGGUUUCAGCCUCAUGACCUACGACUACUCUACAGCGCAUCAGCCUGGCCCUAAUGCACCCCUGUCCUGGGUUCGAGCCUGCGUCCAGGUCCUGGACCCGAAGUCCAAGUGGCGAAGCAAAAUCCUCCUGGGGCUCAACUUCUAUGGUAUGGACUACGCGACCUCCAAGGAUGCCCGUGAGCCUGUUGUCGGGGCCAGGUACAUCCAGACACUGAAGGACCACAGGCCCCGGAUGGUGUGGGACAGCCAGGCCUCAGAGCACUUCUUCGAGUACAAGAAGAGCCGCAGUGGGAGGCACGUCGUCUUCUACCCAACCCUGAAGUCCCUGCAGGUGCGGCUGGAGCUGGCCCGGGAGCUGGGCGUUGGGGUCUCUAUCUGGGAGCUGGGCCAGGGCCUGGACUACUUCUACGACCUGCUCUAGGUGGGCAUUGCGGCCUCCGCGGUGGACGUGUUCUUUUCUAAGCCAUGGAGUGAGUGAGCAGGUGUGAAAUACAGGCCUCCACUCCGUUUGCUGUGACGGGUCUGCUGCAGUCCUCAGUCGGGGGUCCUGGGCACCAUGUGACUCCCCAUCCUCCCAUGAGGGGUCCCUGCCCUGGAUGAGUCCUAGCUGGGGGACACCCUGAGAGCUCGAGCCCCUCCCACCCGGGCAUCCGCUGGCUGCCUCCUGUCAGCUGGGCAGGCGGGGCCCACAGUACCUGCCCCACCAGGACAGCCUGGCUCAGGCCUUUCUGGGCUGCUUCUCACAUCCUGGGCUGGAUGUGGGUUUGGAAGCUCUGGAACCAUCCCGGACUCGCCCACUCCUGGAUUCGAGGGCCCUCGCAGGGACAGCUCUGCCCAGCAUCACCCCAGGGCCUGGCAGUGAUAGAGCUGAGAGCUCCACCCCCACAUACCUGCCACCCACCUGGCCAGCCACAGCACGUGUGUCACCUGCAGAGAGCCACCCAGACGUCCCCACCGAGUCCAGCACGGCAAGGGUGCAGGGGCUGCCCUAGAAAUGGGCUCAGAGGAGCCUGGCCCACCCUCUUGAAACUGGUCCUGGACCUUGGCUCAGCUCUGCCGCCUCAGGUAGCACGACCCCCAGGCCAGCCUGGACACAUCAGGGAGCAUGGUGAGGGGCAACGGCAGGACCCGUGGGCCAUAUCGGGACAGGCAUUUCCAGCGAGGGGUGGGGCAGAGGACAUGUGGCUGGCAGGCUACACCCACCCUGCCAUGCAGCGGUGUCCAGGCUCUGGGGAGGCCCUGGGGAAUUUGGAGGCAUCAUGAGCCAAGGCCUGGUGGCCCUCGUUCCCCUGCCCCUCGUCACCAUCCUGUCCUUGGCUGGCCGUGAGGACUCCCCUCCUCACCACUGGGUCCCACAGGGCUGAGGUGGGCAGUAGAGGGCAUAGGUGGGUACAUGUCCCGGGCAAGGUCUCUCGGGGGGACAGAAGUGAGUCCAGGGAGUGGGUGGGCCUGGGCGUCCCUCACUCAGAAUGCCGUGGGGUGAGGACGGUGAGGACAGGGUGGGCACUGGGUUCUGGUUUAGAGUCAGUAAUGUUAGGGCGCAGUGGGCAGGGGGUCAGGACAUCUCCAGCCGGUGGUGAGGAAGCAUGGUGGGGUCUCCUCCACAGGACGGGAGCUGGGGAGGGGGUCCUGGGUCGGACCCAAGGCACCCACACUUGAGAAAGCCUCCGCCUGGACGUCAGGGAGGCCUGCGAGCUGCCACAGUGCAGGUGCAGCCGUUCCCACCGCCCUGCUGCUGCUUGACACGGGCAUAGGAGAUACAAGUGGUGUGUGCGGCGGUUCAUGCCUGUAAUCCCAGUACUUUGGAAAGCCGUGGCGGGAGGAACGCUGGGCAACAUGGUGAAACCCCGUCUCUACCCCCUAAAAAUAGAAAAAUUAGCAAGACAUGGUGGCAUGUGCCUGUACUCCUGGCUACUCAGGAGGCUGAGAUGGGAGGAUCGCUUGAUGAGGUUGAGGCUGCAGUGAGCUGUGACCGACUGCACUCCAAAAACCUUGUCUAAAAAAACACAAGCUGCCACUGGCUUUGGGGCACUGACCUUGUCUCCCCAGAGGUGCUGACGCUAACAUUCAAGUUGUUCUCGGGGGUCCUGUGGCUUCUGUUGGAGUGAGGGUGGGGGACACGCAGGUCUGGGAGGGUGGUGUGGGCCUGGAGCUAGGCAUUGCCAGAUCAGCAUUGGGUGGAGGCAGGGGUGGGGAUGCCACACAGGAUGGGAUGUCUAGAGCGGGCUGUGUCUCCCGGGGGGAUGGGCAGAGGGUGGGGCAGGAAUUAGCUGGAAAUGAGAUUGUGGGGUGCAGUUUGGGGAUCAGAUGCCCCAACCUGAACUGACCGUCAUCCCUGUGGCCAGGGUCCCCACACAACCCUCACCCCUGGCUGUGAGAAUCCUGAGGCACCUUGAUGCAUUUUUUUUCAUGCCCUGUGA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 66005)
chitinase domain containing 1
strand -
MGC3234, FLJ42707, SI-CLP
NCBI CDS gene sequence (1182 bp)
5'-ATGCGGACACTCTTCAACCTCCTCTGGCTTGCCCTGGCCTGCAGCCCTGTTCACACTACCCTGTCAAAGTCAGATGCCAAAAAAGCCGCCTCAAAGACGCTGCTGGAGAAGAGTCAGTTTTCAGATAAGCCGGTGCAAGACCGGGGTTTGGTGGTGACGGACCTCAAAGCTGAGAGTGTGGTTCTTGAGCATCGCAGCTACTGCTCGGCAAAGGCCCGGGACAGACACTTTGCTGGGGATGTACTGGGCTATGTCACTCCATGGAACAGCCATGGCTACGATGTCACCAAGGTCTTTGGGAGCAAGTTCACACAGATCTCACCCGTCTGGCTGCAGCTGAAGAGACGTGGCCGTGAGATGTTTGAGGTCACGGGCCTCCACGACGTGGACCAAGGGTGGATGCGAGCTGTCAGGAAGCATGCCAAGGGCCTGCACATAGTGCCTCGGCTCCTGTTTGAGGACTGGACTTACGATGATTTCCGGAACGTCTTAGACAGTGAGGATGAGATAGAGGAGCTGAGCAAGACCGTGGTCCAGGTGGCAAAGAACCAGCATTTCGATGGCTTCGTGGTGGAGGTCTGGAACCAGCTGCTAAGCCAGAAGCGCGTGGGCCTCATCCACATGCTCACCCACTTGGCCGAGGCTCTGCACCAGGCCCGGCTGCTGGCCCTCCTGGTCATCCCGCCTGCCATCACCCCCGGGACCGACCAGCTGGGCATGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGATGGTTTCAGCCTCATGACCTACGACTACTCTACAGCGCATCAGCCTGGCCCTAATGCACCCCTGTCCTGGGTTCGAGCCTGCGTCCAGGTCCTGGACCCGAAGTCCAAGTGGCGAAGCAAAATCCTCCTGGGGCTCAACTTCTATGGTATGGACTACGCGACCTCCAAGGATGCCCGTGAGCCTGTTGTCGGGGCCAGGTACATCCAGACACTGAAGGACCACAGGCCCCGGATGGTGTGGGACAGCCAGGCCTCAGAGCACTTCTTCGAGTACAAGAAGAGCCGCAGTGGGAGGCACGTCGTCTTCTACCCAACCCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTTGGGGTCTCTATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTCTAG-3'
NCBI CDS gene sequence with introns (location: 869858.. 904816) (34959 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 867859.. 914845) (46987 bp)Download
NCBI gene sequence (location: [867859.. 914845 + 1000]) (47987 bp)Download
Cite How to cite