NCBI Summary
This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008].
Protein
Protein (NP_059119)
CBM13-ppGalNAc-T7
N-acetylgalactosaminyltransferase 7 (EC 2.4.1.41) (Polypeptide GalNAc transferase 7) (GalNAc-T7) (pp-GaNTase 7) (Protein-UDP acetylgalactosaminyltransferase 7) (UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 7)
GALNT7
polypeptide N-acetylgalactosaminyltransferase 7
Undefined
Curated
Ricin-like
R-Type Lectins
b-trefoil
Undefined
Protein sequence and protein families (fasta) (657 amino acids) Download
MRLKIGFILRSLLVVGSFLGLVVLWSSLTPRPDDPSPLSRMREDRDVNDPMPNRGGNGLAPGEDRFKPVVPWPHVEGVEVDLESIRRINKAKNEQEHHAGGDSQKDIMQRQYLTFKPQTFTYHDPVLRPGILGNFEPKEPEPPGVVGGPGEKAKPLVLGPEFKQAIQASIKEFGFNMVASDMISLDRSVNDLRQEECKYWHYDENLLTSSVVIVFHNEGWSTLMRTVHSVIKRTPRKYLAEIVLIDDFSNKEHLKEKLDEYIKLWNGLVKVFRNERREGLIQARSIGAQKAKLGQVLIYLDAHCEVAVNWYAPLVAPISKDRTICTVPLIDVINGNTYEIIPQGGGDEDGYARGAWDWSMLWKRVPLTPQEKRLRKTKTEPYRSPAMAGGLFAIEREFFFELGLYDPGLQIWGGENFEISYKIWQCGGKLLFVPCSRVGHIYRLEGWQGNPPPIYVGSSPTLKNYVRVVEVWWDEYKDYFYASRPESQALPYGDISELKKFREDHNCKSFKWFMEEIAYDITSHYPLPPKNVDWGEIRGFETAYCIDSMGKTNGGFVELGPCHRMGGNQLFRINEANQLMQYDQCLTKGADGSKVMITHCNLNEFKEWQYFKNLHRFTHIPSGKCLDRSEVLHQVFISNCDSSKTTQKWEMNNIHSV
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
GalNAc
GalNAc
References
NCBI References (10 PubMed Identifiers)
  • Long non-coding RNA TP73-AS1 contributes to glioma tumorigenesis by sponging the miR-103a/GALNT7 pathway. [32416102]
  • Structural basis of carbohydrate transfer activity of UDP-GalNAc: Polypeptide N-acetylgalactosaminyltransferase 7. [30685086]
  • Long non-coding RNA-SNHG7 acts as a target of miR-34a to increase GALNT7 level and regulate PI3K/Akt/mTOR pathway in colorectal cancer progression. [29970122]
  • miR-214 inhibits invasion and migration via downregulating GALNT7 in esophageal squamous cell cancer. [27619677]
  • GALNT7, a target of miR-494, participates in the oncogenesis of nasopharyngeal carcinoma. [26503214]
  • MicroRNA-214 suppresses growth and invasiveness of cervical cancer cells by targeting UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7. [22399294]
  • miR-30b/30d regulation of GalNAc transferases enhances invasion and immunosuppression during metastasis. [21741600]
  • Defining the membrane proteome of NK cells. [19946888]
  • MicroRNA miR-378 regulates nephronectin expression modulating osteoblast differentiation by targeting GalNT-7. [19844573]
  • A novel human UDP-N-acetyl-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase, GalNAc-T7, with specificity for partial GalNAc-glycosylated acceptor substrates. [10544240]
UniProt Main References (4 PubMed Identifiers)
  • Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. [16303743]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Functional conservation of subfamilies of putative UDP-N-acetylgalactosamine:polypeptide N-acetylgalactosaminyltransferases in Drosophila, Caenorhabditis elegans, and mammals. One subfamily composed of l(2)35Aa is essential in Drosophila. [11925450]
  • Initial characterization of the human central proteome. [21269460]
RNA
RNA (Transcript ID: NM_017423.3)
polypeptide N-acetylgalactosaminyltransferase 7, transcript variant 1
m7G-5')ppp(5'-GUGAGUCUCUCGCCGCCGGAGGAAGAUGAGGCUGAAGAUUGGGUUCAUCUUACGCAGUUUGCUGGUGGUGGGAAGCUUCCUGGGGCUAGUGGUCCUCUGGUCUUCCCUGACCCCGCGGCCGGACGACCCAAGCCCGCUGAGCAGGAUGAGGGAAGACAGAGAUGUCAAUGACCCCAUGCCCAACCGAGGCGGCAAUGGACUAGCUCCUGGGGAGGACAGAUUCAAACCUGUGGUACCAUGGCCUCAUGUUGAAGGAGUAGAAGUGGACUUAGAGUCUAUUAGAAGAAUAAACAAGGCCAAAAAUGAACAAGAGCACCAUGCUGGAGGAGAUUCCCAGAAAGAUAUCAUGCAGAGGCAGUAUCUCACAUUUAAGCCUCAGACAUUCACCUACCAUGAUCCUGUGCUUCGCCCAGGGAUCCUCGGUAACUUUGAACCCAAAGAACCUGAGCCUCCUGGAGUGGUUGGUGGCCCUGGAGAGAAAGCCAAGCCAUUGGUUUUGGGACCAGAAUUCAAACAAGCAAUUCAAGCCAGCAUUAAAGAGUUUGGAUUUAACAUGGUGGCAAGUGACAUGAUCUCACUGGACCGCAGCGUCAAUGACUUACGCCAAGAAGAAUGCAAGUAUUGGCAUUAUGAUGAAAACUUGCUCACUUCGAGCGUUGUCAUUGUCUUCCAUAAUGAAGGAUGGUCAACCCUCAUGAGAACAGUCCACAGUGUAAUUAAAAGGACUCCAAGGAAAUAUUUAGCAGAAAUUGUGUUAAUUGACGAUUUCAGUAAUAAAGAACACUUAAAAGAAAAACUGGAUGAAUAUAUUAAGCUGUGGAAUGGCCUAGUGAAGGUAUUUCGAAAUGAAAGAAGGGAAGGUUUAAUUCAAGCACGAAGUAUUGGUGCUCAGAAGGCUAAACUUGGACAGGUUUUGAUAUACCUUGAUGCCCACUGUGAGGUGGCAGUUAACUGGUAUGCACCACUUGUAGCUCCCAUAUCUAAGGACAGAACCAUUUGCACUGUGCCGCUUAUAGAUGUCAUAAAUGGCAACACAUAUGAAAUUAUACCCCAAGGGGGUGGUGAUGAAGAUGGGUAUGCCCGAGGAGCAUGGGAUUGGAGUAUGCUCUGGAAACGGGUGCCUCUGACCCCUCAAGAGAAGAGACUGAGAAAGACAAAAACUGAACCGUAUCGGUCCCCAGCCAUGGCUGGGGGAUUAUUUGCCAUUGAACGAGAGUUCUUCUUUGAAUUGGGUCUCUAUGAUCCAGGUCUCCAGAUUUGGGGUGGUGAAAACUUUGAGAUCUCAUACAAGAUAUGGCAGUGUGGUGGCAAAUUAUUAUUUGUUCCUUGUUCUCGUGUUGGACAUAUCUACCGUCUUGAGGGCUGGCAAGGAAAUCCUCCGCCCAUUUAUGUUGGGUCUUCUCCAACUCUGAAGAAUUAUGUUAGAGUUGUGGAGGUUUGGUGGGAUGAAUAUAAAGACUACUUCUAUGCUAGUCGUCCUGAAUCGCAGGCAUUACCAUAUGGGGAUAUAUCGGAGCUGAAAAAAUUUCGAGAAGAUCACAACUGCAAAAGUUUUAAGUGGUUCAUGGAAGAAAUAGCUUAUGAUAUCACCUCACACUACCCUUUGCCACCCAAAAAUGUUGACUGGGGAGAAAUCAGAGGCUUCGAAACUGCUUACUGCAUUGAUAGCAUGGGAAAAACAAAUGGAGGCUUUGUUGAACUAGGACCCUGCCACAGGAUGGGAGGGAAUCAGCUUUUCAGAAUCAAUGAAGCAAAUCAACUCAUGCAGUAUGACCAGUGUUUGACAAAGGGAGCUGAUGGAUCAAAAGUUAUGAUUACACACUGUAAUCUAAAUGAAUUUAAGGAAUGGCAGUACUUCAAGAACCUGCACAGAUUUACUCAUAUUCCUUCAGGAAAGUGUUUAGAUCGCUCAGAGGUCCUGCAUCAAGUAUUCAUCUCCAAUUGUGACUCCAGUAAAACGACUCAAAAAUGGGAAAUGAAUAACAUCCAUAGUGUUUAGAGAGAAAAAAAUAAACCAAUAACCUACCUACUGACAAGUAAAUUUAUACAGGACUGAAAACCGCCUGAAACCUGCUGCAACUAUUGUUAUUAACUCUGUAUAGCUCCAAACCUGGAACCUCCUGAUCAGUUUGAAGGACAUUGAUAAACUGUGAUUUUACAAUAACAUUAUCAUCUGCAGUUACUGUUUACAAGACUGCUUUUACCUUAAACUUUGUAGAUGUUUACAUCUUUUUGUUGUGUUUUAAGAUGAUGUUGGUAAUUUGUGCCUUUAGCUCUGUUUUAUUAGACAGAGUUAAAGCAUGUUGUCUUCUUUGGGAUUACACUCAGGGGUCUGAAAGGCAGUUUGAUUUUUAUUUUUAACACACUUGAAAAAAGGUUGGAGUAGCCAGACUUUCAUAUAUAACUUGGUGAUUAUCAACCUGUUGUGUCUUUAUUUAAUUUUACAUCUUUUUGAAGCACUGCCACAGGUUAUUAGCCAAGGUGGCCUUCCUUCACAGUCAUGCUGCUUUUUUGAAAGGUGAAUUUCAACACAUUUAGUGCCUCUUUCAUUUCUCAGUAUAUAUUUCAAGAGCUUGUGAUGAAAUCUAUAGGAUGGUAAUGAUGGACUUGUCACCUGUAUGGGGAAUACUUUUACUACUCAGAAAUGAAUUUAUGUGCUGCCAUUUGCUAUAAAGUUGAACUUUGUAUGGCUUGAAAAAGAAAUGACAAUAUGGAACAUCCCAAGGCUGUCCCAUAGGGUUGGAAGUUGUGUAGCAUUCACUCCCUUACCUACUGGCAUUCCCAGUGCCCUCUGUCCAUACCUACUUCUAGGAUUGCAAAGGAGUCUUCCAACUAGAGAAAAAUUGUCCACUGACAUUUGGGAUUUACUUUUCUCCAAUACCUGCCAAUACAGAAAACUAUUAUCAGUUGUUAUUGUUAUCCCUUGAAAGCGAGGGUGACAAAAACAACAAAACACCGUUAUAAACACAUCAAAGGUUCAUUCUGACUGAGGUAAGACUUUCCAAGCCCUUGUUAGAUUAGGCCUUAUAAAACUUGUGUGCAUUAUAACCUAAGCUGUGCAACCUGUGAAGCCAAGAGUGAACUGAUGUUUCAUUUAUAUUUUCAUCCAAAUGACAUUAUCUGCACGUUUUUAAAAUUUAAAAACAAAGGACUAUUUAAAAAUACAGUUUAUUAACAAACGUGAACUACUUUCUGUUACAUUAGGUGUUCCCUAGUGUUUCUUAAUUUCUUUUUAGAAAGUGUAUUUUUAUUAGUAUUUUUCCGGUGAACAGAAGAUUUGUUUGGAUUUAAACAUUUACUAAGACAGUACCUAUUAGGAAAACCAAAUAUUGCAAAUGGUCAAUUCGAUUUUAAUUUCUCAAAAGAUACUCUGUUAUCCAGAAGAUUAAAAUGCCUACAUUGAGUGCUUAAAAAAAAAAAAACAACUGUGAUGAUGUGAGCAGAAUGGCAAGUAAGUUAAGCAUUUUUGAUCCUGUAAUCAUGGUAUCAUUACAAUGAAAGGAAUUCACAAACUACUGCCAGAGGAAGUUUGUUUUUUAAUUUAAGAGGGAAAUAUAACCUAUAAAUUUGUUUCUUCCAAGCUUAGCUCUUAAAUUUGGAGACUCAAAGUUAAACAUCCUCAACAGAGUUUUAUUUAUAAUUUUGAAUUGUCAAUUUGUAUUUUGCUACUGAUCUGUGAUCAACCAUUUUAACUUUCAUCUCUAGGGAUGUUUAACAUUUAUAAUUGCAAAAUAAACCAACUAUAAAAAAAGAAACUAAGAGAGAAUUGGUACUUUAAUUACUUGUGUGUUUGCAAAUAGGCUCCAUUUUCCAUGUUGAGUAGAUUAUAACCUUAUUAACUAUGCAUAGGCCUAAGAAAGGUGGCAAUGAACUGUGCAUGUAAAUUUUAAAUGGGUACUUUGUGCAAUUCGUUAAAAGAAGAUACUCUAUGAAUAUGAUUCUAUAUAUUGAAAUCAGAAAACCUACCAAACAAAAACAUCAGAAGCUGCUGCCAUAAUGACUAUUUUCUACUGUAGGCUGCUUUGGAAAUAAUUCCCAUAUCCUUGCUUUGUAAGUUGGUAAUAUCACUAUGCAUUUCUACACAUUUUAUAAAUUUGAUUUAUGCAGAUUUUGAUACACUGUAUGUUUCUGUAGAAAUUGUAUAAAUAUUCAAAAUUUUAUUAGGAUAAAUUUGAGAAACUUACGUAUAUCUUAAUUCUGGGUUGCUUGUUUUUUAGGUGACAAAAAUAAAAUAUUGUAUUUUAAUUCA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 51809)
polypeptide N-acetylgalactosaminyltransferase 7
strand +
GALNAC-T7
NCBI CDS gene sequence (1974 bp)
5'-ATGAGGCTGAAGATTGGGTTCATCTTACGCAGTTTGCTGGTGGTGGGAAGCTTCCTGGGGCTAGTGGTCCTCTGGTCTTCCCTGACCCCGCGGCCGGACGACCCAAGCCCGCTGAGCAGGATGAGGGAAGACAGAGATGTCAATGACCCCATGCCCAACCGAGGCGGCAATGGACTAGCTCCTGGGGAGGACAGATTCAAACCTGTGGTACCATGGCCTCATGTTGAAGGAGTAGAAGTGGACTTAGAGTCTATTAGAAGAATAAACAAGGCCAAAAATGAACAAGAGCACCATGCTGGAGGAGATTCCCAGAAAGATATCATGCAGAGGCAGTATCTCACATTTAAGCCTCAGACATTCACCTACCATGATCCTGTGCTTCGCCCAGGGATCCTCGGTAACTTTGAACCCAAAGAACCTGAGCCTCCTGGAGTGGTTGGTGGCCCTGGAGAGAAAGCCAAGCCATTGGTTTTGGGACCAGAATTCAAACAAGCAATTCAAGCCAGCATTAAAGAGTTTGGATTTAACATGGTGGCAAGTGACATGATCTCACTGGACCGCAGCGTCAATGACTTACGCCAAGAAGAATGCAAGTATTGGCATTATGATGAAAACTTGCTCACTTCGAGCGTTGTCATTGTCTTCCATAATGAAGGATGGTCAACCCTCATGAGAACAGTCCACAGTGTAATTAAAAGGACTCCAAGGAAATATTTAGCAGAAATTGTGTTAATTGACGATTTCAGTAATAAAGAACACTTAAAAGAAAAACTGGATGAATATATTAAGCTGTGGAATGGCCTAGTGAAGGTATTTCGAAATGAAAGAAGGGAAGGTTTAATTCAAGCACGAAGTATTGGTGCTCAGAAGGCTAAACTTGGACAGGTTTTGATATACCTTGATGCCCACTGTGAGGTGGCAGTTAACTGGTATGCACCACTTGTAGCTCCCATATCTAAGGACAGAACCATTTGCACTGTGCCGCTTATAGATGTCATAAATGGCAACACATATGAAATTATACCCCAAGGGGGTGGTGATGAAGATGGGTATGCCCGAGGAGCATGGGATTGGAGTATGCTCTGGAAACGGGTGCCTCTGACCCCTCAAGAGAAGAGACTGAGAAAGACAAAAACTGAACCGTATCGGTCCCCAGCCATGGCTGGGGGATTATTTGCCATTGAACGAGAGTTCTTCTTTGAATTGGGTCTCTATGATCCAGGTCTCCAGATTTGGGGTGGTGAAAACTTTGAGATCTCATACAAGATATGGCAGTGTGGTGGCAAATTATTATTTGTTCCTTGTTCTCGTGTTGGACATATCTACCGTCTTGAGGGCTGGCAAGGAAATCCTCCGCCCATTTATGTTGGGTCTTCTCCAACTCTGAAGAATTATGTTAGAGTTGTGGAGGTTTGGTGGGATGAATATAAAGACTACTTCTATGCTAGTCGTCCTGAATCGCAGGCATTACCATATGGGGATATATCGGAGCTGAAAAAATTTCGAGAAGATCACAACTGCAAAAGTTTTAAGTGGTTCATGGAAGAAATAGCTTATGATATCACCTCACACTACCCTTTGCCACCCAAAAATGTTGACTGGGGAGAAATCAGAGGCTTCGAAACTGCTTACTGCATTGATAGCATGGGAAAAACAAATGGAGGCTTTGTTGAACTAGGACCCTGCCACAGGATGGGAGGGAATCAGCTTTTCAGAATCAATGAAGCAAATCAACTCATGCAGTATGACCAGTGTTTGACAAAGGGAGCTGATGGATCAAAAGTTATGATTACACACTGTAATCTAAATGAATTTAAGGAATGGCAGTACTTCAAGAACCTGCACAGATTTACTCATATTCCTTCAGGAAAGTGTTTAGATCGCTCAGAGGTCCTGCATCAAGTATTCATCTCCAATTGTGACTCCAGTAAAACGACTCAAAAATGGGAAATGAATAACATCCATAGTGTTTAG-3'
NCBI CDS gene sequence with introns (location: 173168836.. 173321717) (152882 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 173168811.. 173323967) (155157 bp)Download
NCBI gene sequence (location: [173168811 - 1000].. 173323967) (156157 bp)Download
Cite How to cite