Protein
Protein (NP_001161840)
CBM13-ppGalNAc-T16
Polypeptide N-acetylgalactosaminyltransferase 16 (EC 2.4.1.41) (Polypeptide GalNAc transferase 16) (GalNAc-T16) (Polypeptide GalNAc transferase-like protein 1) (GalNAc-T-like protein 1) (pp-GaNTase-like protein 1) (Polypeptide N-acetylgalactosaminyltransferase-like protein 1) (Protein-UDP acetylgalactosaminyltransferase-like protein 1) (UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase-like protein 1)
GALNT16
polypeptide N-acetylgalactosaminyltransferase 16
Undefined
Curated
Ricin-like
R-Type Lectins
b-trefoil
GalNAc / Mucin-type glycopeptide
Undefined
Protein sequence and protein families (fasta) (558 amino acids) Download
MRKIRANAIAILTVAWILGTFYYLWQDNRAHAASSGGRGAQRAGRRSEQLREDRTIPLIVTGTPSKGFDEKAYLSAKQLKAGEDPYRQHAFNQLESDKLSPDRPIRDTRHYSCPSVSYSSDLPATSVIITFHNEARSTLLRTVKSVLNRTPANLIQEIILVDDFSSDPEDCLLLTRIPKVKCLRNDRREGLIRSRVRGADVAAATVLTFLDSHCEVNTEWLPPMLQRVKEDHTRVVSPIIDVISLDNFAYLAASADLRGGFDWSLHFKWEQIPLEQKMTRTDPTRPIRTPVIAGGIFVIDKSWFNHLGKYDAQMDIWGGENFELSFRVWMCGGSLEIVPCSRVGHVFRKRHPYNFPEGNALTYIRNTKRTAEVWMDEYKQYYYEARPSAIGKAFGSVATRIEQRKKMNCKSFRWYLENVYPELTVPVKEALPGIIKQGVNCLESQGQNTAGDFLLGMGICRGSAKNPQPAQAWLFSDHLIQQQGKCLAATSTLMSSPGSPVILQMCNPREGKQKWRRKGSFIQHSVSGLCLETKPAQLVTSKCQADAQAQQWQLLPHT
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.4, 1.74] ÅDownload
The location of the lectin domain structural model is: 217-555
We infer [1.4, 1.74] Å as the interval of error of this structural model.
Template: 1XHB chain: A, O08912, NP_001153876.1, sequence identity: 39.5%, coverage: 96.8%, location in sequence: 95-553, (95-553 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (2 PubMed Identifiers)
  • Evaluation of GALNT16 polymorphisms to breast cancer risk in Chinese population. [31286696]
  • UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferases: completion of the family tree. [22186971]
UniProt Main References (3 PubMed Identifiers)
  • Characterization of cDNA clones selected by the GeneMark analysis from size-fractionated cDNA libraries from human brain. [10574461]
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
RNA
RNA (Transcript ID: NM_001168368.2)
polypeptide N-acetylgalactosaminyltransferase 16, transcript variant 1
m7G-5')ppp(5'-CUCCUUUUUCUGCUCUGCAGGACUGAGCAGCUAGGCGCGAGCGAAAACAAACAGCUGGGGCUGCGAGCGCCCCCGCCCCGGCCCCGAGAGCACGCCGGCCCAGUCCCCCACCUGGGGCGCCCGUCUGCCCACCAUGAGGAAGAUCCGCGCCAAUGCCAUCGCCAUCCUGACCGUAGCCUGGAUCCUGGGCACUUUCUACUACUUAUGGCAGGACAACCGAGCCCACGCAGCAUCCUCCGGCGGCCGGGGCGCGCAGAGGGCAGGCAGGAGGUCGGAGCAGCUCCGCGAGGACCGCACCAUCCCGCUCAUUGUGACAGGAACUCCCUCGAAAGGCUUUGAUGAGAAGGCCUACCUGUCGGCCAAGCAGCUGAAGGCUGGAGAGGACCCCUACAGACAGCACGCCUUCAACCAGCUGGAGAGUGACAAGCUGAGCCCAGACCGGCCCAUCCGGGACACCCGCCAUUACAGCUGCCCAUCUGUGUCCUACUCCUCGGACCUGCCAGCCACCAGCGUCAUCAUCACCUUCCACAAUGAGGCCCGUUCCACCCUGCUGCGCACAGUGAAGAGUGUCCUGAACCGAACUCCUGCCAACUUGAUCCAGGAGAUCAUUUUAGUGGAUGACUUCAGCUCAGAUCCGGAAGACUGUCUACUCCUGACCAGGAUCCCCAAGGUCAAGUGCCUGCGCAAUGAUCGGCGGGAAGGGCUGAUCCGGUCCCGAGUGCGUGGGGCGGACGUGGCUGCAGCUACCGUUCUCACCUUUCUGGAUAGCCACUGCGAAGUGAACACCGAGUGGCUGCCGCCCAUGCUGCAGCGGGUGAAGGAGGACCACACCCGCGUGGUGAGUCCCAUCAUUGAUGUCAUCAGUCUGGAUAAUUUUGCCUACCUUGCAGCAUCUGCUGACCUUCGUGGAGGGUUCGACUGGAGCCUGCAUUUCAAGUGGGAGCAGAUCCCUCUUGAGCAGAAGAUGACCCGGACAGACCCCACCAGGCCCAUAAGGACGCCUGUCAUAGCUGGAGGAAUCUUCGUGAUCGACAAGUCCUGGUUUAACCACUUGGGAAAGUAUGAUGCCCAGAUGGACAUCUGGGGGGGAGAGAAUUUUGAGCUCUCCUUCAGGGUGUGGAUGUGUGGUGGCAGUCUGGAGAUCGUCCCCUGCAGCCGGGUGGGCCAUGUCUUCAGGAAACGGCACCCCUACAACUUCCCUGAGGGUAAUGCCCUCACCUACAUCAGGAAUACUAAGCGCACUGCAGAAGUGUGGAUGGAUGAAUACAAGCAAUACUACUAUGAGGCCCGGCCCUCGGCCAUCGGGAAGGCCUUCGGCAGUGUGGCUACGCGGAUAGAGCAGAGGAAGAAGAUGAACUGCAAGUCCUUCCGCUGGUACCUGGAGAACGUCUACCCAGAGCUCACGGUCCCCGUGAAGGAAGCACUCCCCGGCAUCAUUAAGCAGGGGGUGAACUGCUUAGAAUCUCAGGGCCAGAACACAGCUGGUGACUUCCUGCUUGGAAUGGGGAUCUGCAGAGGGUCUGCCAAGAACCCGCAGCCCGCCCAGGCAUGGCUGUUCAGUGACCACCUCAUCCAGCAGCAGGGGAAGUGCCUGGCUGCCACCUCCACCUUAAUGUCCUCCCCUGGAUCCCCAGUCAUACUGCAGAUGUGCAACCCUAGAGAAGGCAAGCAGAAAUGGAGGAGAAAAGGAUCUUUCAUCCAGCAUUCAGUCAGUGGCCUCUGCCUGGAGACAAAGCCUGCCCAGCUGGUGACCAGCAAGUGUCAGGCUGACGCCCAGGCCCAGCAGUGGCAGCUGUUGCCACACACAUGACGGUAGCCCUGGGGCCUCCUGUACCUUUUGCAUGAGACUUCGGGACCGGAAGGGGGUUAGGGUGGGGGAGUGCAAAGUGGGCUGUUCCCAUCUCCUCACAUUUCUGCCAGGACCAUCAGCAAAUACCCACCAUGACACACGUUCUCCAAAGCUUGUUCUAGGAGGGCGCAGGCGGGCACGCCCCGAUGCCCUCAGUGCUGUCCUGGCCUUGCCCCGGGAGAGGAGAUGGUCAGGGUGCUGGACUGUUGCUGGGUAGAGACUGAGUAGGUGCCCCUGGCCCUUUGUCCUCUCCCUUGGCGCUUCUUGGGGCUGGGACAAUAGUGUGUGGUCUCUCCCUUGUUGCCCGGAGAAAGCAAGGACAGAAGCCCACACAGGGGUCUUUUGGGUCAUGAGGCCCAGCUGUGCAGGCAGGCAGGGCCAGGGGAAAUUGGGCAGCAUGGAUGGAGAGGCUGAAGGCUGGGAAGAGGGAAGGGGAGAGGGGCAGCCUGCAGGGGUAGCUGAAGAACAGGAAGGAGGUGAGAAGCCCGGUGACCUGUCAGAGAUGCCAAGCCCAGGGUGGCACUGGGUUGGGUGGGGACGGAUGGUGUCUUGGCAGCAAAGGAUGGGUAAUUUGCAAAUGAACAUGGAUAGAAGAGCAGCAAAGCACCAAAAGAACAAGGUCUCUUACCCAGGACACAGUCCCUUCCACACUUUACCAGCCCCAGGGUCUGAGCCCGACGCUGCCUCUUCCGGUCCUGUGCCUGUGGGUGCCCACAUUCUUAGCAAGAGGCUGCAGAGGGAUCUUUAGGGGAAGAUUCGGGCGUAGUUUAUUAAACAGACUCCACUUCUAUUUGGCCAUGUGUCAGGCUGAGACCUCUCUCUCGGGCAUUAAUGAACAGCUAGUGCCCUGUCCCUGCCGCCAGGACCCACUGAAAGGACGGGUAGCCACACACAUCCCUGAGUAGUCCCAGCCUCAUUUGUCAUUUUUGACUCCUGCUUUCUCAAAGGUUUUUGCCUCUGUCAAUACAGCAUCAUGGGUGGUUGGAAAGAAGGGAACUUCCCUUCUGGACCAAGAACAGCCCCUAAGUCAUUAGGGUUCAACCUCACCCUUAUUCCCCUCCCCGCUACAGGAGCCCCUAAGUCAUUAGGGCUCAACCUCACCCUUAUUCCCCUCCCUACUACAGGAGGGAUUUUCUUGAAGGGUCAGCUAUUGCACUGUGCUGGGAGGCUGGCUGUGGCUCCUGUUUGUGAAGAGAACUCCCAGUUCCUUUUCACAGCCGCUGAGAACACAUCCACACAUCUACCCCACGGCCUUGUCUUGGAACUGCUCCUGCUAUCCCCACACCCUGCUUCCUCACCCCACUGGCUCUUGGGCAAAUGACUGUUGGUACCAGGACCCUGGGGGUCUCCCCUACAAAGCAGACCAGCCUGGGGCAGAUAUACCUACCACAGGAGCCCCCUGUCUUUCAUAGGCCAAGGAUCCACAUACCCAUAGAGUUCAUGGAUUCUAGAGGGUCUAGGAAUCUCUUGAAAUUGUCCCUAAAAUACUGCAUGUGUGUGCAUACAUGCAUUUUCCUGGGGAAAAAGUCCAUGGCUUCUAAAAGAGGUCCCUGAUCCCCAAAGGGCCUGAACCUCUGCUCUGGAUUGAAGCCACUGUCUGCCCAAGCUGCCACCCCCUAAUCUUCCUCCCUGGCGUGCUCAAACUGCCAUCGCCUGCUCCCUCCACACGGCCCUUGGGGUCAGCAGCCAAGUGUCUGUGGUCCGCAGCACCUGCUCUGGAGGGCUCUCCAGCAGUUUCGCCUCCUGACUCUCACCAGCGUCCUCUCGGCAGCACUCCCGUGCCCAAGUGCACCCCUCUGGACUUGCCAGCGCAGGCCCCUUCGCUCCCAGGGCCAUGCUUUGCCUGUCCUCUGUCGUGAUGUUUCUUCCGCAGCCAGGUGCAGCCUCAGAUCCCCUGUUCAUCUGGGAAGCCUCCUGCCACAGCUUAGGACAGAACUGGGCCCAGGGCAAAGGCCUCUCCCCAGAGGAUGGACUAGAAGGCCUGGGCCACACUCGGGCAUGGACCUUUGGGGCUGGGGAGCCGGGGCUGCGCCUGUUGAAUGUAAGAGGACUGCUGACCAGAGGGCCUUCAAGAGGGUCUCUCUGUCCUUUGCUGUGGUCAGAUCAGGCUCUGCACUUAUCAGCCGGUCCUUUGUGGCAACGCAGCCCUGUUCUGUUUUUGCUUUUCCUCUUCUUGACCAAAGCAUGUGCCACUAGCUGUCCUUGAGGACCUCGUCUUUAUGAAACACACACCUGGAAUAAAACCACUUCUUACAUGUC-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 57452)
polypeptide N-acetylgalactosaminyltransferase 16
strand +
KIAA1130, GalNAc-T16
NCBI CDS gene sequence (1677 bp)
5'-ATGAGGAAGATCCGCGCCAATGCCATCGCCATCCTGACCGTAGCCTGGATCCTGGGCACTTTCTACTACTTATGGCAGGACAACCGAGCCCACGCAGCATCCTCCGGCGGCCGGGGCGCGCAGAGGGCAGGCAGGAGGTCGGAGCAGCTCCGCGAGGACCGCACCATCCCGCTCATTGTGACAGGAACTCCCTCGAAAGGCTTTGATGAGAAGGCCTACCTGTCGGCCAAGCAGCTGAAGGCTGGAGAGGACCCCTACAGACAGCACGCCTTCAACCAGCTGGAGAGTGACAAGCTGAGCCCAGACCGGCCCATCCGGGACACCCGCCATTACAGCTGCCCATCTGTGTCCTACTCCTCGGACCTGCCAGCCACCAGCGTCATCATCACCTTCCACAATGAGGCCCGTTCCACCCTGCTGCGCACAGTGAAGAGTGTCCTGAACCGAACTCCTGCCAACTTGATCCAGGAGATCATTTTAGTGGATGACTTCAGCTCAGATCCGGAAGACTGTCTACTCCTGACCAGGATCCCCAAGGTCAAGTGCCTGCGCAATGATCGGCGGGAAGGGCTGATCCGGTCCCGAGTGCGTGGGGCGGACGTGGCTGCAGCTACCGTTCTCACCTTTCTGGATAGCCACTGCGAAGTGAACACCGAGTGGCTGCCGCCCATGCTGCAGCGGGTGAAGGAGGACCACACCCGCGTGGTGAGTCCCATCATTGATGTCATCAGTCTGGATAATTTTGCCTACCTTGCAGCATCTGCTGACCTTCGTGGAGGGTTCGACTGGAGCCTGCATTTCAAGTGGGAGCAGATCCCTCTTGAGCAGAAGATGACCCGGACAGACCCCACCAGGCCCATAAGGACGCCTGTCATAGCTGGAGGAATCTTCGTGATCGACAAGTCCTGGTTTAACCACTTGGGAAAGTATGATGCCCAGATGGACATCTGGGGGGGAGAGAATTTTGAGCTCTCCTTCAGGGTGTGGATGTGTGGTGGCAGTCTGGAGATCGTCCCCTGCAGCCGGGTGGGCCATGTCTTCAGGAAACGGCACCCCTACAACTTCCCTGAGGGTAATGCCCTCACCTACATCAGGAATACTAAGCGCACTGCAGAAGTGTGGATGGATGAATACAAGCAATACTACTATGAGGCCCGGCCCTCGGCCATCGGGAAGGCCTTCGGCAGTGTGGCTACGCGGATAGAGCAGAGGAAGAAGATGAACTGCAAGTCCTTCCGCTGGTACCTGGAGAACGTCTACCCAGAGCTCACGGTCCCCGTGAAGGAAGCACTCCCCGGCATCATTAAGCAGGGGGTGAACTGCTTAGAATCTCAGGGCCAGAACACAGCTGGTGACTTCCTGCTTGGAATGGGGATCTGCAGAGGGTCTGCCAAGAACCCGCAGCCCGCCCAGGCATGGCTGTTCAGTGACCACCTCATCCAGCAGCAGGGGAAGTGCCTGGCTGCCACCTCCACCTTAATGTCCTCCCCTGGATCCCCAGTCATACTGCAGATGTGCAACCCTAGAGAAGGCAAGCAGAAATGGAGGAGAAAAGGATCTTTCATCCAGCATTCAGTCAGTGGCCTCTGCCTGGAGACAAAGCCTGCCCAGCTGGTGACCAGCAAGTGTCAGGCTGACGCCCAGGCCCAGCAGTGGCAGCTGTTGCCACACACATGA-3'
NCBI CDS gene sequence with introns (location: 69260291.. 69352168) (91878 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 69260158.. 69354466) (94309 bp)Download
NCBI gene sequence (location: [69260158 - 1000].. 69354466) (95309 bp)Download
Cite How to cite