Protein
Protein (NP_940918)
CBM13-ppGalNAc-T18
Polypeptide N-acetylgalactosaminyltransferase 18 (EC 2.4.1.41) (Polypeptide GalNAc transferase 18) (GalNAc-T18) (Polypeptide GalNAc transferase-like protein 4) (GalNAc-T-like protein 4) (pp-GaNTase-like protein 4) (Polypeptide N-acetylgalactosaminyltransferase-like protein 4) (Protein-UDP acetylgalactosaminyltransferase-like protein 4) (UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase-like protein 4)
GALNT18
polypeptide N-acetylgalactosaminyltransferase 18
Undefined
Curated
Ricin-like
R-Type Lectins
b-trefoil
GalNAc / Mucin-type glycopeptide
Undefined
Protein sequence and protein families (fasta) (607 amino acids) Download
MVCTRKTKTLVSTCVILSGMTNIICLLYVGWVTNYIASVYVRGQEPAPDKKLEEDKGDTLKIIERLDHLENVIKQHIQEAPAKPEEAEAEPFTDSSLFAHWGQELSPEGRRVALKQFQYYGYNAYLSDRLPLDRPLPDLRPSGCRNLSFPDSLPEVSIVFIFVNEALSVLLRSIHSAMERTPPHLLKEIILVDDNSSNEELKEKLTEYVDKVNSQKPGFIKVVRHSKQEGLIRSRVSGWRAATAPVVALFDAHVEFNVGWAEPVLTRIKENRKRIISPSFDNIKYDNFEIEEYPLAAQGFDWELWCRYLNPPKAWWKLENSTAPIRSPALIGCFIVDRQYFQEIGLLDEGMEVYGGENVELGIRVWQCGGSVEVLPCSRIAHIERAHKPYTEDLTAHVRRNALRVAEVWMDEFKSHVYMAWNIPQEDSGIDIGDITARKALRKQLQCKTFRWYLVSVYPEMRMYSDIIAYGVLQNSLKTDLCLDQGPDTENVPIMYICHGMTPQNVYYTSSQQIHVGILSPTVDDDDNRCLVDVNSRPRLIECSYAKAKRMKLHWQFSQGGPIQNRKSKRCLELQENSDLEFGFQLVLQKCSGQHWSITNVLRSLAS
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.49, 1.89] ÅDownload
The location of the lectin domain structural model is: 257-602
We infer [1.49, 1.89] Å as the interval of error of this structural model.
Template: 1XHB chain: A, O08912, NP_001153876.1, sequence identity: 33.2%, coverage: 94.8%, location in sequence: 95-553, (95-553 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (6 PubMed Identifiers)
  • Genome-wide association analysis implicates the involvement of eight loci with response to tocilizumab for the treatment of rheumatoid arthritis. [22491018]
  • UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferases: completion of the family tree. [22186971]
  • Characterization of ppGalNAc-T18, a member of the vertebrate-specific Y subfamily of UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferases. [22171061]
  • A genome-wide association search for type 2 diabetes genes in African Americans. [22238593]
  • Inherited genetic variant predisposes to aggressive but not indolent prostate cancer. [20080650]
  • Coeliac disease-associated risk variants in TNFAIP3 and REL implicate altered NF-kappaB signalling. [19240061]
UniProt Main References (1 PubMed Identifiers)
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
RNA
RNA (Transcript ID: NM_198516.3)
polypeptide N-acetylgalactosaminyltransferase 18, transcript variant 1
m7G-5')ppp(5'-GCUGUUCUCCUAGCAGCGCGGGCCGGUCGGACCGCCAAGGCAGCCGGCGCUGGCGAUGGGAAGCGGCGUGGCCGCCGACACAGGCAGUGGCAAAGUUUCCCAGACGUACACAUCUGGACGCGCGGCUGCCGGCUACCCGUGACCCCUCUAGGAAGGGUUCAGGGAUUUUUAAUUUGGAAAAAAAUCCACCUGGUUUCCUUUGUCAAGGUCUCUCCGGGUGGCCAGCGGCAGGAGCUGCAAACUUGGGCACGGCGGCUACACCGGCAGCGGACCGGGCUUUGGAGAACCUCGGGACUCAGGUGCUGAGGUGCCCAGCGGCUCCGGACGUGCUACGGGGUGCGAGCGCGGGGGAGUUCGGGGCGCACGACAAGGAAGGGCCCCCGGGAGCUCUAUAUGGAGGAAGGAGCCCAGAAUGGUGUGCACCAGGAAGACCAAAACUUUGGUGUCCACUUGCGUGAUCCUGAGCGGCAUGACUAACAUCAUCUGCCUGCUCUACGUGGGCUGGGUCACCAACUACAUCGCCAGCGUGUAUGUGCGGGGGCAGGAGCCGGCGCCCGACAAGAAGCUGGAGGAAGACAAAGGGGACACUCUGAAGAUUAUUGAGCGGCUGGACCACCUGGAGAAUGUCAUCAAGCAGCACAUUCAAGAGGCUCCUGCCAAGCCUGAGGAGGCAGAGGCCGAGCCCUUCACAGACUCCUCUCUGUUUGCACACUGGGGCCAGGAGCUCAGCCCCGAAGGCCGGCGCGUGGCCCUGAAGCAAUUCCAGUACUACGGCUACAACGCCUACCUCAGCGACCGCCUGCCCCUGGACCGGCCCCUGCCUGACCUCAGACCCAGUGGGUGCCGUAACCUCUCAUUUCCUGACAGCCUGCCAGAGGUGAGCAUCGUGUUCAUCUUCGUCAAUGAAGCGCUUUCAGUGCUGCUGCGCUCCAUCCACUCGGCCAUGGAACGCACGCCCCCACAUCUGCUCAAGGAGAUCAUUCUGGUGGAUGACAACAGCAGUAACGAGGAACUGAAGGAGAAGCUGACCGAAUAUGUGGACAAGGUGAACAGCCAGAAGCCAGGCUUCAUCAAAGUCGUGCGUCACAGCAAGCAGGAAGGCCUCAUCCGCUCCAGGGUCAGUGGCUGGAGGGCGGCCACUGCCCCUGUGGUGGCACUCUUUGAUGCCCACGUGGAGUUCAAUGUGGGCUGGGCUGAACCUGUACUCACCCGCAUCAAGGAGAACCGGAAGCGGAUCAUCUCGCCAUCCUUUGAUAACAUCAAAUAUGACAACUUUGAGAUAGAAGAGUACCCGCUGGCUGCCCAGGGCUUUGACUGGGAGCUGUGGUGCCGCUACCUAAAUCCCCCCAAGGCCUGGUGGAAGCUGGAGAACUCCACAGCGCCAAUCAGGAGCCCUGCCCUCAUUGGCUGCUUCAUUGUGGACCGGCAGUACUUCCAGGAGAUCGGCCUGCUGGACGAAGGCAUGGAAGUCUACGGGGGCGAGAAUGUGGAGCUUGGGAUCAGGGUGUGGCAGUGUGGCGGGAGUGUGGAGGUCCUGCCCUGCUCACGGAUUGCCCACAUUGAGCGAGCCCACAAGCCCUACACAGAGGACCUCACCGCCCAUGUCCGCAGGAACGCUCUCAGGGUGGCUGAAGUCUGGAUGGAUGAAUUUAAAAGCCACGUCUACAUGGCAUGGAACAUACCGCAGGAGGACUCAGGAAUUGACAUUGGGGACAUCACUGCAAGGAAGGCUCUCAGGAAACAGCUGCAGUGCAAGACCUUCCGGUGGUACCUGGUCAGCGUGUACCCAGAGAUGAGGAUGUACUCCGACAUCAUUGCCUAUGGAGUGCUGCAGAAUUCUCUGAAGACUGAUUUGUGUCUUGACCAGGGGCCAGAUACAGAGAAUGUCCCCAUCAUGUACAUCUGCCAUGGGAUGACGCCUCAGAACGUGUACUACACGAGCAGUCAGCAGAUCCAUGUGGGCAUUCUGAGCCCCACCGUGGAUGAUGAUGACAACCGAUGCCUGGUGGACGUCAACAGCCGGCCCCGGCUCAUCGAAUGCAGCUACGCCAAAGCCAAGAGGAUGAAGCUUCACUGGCAGUUCUCUCAGGGAGGACCCAUCCAGAACCGCAAGUCUAAGCGCUGUCUGGAGCUGCAGGAGAAUAGCGACCUGGAGUUCGGCUUCCAGCUGGUGUUGCAGAAGUGCUCGGGCCAGCACUGGAGCAUCACCAACGUCCUGAGGAGCCUCGCGUCCUGACCCACCGGGGCCACUUCCGGCUGCCUCUUUGCUACUGUGUAGCACCUGCUGCAACGUUGCCUGCUGUCCACGUGGGGUUGUUUGGAGUCUGGGGAACCAGGUUAGUGGGCCCCCAAGAAGAGCUUUUUAUUUCCUAUUCAAUUUUCAUGGAGUUUAUAGAAAGAUGCUGAUUGGUAGGUGAUGGUAUGAUAUCAAACUAUUUUGCAGUUGUAAAUAGGGGACAGAUGGAAAAUAUUUAUAACUGACAAUAAAAUAUUAUUAAGAAAA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 374378)
polypeptide N-acetylgalactosaminyltransferase 18
strand -
MGC71806, GALNT15, GalNAc-T18
NCBI CDS gene sequence (1824 bp)
5'-ATGGTGTGCACCAGGAAGACCAAAACTTTGGTGTCCACTTGCGTGATCCTGAGCGGCATGACTAACATCATCTGCCTGCTCTACGTGGGCTGGGTCACCAACTACATCGCCAGCGTGTATGTGCGGGGGCAGGAGCCGGCGCCCGACAAGAAGCTGGAGGAAGACAAAGGGGACACTCTGAAGATTATTGAGCGGCTGGACCACCTGGAGAATGTCATCAAGCAGCACATTCAAGAGGCTCCTGCCAAGCCTGAGGAGGCAGAGGCCGAGCCCTTCACAGACTCCTCTCTGTTTGCACACTGGGGCCAGGAGCTCAGCCCCGAAGGCCGGCGCGTGGCCCTGAAGCAATTCCAGTACTACGGCTACAACGCCTACCTCAGCGACCGCCTGCCCCTGGACCGGCCCCTGCCTGACCTCAGACCCAGTGGGTGCCGTAACCTCTCATTTCCTGACAGCCTGCCAGAGGTGAGCATCGTGTTCATCTTCGTCAATGAAGCGCTTTCAGTGCTGCTGCGCTCCATCCACTCGGCCATGGAACGCACGCCCCCACATCTGCTCAAGGAGATCATTCTGGTGGATGACAACAGCAGTAACGAGGAACTGAAGGAGAAGCTGACCGAATATGTGGACAAGGTGAACAGCCAGAAGCCAGGCTTCATCAAAGTCGTGCGTCACAGCAAGCAGGAAGGCCTCATCCGCTCCAGGGTCAGTGGCTGGAGGGCGGCCACTGCCCCTGTGGTGGCACTCTTTGATGCCCACGTGGAGTTCAATGTGGGCTGGGCTGAACCTGTACTCACCCGCATCAAGGAGAACCGGAAGCGGATCATCTCGCCATCCTTTGATAACATCAAATATGACAACTTTGAGATAGAAGAGTACCCGCTGGCTGCCCAGGGCTTTGACTGGGAGCTGTGGTGCCGCTACCTAAATCCCCCCAAGGCCTGGTGGAAGCTGGAGAACTCCACAGCGCCAATCAGGAGCCCTGCCCTCATTGGCTGCTTCATTGTGGACCGGCAGTACTTCCAGGAGATCGGCCTGCTGGACGAAGGCATGGAAGTCTACGGGGGCGAGAATGTGGAGCTTGGGATCAGGGTGTGGCAGTGTGGCGGGAGTGTGGAGGTCCTGCCCTGCTCACGGATTGCCCACATTGAGCGAGCCCACAAGCCCTACACAGAGGACCTCACCGCCCATGTCCGCAGGAACGCTCTCAGGGTGGCTGAAGTCTGGATGGATGAATTTAAAAGCCACGTCTACATGGCATGGAACATACCGCAGGAGGACTCAGGAATTGACATTGGGGACATCACTGCAAGGAAGGCTCTCAGGAAACAGCTGCAGTGCAAGACCTTCCGGTGGTACCTGGTCAGCGTGTACCCAGAGATGAGGATGTACTCCGACATCATTGCCTATGGAGTGCTGCAGAATTCTCTGAAGACTGATTTGTGTCTTGACCAGGGGCCAGATACAGAGAATGTCCCCATCATGTACATCTGCCATGGGATGACGCCTCAGAACGTGTACTACACGAGCAGTCAGCAGATCCATGTGGGCATTCTGAGCCCCACCGTGGATGATGATGACAACCGATGCCTGGTGGACGTCAACAGCCGGCCCCGGCTCATCGAATGCAGCTACGCCAAAGCCAAGAGGATGAAGCTTCACTGGCAGTTCTCTCAGGGAGGACCCATCCAGAACCGCAAGTCTAAGCGCTGTCTGGAGCTGCAGGAGAATAGCGACCTGGAGTTCGGCTTCCAGCTGGTGTTGCAGAAGTGCTCGGGCCAGCACTGGAGCATCACCAACGTCCTGAGGAGCCTCGCGTCCTGA-3'
NCBI CDS gene sequence with introns (location: 11271144.. 11621593) (350450 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 11270877.. 11622005) (351129 bp)Download
NCBI gene sequence (location: [11270877.. 11622005 + 1000]) (352129 bp)Download
Cite How to cite