NCBI Summary
This gene encodes a Golgi protein which is a member of the polypeptide N-acetylgalactosaminyltransferase (ppGalNAc-Ts) protein family. These enzymes catalyze the transfer of N-acetyl-D-galactosamine (GalNAc) to the hydroxyl groups on serines and threonines in target peptides. The encoded protein has been shown to transfer GalNAc to large proteins like mucins. Alterations in this gene may play a role in cancer progression and response to chemotherapy. [provided by RefSeq, Jun 2016].
Protein
Protein (NP_078848)
CBM13-ppGalNAc-T14
Polypeptide N-acetylgalactosaminyltransferase 14 (EC 2.4.1.41) (Polypeptide GalNAc transferase 14) (GalNAc-T14) (pp-GaNTase 14) (Protein-UDP acetylgalactosaminyltransferase 14) (UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase 14)
GALNT14
polypeptide N-acetylgalactosaminyltransferase 14
Undefined
Curated
Ricin-like
R-Type Lectins
b-trefoil
GalNAc / Mucin-type glycopeptide
Undefined
Protein sequence and protein families (fasta) (552 amino acids) Download
MRRLTRRLVLPVFGVLWITVLLFFWVTKRKLEVPTGPEVQTPKPSDADWDDLWDQFDERRYLNAKKWRVGDDPYKLYAFNQRESERISSNRAIPDTRHLRCTLLVYCTDLPPTSIIITFHNEARSTLLRTIRSVLNRTPTHLIREIILVDDFSNDPDDCKQLIKLPKVKCLRNNERQGLVRSRIRGADIAQGTTLTFLDSHCEVNRDWLQPLLHRVKEDYTRVVCPVIDIINLDTFTYIESASELRGGFDWSLHFQWEQLSPEQKARRLDPTEPIRTPIIAGGLFVIDKAWFDYLGKYDMDMDIWGGENFEISFRVWMCGGSLEIVPCSRVGHVFRKKHPYVFPDGNANTYIKNTKRTAEVWMDEYKQYYYAARPFALERPFGNVESRLDLRKNLRCQSFKWYLENIYPELSIPKESSIQKGNIRQRQKCLESQRQNNQETPNLKLSPCAKVKGEDAKSQVWAFTYTQQILQEELCLSVITLFPGAPVVLVLCKNGDDRQQWTKTGSHIEHIASHLCLDTDMFGDGTENGKEIVVNPCESSLMSQHWDMVSS
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.36, 1.69] ÅDownload
The location of the lectin domain structural model is: 206-550
We infer [1.36, 1.69] Å as the interval of error of this structural model.
Template: 1XHB chain: A, O08912, NP_001153876.1, sequence identity: 41.7%, coverage: 95.9%, location in sequence: 95-553, (95-553 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • GALNT2/14 overexpression correlate with prognosis and methylation: potential therapeutic targets for lung adenocarcinoma. [33964375]
  • GALNT14: An Emerging Marker Capable of Predicting Therapeutic Outcomes in Multiple Cancers. [32098271]
  • Effects of IGFBP-3 and GalNAc-T14 on proliferation and cell cycle of glioblastoma cells and its mechanism. [31713889]
  • A GALNT14 rs9679162 genotype-guided therapeutic strategy for advanced hepatocellular carcinoma: systemic or hepatic arterial infusion chemotherapy. [31611591]
  • BORIS Expression in Ovarian Cancer Precursor Cells Alters the CTCF Cistrome and Enhances Invasiveness through GALNT14. [31292201]
  • N-Acetylgalactosaminyltransferase-14 as a potential biomarker for breast cancer by immunohistochemistry. [20356418]
  • Development of immunohistochemistry assays to assess GALNT14 and FUT3/6 in clinical trials of dulanermin and drozitumab. [20179215]
  • GalNAc-T14 may be involved in regulating the apoptotic action of IGFBP-3. [19805900]
  • N-Acetylgalactosaminyltransferase 14, a novel insulin-like growth factor binding protein-3 binding partner. [17434446]
  • Cloning and characterization of a novel UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase, pp-GalNAc-T14. [12507512]
UniProt Main References (4 PubMed Identifiers)
  • The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. [12975309]
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • Generation and annotation of the DNA sequences of human chromosomes 2 and 4. [15815621]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
RNA
RNA (Transcript ID: NM_024572.4)
polypeptide N-acetylgalactosaminyltransferase 14, transcript variant 1
m7G-5')ppp(5'-GUUUCCCUAUCGGCGGCAGCGGGCAAGGCGGCGGCGGCGGCGGCGGCAGCCGCGGUGGCGGCGUGGGGAACAUCUCGGCAGCCACCGCGCUUCUCCCGCUGGAGCGGGCGUCCAGCUUGGCUGCCCUCGGUCCUUCCCUGCCACGUUUCGGGUCGCCCUGCACCCCCCACCCAGGCUCGCUUCUCUUCGAAGCGGGAAGGGCGCCUUGCAGGAUCCUGCCGCCCCUCCAACCGGAUCCUGGGUCUAGAGCUCCCCAGAGCGAGGCGCUCGCCAGGACUCCUGCCCCGCCAACCCUGACCGCCGGGGGGUGCCCCCGGGACGUAGCGCCGCGGAGAGGAAGCGGCAAAGGGGACCAUGCGGCGCCUGACUCGUCGGCUGGUUCUGCCAGUCUUCGGGGUGCUCUGGAUCACGGUGCUGCUGUUCUUCUGGGUAACCAAGAGGAAGUUGGAGGUGCCGACGGGACCUGAAGUGCAGACCCCUAAGCCUUCGGACGCUGACUGGGACGACCUGUGGGACCAGUUUGAUGAGCGGCGGUAUCUGAAUGCCAAAAAGUGGCGCGUUGGUGACGACCCCUAUAAGCUGUAUGCUUUCAACCAGCGGGAGAGUGAGCGGAUCUCCAGCAAUCGGGCCAUCCCGGACACUCGCCAUCUGAGAUGCACACUGCUGGUGUAUUGCACGGACCUUCCACCCACUAGCAUCAUCAUCACCUUCCACAACGAGGCCCGCUCCACGCUGCUCAGGACCAUCCGCAGUGUAUUAAACCGCACCCCUACGCAUCUGAUCCGGGAAAUCAUAUUAGUGGAUGACUUCAGCAAUGACCCUGAUGACUGUAAACAGCUCAUCAAGUUGCCCAAGGUGAAAUGCUUGCGCAAUAAUGAACGGCAAGGUCUGGUCCGGUCCCGGAUUCGGGGCGCUGACAUCGCCCAGGGCACCACUCUGACUUUCCUCGACAGCCACUGUGAGGUGAACAGGGACUGGCUCCAGCCUCUGUUGCACAGGGUCAAAGAGGACUACACGCGGGUGGUGUGCCCUGUGAUCGAUAUCAUUAACCUGGACACCUUCACCUACAUCGAGUCUGCCUCGGAGCUCAGAGGGGGGUUUGACUGGAGCCUCCACUUCCAGUGGGAGCAGCUCUCCCCAGAGCAGAAGGCUCGGCGCCUGGACCCCACGGAGCCCAUCAGGACUCCUAUCAUAGCUGGAGGGCUCUUCGUGAUCGACAAAGCUUGGUUUGAUUACCUGGGGAAAUAUGAUAUGGACAUGGACAUCUGGGGUGGGGAGAACUUUGAAAUCUCCUUCCGAGUGUGGAUGUGCGGGGGCAGCCUAGAGAUCGUCCCCUGCAGCCGAGUGGGGCACGUCUUCCGGAAGAAGCACCCCUACGUUUUCCCUGAUGGAAAUGCCAACACGUAUAUAAAGAACACCAAGCGGACAGCUGAAGUGUGGAUGGAUGAAUACAAGCAAUACUAUUACGCUGCCCGGCCAUUCGCCCUGGAGAGGCCCUUCGGGAAUGUUGAGAGCAGAUUGGACCUGAGGAAGAAUCUGCGCUGCCAGAGCUUCAAGUGGUACCUGGAGAAUAUCUACCCUGAACUCAGCAUCCCCAAGGAGUCCUCCAUCCAGAAGGGCAAUAUCCGACAGAGACAGAAGUGCCUGGAAUCUCAAAGGCAGAACAACCAAGAAACCCCAAACCUAAAGUUGAGCCCCUGUGCCAAGGUCAAAGGCGAAGAUGCAAAGUCCCAGGUAUGGGCCUUCACAUACACCCAGCAGAUCCUCCAGGAGGAGCUGUGCCUGUCAGUCAUCACCUUGUUCCCUGGCGCCCCAGUGGUUCUUGUCCUUUGCAAGAAUGGAGAUGACCGACAGCAAUGGACCAAAACUGGUUCCCACAUCGAGCACAUAGCAUCCCACCUCUGCCUCGAUACAGAUAUGUUCGGUGAUGGCACCGAGAACGGCAAGGAAAUCGUCGUCAACCCAUGUGAGUCCUCACUCAUGAGCCAGCACUGGGACAUGGUGAGCUCUUGAGGACCCCUGCCAGAAGCAGCAAGGGCCAUGGGGUGGUGCUUCCCUGGACCAGAACAGACUGGAAACUGGGCAGCAAGCAGCCUGCAACCACCUCAGACAUCCUGGACUGGGAGGUGGAGGCAGAGCCCCCCAGGACAGGAGCAACUGUCUCAGGGAGGACAGAGGAAAACAUCACAAGCCAAUGGGGCUCAAAGACAAAUCCCACAUGUUCUCAAGGCCGUUAAGUUCCAGUCCUGGCCAGUCAUUCCCUGAUUGGUAUCUGGAGACAGAAACCUAAUGGGAAGUGUUUAUUGUUCCUUUUCCUACAAAGGAAGCAGUCUCUGGAGGCCAGAAAGAAAAGCCUUCUUUUUCACUAGGCCAGGACUACAUUGAGAGAUGAAGAAUGGAGGUUGUUUCCAAAAGAAAUAAAGAGAAACUUAGAAGUUGUCUCUGGA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 79623)
polypeptide N-acetylgalactosaminyltransferase 14
strand -
GalNac-T10, FLJ12691, GalNac-T14
NCBI CDS gene sequence (1659 bp)
5'-ATGCGGCGCCTGACTCGTCGGCTGGTTCTGCCAGTCTTCGGGGTGCTCTGGATCACGGTGCTGCTGTTCTTCTGGGTAACCAAGAGGAAGTTGGAGGTGCCGACGGGACCTGAAGTGCAGACCCCTAAGCCTTCGGACGCTGACTGGGACGACCTGTGGGACCAGTTTGATGAGCGGCGGTATCTGAATGCCAAAAAGTGGCGCGTTGGTGACGACCCCTATAAGCTGTATGCTTTCAACCAGCGGGAGAGTGAGCGGATCTCCAGCAATCGGGCCATCCCGGACACTCGCCATCTGAGATGCACACTGCTGGTGTATTGCACGGACCTTCCACCCACTAGCATCATCATCACCTTCCACAACGAGGCCCGCTCCACGCTGCTCAGGACCATCCGCAGTGTATTAAACCGCACCCCTACGCATCTGATCCGGGAAATCATATTAGTGGATGACTTCAGCAATGACCCTGATGACTGTAAACAGCTCATCAAGTTGCCCAAGGTGAAATGCTTGCGCAATAATGAACGGCAAGGTCTGGTCCGGTCCCGGATTCGGGGCGCTGACATCGCCCAGGGCACCACTCTGACTTTCCTCGACAGCCACTGTGAGGTGAACAGGGACTGGCTCCAGCCTCTGTTGCACAGGGTCAAAGAGGACTACACGCGGGTGGTGTGCCCTGTGATCGATATCATTAACCTGGACACCTTCACCTACATCGAGTCTGCCTCGGAGCTCAGAGGGGGGTTTGACTGGAGCCTCCACTTCCAGTGGGAGCAGCTCTCCCCAGAGCAGAAGGCTCGGCGCCTGGACCCCACGGAGCCCATCAGGACTCCTATCATAGCTGGAGGGCTCTTCGTGATCGACAAAGCTTGGTTTGATTACCTGGGGAAATATGATATGGACATGGACATCTGGGGTGGGGAGAACTTTGAAATCTCCTTCCGAGTGTGGATGTGCGGGGGCAGCCTAGAGATCGTCCCCTGCAGCCGAGTGGGGCACGTCTTCCGGAAGAAGCACCCCTACGTTTTCCCTGATGGAAATGCCAACACGTATATAAAGAACACCAAGCGGACAGCTGAAGTGTGGATGGATGAATACAAGCAATACTATTACGCTGCCCGGCCATTCGCCCTGGAGAGGCCCTTCGGGAATGTTGAGAGCAGATTGGACCTGAGGAAGAATCTGCGCTGCCAGAGCTTCAAGTGGTACCTGGAGAATATCTACCCTGAACTCAGCATCCCCAAGGAGTCCTCCATCCAGAAGGGCAATATCCGACAGAGACAGAAGTGCCTGGAATCTCAAAGGCAGAACAACCAAGAAACCCCAAACCTAAAGTTGAGCCCCTGTGCCAAGGTCAAAGGCGAAGATGCAAAGTCCCAGGTATGGGCCTTCACATACACCCAGCAGATCCTCCAGGAGGAGCTGTGCCTGTCAGTCATCACCTTGTTCCCTGGCGCCCCAGTGGTTCTTGTCCTTTGCAAGAATGGAGATGACCGACAGCAATGGACCAAAACTGGTTCCCACATCGAGCACATAGCATCCCACCTCTGCCTCGATACAGATATGTTCGGTGATGGCACCGAGAACGGCAAGGAAATCGTCGTCAACCCATGTGAGTCCTCACTCATGAGCCAGCACTGGGACATGGTGAGCTCTTGA-3'
NCBI CDS gene sequence with introns (location: 30910901.. 31138086) (227186 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 30910467.. 31138440) (227974 bp)Download
NCBI gene sequence (location: [30910467.. 31138440 + 1000]) (228974 bp)Download
How to cite: Schnider B., M'Rad Y., el Ahmadie J., de Brevern AG., Imberty A., Lisacek F., HumanLectome, an update of UniLectin for the annotation and prediction of human lectins, Nucleic Acids Reasearch doi.org/10.1093/nar/gkad905