NCBI Summary
The protein encoded by this gene is a surface antigen found on all peripheral blood T-cells. The encoded protein interacts with LFA3 (CD58) on antigen presenting cells to optimize immune recognition. A locus control region (LCR) has been found in the 3' flanking sequence of this gene. [provided by RefSeq, Jun 2016].
Protein
Protein (NP_001315538)
CD2
T-cell surface antigen CD2 (Erythrocyte receptor) (LFA-2) (LFA-3 receptor) (Rosette receptor) (T-cell surface antigen T11/Leu-5) (CD antigen CD2)
CD2
CD2 molecule
Low evidence
I-type lectin
I-Type Lectins
b-sandwich / Ig-like
Sulfated
Undefined
Undefined
Protein sequence and protein families (fasta) (377 amino acids) Download
MSFPCKFVASFLLIFNVSSKGAVSKEITNALETWGALGQDINLDIPSFQMSDDIDDIKWEKTSDKKKIAQFRKEKETFKEKDTYKLFKNGTLKIKHLKTDDQDIYKVSIYDTKGKNVLEKIFDLKIQERVSKPKISWTCINTTLTCEVMNGTDPELNLYQDGKHLKLSQRVITHKWTTSLSAKFKCTAGNKVSKESSVEPVSCPGGSILGQSNGLSAWTPPSHPTSLPFAEKGLDIYLIIGICGGGSLLMVFVALLVFYITKRKKQRSRRNDEELETRAHRVATEERGRKPHQIPASTPQNPATSQHPPPPPGHRSQAPSHRPPPPGHRVQHQPQKRPPAPSGTQVHQQKGPPLPRPRVQPKPPHGAAENSLSPSSN
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
  • Polymorphic estrogen receptor binding site causes Cd2-dependent sex bias in the susceptibility to autoimmune diseases. [34552089]
  • Phosphoproteomics of CD2 signaling reveals AMPK-dependent regulation of lytic granule polarization in cytotoxic T cells. [32398348]
  • Keratinocytes costimulate naive human T cells via CD2: a potential target to prevent the development of proinflammatory Th1 cells in the skin. [31324882]
  • MMP11 and CD2 as novel prognostic factors in hormone receptor-negative, HER2-positive breast cancer. [28409241]
  • A candidate gene study identifies a haplotype of CD2 as novel susceptibility factor for systemic sclerosis. [27385538]
  • The antigen-specific induction of normal human lymphocytes in vitro is down-regulated by a conserved HIV p24 epitope. [1385321]
  • Overlapping but nonidentical binding sites on CD2 for CD58 and a second ligand CD59. [1377404]
  • The lymphocyte-specific tyrosine protein kinase p56lck is endocytosed in Jurkat cells stimulated via CD2. [1351089]
  • The OX-44 molecule couples to signaling pathways and is associated with CD2 on rat T lymphocytes and a natural killer cell line. [1346273]
  • Association of CD2 and CD45 on human T lymphocytes. [1970422]
UniProt Main References (15 PubMed Identifiers)
  • Exon-intron organization and sequence comparison of human and murine T11 (CD2) genes. [2894031]
  • Molecular cloning of the CD2 antigen, the T-cell erythrocyte receptor, by a rapid immunoselection procedure. [2437578]
  • Molecular cloning of the human T-lymphocyte surface CD2 (T11) antigen. [3490670]
  • Molecular cloning and expression of T11 cDNAs reveal a receptor-like structure on human T lymphocytes. [2883656]
  • The structure of the human CD2 gene and its expression in transgenic mice. [2901953]
  • The DNA sequence and biological annotation of human chromosome 1. [16710414]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Monoclonal antibody and ligand binding sites of the T cell erythrocyte receptor (CD2). [2444890]
  • A cdc15-like adaptor protein (CD2BP1) interacts with the CD2 cytoplasmic domain and regulates CD2-triggered adhesion. [9857189]
  • Human immunodeficiency-causing mutation defines CD16 in spontaneous NK cell cytotoxicity. [23006327]
  • Show more
RNA
RNA (Transcript ID: NM_001328609.2)
CD2 molecule, transcript variant 1
m7G-5')ppp(5'-AGUCUCACUUCAGUUCCUUUUGCAUGAAGAGCUCAGAAUCAAAAGAGGAAACCAACCCCUAAGAUGAGCUUUCCAUGUAAAUUUGUAGCCAGCUUCCUUCUGAUUUUCAAUGUUUCUUCCAAAGGUGCAGUCUCCAAAGAGAUUACGAAUGCCUUGGAAACCUGGGGUGCCUUGGGUCAGGACAUCAACUUGGACAUUCCUAGUUUUCAAAUGAGUGAUGAUAUUGACGAUAUAAAAUGGGAAAAAACUUCAGACAAGAAAAAGAUUGCACAAUUCAGAAAAGAGAAAGAGACUUUCAAGGAAAAAGAUACAUAUAAGCUAUUUAAAAAUGGAACUCUGAAAAUUAAGCAUCUGAAGACCGAUGAUCAGGAUAUCUACAAGGUAUCAAUAUAUGAUACAAAAGGAAAAAAUGUGUUGGAAAAAAUAUUUGAUUUGAAGAUUCAAGAGAGGGUCUCAAAACCAAAGAUCUCCUGGACUUGUAUCAACACAACCCUGACCUGUGAGGUAAUGAAUGGAACUGACCCCGAAUUAAACCUGUAUCAAGAUGGGAAACAUCUAAAACUUUCUCAGAGGGUCAUCACACACAAGUGGACCACCAGCCUGAGUGCAAAAUUCAAGUGCACAGCAGGGAACAAAGUCAGCAAGGAAUCCAGUGUCGAGCCUGUCAGCUGUCCAGGAGGCAGCAUCCUUGGCCAGAGUAAUGGGCUCUCUGCCUGGACCCCUCCCAGCCAUCCCACUUCUCUUCCUUUUGCAGAGAAAGGUCUGGACAUCUAUCUCAUCAUUGGCAUAUGUGGAGGAGGCAGCCUCUUGAUGGUCUUUGUGGCACUGCUCGUUUUCUAUAUCACCAAAAGGAAAAAACAGAGGAGUCGGAGAAAUGAUGAGGAGCUGGAGACAAGAGCCCACAGAGUAGCUACUGAAGAAAGGGGCCGGAAGCCCCACCAAAUUCCAGCUUCAACCCCUCAGAAUCCAGCAACUUCCCAACAUCCUCCUCCACCACCUGGUCAUCGUUCCCAGGCACCUAGUCAUCGUCCCCCGCCUCCUGGACACCGUGUUCAGCACCAGCCUCAGAAGAGGCCUCCUGCUCCGUCGGGCACACAAGUUCACCAGCAGAAAGGCCCGCCCCUCCCCAGACCUCGAGUUCAGCCAAAACCUCCCCAUGGGGCAGCAGAAAACUCAUUGUCCCCUUCCUCUAAUUAAAAAAGAUAGAAACUGUCUUUUUCAAUAAAAAGCACUGUGGAUUUCUGCCCUCCUGAUGUGCAUAUCCGUACUUCCAUGAGGUGUUUUCUGUGUGCAGAACAUUGUCACCUCCUGAGGCUGUGGGCCACAGCCACCUCUGCAUCUUCGAACUCAGCCAUGUGGUCAACAUCUGGAGUUUUUGGUCUCCUCAGAGAGCUCCAUCACACCAGUAAGGAGAAGCAAUAUAAGUGUGAUUGCAAGAAUGGUAGAGGACCGAGCACAGAAAUCUUAGAGAUUUCUUGUCCCCUCUCAGGUCAUGUGUAGAUGCGAUAAAUCAAGUGAUUGGUGUGCCUGGGUCUCACUACAAGCAGCCUAUCUGCUUAAGAGACUCUGGAGUUUCUUAUGUGCCCUGGUGGACACUUGCCCACCAUCCUGUGAGUAAAAGUGAAAUAAAAGCUUUGACUAGA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 914)
CD2
CD2 molecule
strand +
NCBI CDS gene sequence (1134 bp)
5'-ATGAGCTTTCCATGTAAATTTGTAGCCAGCTTCCTTCTGATTTTCAATGTTTCTTCCAAAGGTGCAGTCTCCAAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCATCTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAACTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGGAGGCAGCATCCTTGGCCAGAGTAATGGGCTCTCTGCCTGGACCCCTCCCAGCCATCCCACTTCTCTTCCTTTTGCAGAGAAAGGTCTGGACATCTATCTCATCATTGGCATATGTGGAGGAGGCAGCCTCTTGATGGTCTTTGTGGCACTGCTCGTTTTCTATATCACCAAAAGGAAAAAACAGAGGAGTCGGAGAAATGATGAGGAGCTGGAGACAAGAGCCCACAGAGTAGCTACTGAAGAAAGGGGCCGGAAGCCCCACCAAATTCCAGCTTCAACCCCTCAGAATCCAGCAACTTCCCAACATCCTCCTCCACCACCTGGTCATCGTTCCCAGGCACCTAGTCATCGTCCCCCGCCTCCTGGACACCGTGTTCAGCACCAGCCTCAGAAGAGGCCTCCTGCTCCGTCGGGCACACAAGTTCACCAGCAGAAAGGCCCGCCCCTCCCCAGACCTCGAGTTCAGCCAAAACCTCCCCATGGGGCAGCAGAAAACTCATTGTCCCCTTCCTCTAATTAA-3'
NCBI CDS gene sequence with introns (location: 116754493.. 116768783) (14291 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 116754430.. 116769229) (14800 bp)Download
NCBI gene sequence (location: [116754430 - 1000].. 116769229) (15800 bp)Download
How to cite: Schnider B., M'Rad Y., el Ahmadie J., de Brevern AG., Imberty A., Lisacek F., HumanLectome, an update of UniLectin for the annotation and prediction of human lectins, Nucleic Acids Reasearch doi.org/10.1093/nar/gkad905