NCBI Summary
The protein encoded by this gene is a surface antigen found on all peripheral blood T-cells. The encoded protein interacts with LFA3 (CD58) on antigen presenting cells to optimize immune recognition. A locus control region (LCR) has been found in the 3' flanking sequence of this gene. [provided by RefSeq, Jun 2016].
Protein
Protein (NP_001315538)
CD2
T-cell surface antigen CD2 (Erythrocyte receptor) (LFA-2) (LFA-3 receptor) (Rosette receptor) (T-cell surface antigen T11/Leu-5) (CD antigen CD2)
CD2
CD2 molecule
Low evidence
I-type lectin
I-Type Lectins
b-sandwich / Ig-like
Sulfated
Undefined
Undefined
Protein sequence and protein families (fasta) (377 amino acids) Download
MSFPCKFVASFLLIFNVSSKGAVSKEITNALETWGALGQDINLDIPSFQMSDDIDDIKWEKTSDKKKIAQFRKEKETFKEKDTYKLFKNGTLKIKHLKTDDQDIYKVSIYDTKGKNVLEKIFDLKIQERVSKPKISWTCINTTLTCEVMNGTDPELNLYQDGKHLKLSQRVITHKWTTSLSAKFKCTAGNKVSKESSVEPVSCPGGSILGQSNGLSAWTPPSHPTSLPFAEKGLDIYLIIGICGGGSLLMVFVALLVFYITKRKKQRSRRNDEELETRAHRVATEERGRKPHQIPASTPQNPATSQHPPPPPGHRSQAPSHRPPPPGHRVQHQPQKRPPAPSGTQVHQQKGPPLPRPRVQPKPPHGAAENSLSPSSN
Mol* PDB structure viewerUniLectin3D
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.

Oligomerization and Known Interactions
Interacts with CD48 (By similarity). Interacts with CD58 (LFA-3) (PubMed:10380930). Interacts with CD2AP (By similarity). Interacts with PSTPIP1 (PubMed:9857189). Interacts with FCGR3A; this interaction modulates NK cell activation and cytotoxicity. Source: UniProt
Annotation
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
Expression
Functionality temporarily unavailable.
References
NCBI References (10 PubMed Identifiers)
  • Polymorphic estrogen receptor binding site causes Cd2-dependent sex bias in the susceptibility to autoimmune diseases. [34552089]
  • Phosphoproteomics of CD2 signaling reveals AMPK-dependent regulation of lytic granule polarization in cytotoxic T cells. [32398348]
  • Keratinocytes costimulate naive human T cells via CD2: a potential target to prevent the development of proinflammatory Th1 cells in the skin. [31324882]
  • MMP11 and CD2 as novel prognostic factors in hormone receptor-negative, HER2-positive breast cancer. [28409241]
  • A candidate gene study identifies a haplotype of CD2 as novel susceptibility factor for systemic sclerosis. [27385538]
  • The antigen-specific induction of normal human lymphocytes in vitro is down-regulated by a conserved HIV p24 epitope. [1385321]
  • Overlapping but nonidentical binding sites on CD2 for CD58 and a second ligand CD59. [1377404]
  • The lymphocyte-specific tyrosine protein kinase p56lck is endocytosed in Jurkat cells stimulated via CD2. [1351089]
  • The OX-44 molecule couples to signaling pathways and is associated with CD2 on rat T lymphocytes and a natural killer cell line. [1346273]
  • Association of CD2 and CD45 on human T lymphocytes. [1970422]
UniProt Main References (15 PubMed Identifiers)
  • Exon-intron organization and sequence comparison of human and murine T11 (CD2) genes. [2894031]
  • Molecular cloning of the CD2 antigen, the T-cell erythrocyte receptor, by a rapid immunoselection procedure. [2437578]
  • Molecular cloning of the human T-lymphocyte surface CD2 (T11) antigen. [3490670]
  • Molecular cloning and expression of T11 cDNAs reveal a receptor-like structure on human T lymphocytes. [2883656]
  • The structure of the human CD2 gene and its expression in transgenic mice. [2901953]
  • The DNA sequence and biological annotation of human chromosome 1. [16710414]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Monoclonal antibody and ligand binding sites of the T cell erythrocyte receptor (CD2). [2444890]
  • A cdc15-like adaptor protein (CD2BP1) interacts with the CD2 cytoplasmic domain and regulates CD2-triggered adhesion. [9857189]
  • Human immunodeficiency-causing mutation defines CD16 in spontaneous NK cell cytotoxicity. [23006327]
  • Show more
RNA
RNA (Transcript ID: NM_001328609.2)
CD2 molecule, transcript variant 1
m7G-5')ppp(5'-AGUCUCACUUCAGUUCCUUUUGCAUGAAGAGCUCAGAAUCAAAAGAGGAAACCAACCCCUAAGAUGAGCUUUCCAUGUAAAUUUGUAGCCAGCUUCCUUCUGAUUUUCAAUGUUUCUUCCAAAGGUGCAGUCUCCAAAGAGAUUACGAAUGCCUUGGAAACCUGGGGUGCCUUGGGUCAGGACAUCAACUUGGACAUUCCUAGUUUUCAAAUGAGUGAUGAUAUUGACGAUAUAAAAUGGGAAAAAACUUCAGACAAGAAAAAGAUUGCACAAUUCAGAAAAGAGAAAGAGACUUUCAAGGAAAAAGAUACAUAUAAGCUAUUUAAAAAUGGAACUCUGAAAAUUAAGCAUCUGAAGACCGAUGAUCAGGAUAUCUACAAGGUAUCAAUAUAUGAUACAAAAGGAAAAAAUGUGUUGGAAAAAAUAUUUGAUUUGAAGAUUCAAGAGAGGGUCUCAAAACCAAAGAUCUCCUGGACUUGUAUCAACACAACCCUGACCUGUGAGGUAAUGAAUGGAACUGACCCCGAAUUAAACCUGUAUCAAGAUGGGAAACAUCUAAAACUUUCUCAGAGGGUCAUCACACACAAGUGGACCACCAGCCUGAGUGCAAAAUUCAAGUGCACAGCAGGGAACAAAGUCAGCAAGGAAUCCAGUGUCGAGCCUGUCAGCUGUCCAGGAGGCAGCAUCCUUGGCCAGAGUAAUGGGCUCUCUGCCUGGACCCCUCCCAGCCAUCCCACUUCUCUUCCUUUUGCAGAGAAAGGUCUGGACAUCUAUCUCAUCAUUGGCAUAUGUGGAGGAGGCAGCCUCUUGAUGGUCUUUGUGGCACUGCUCGUUUUCUAUAUCACCAAAAGGAAAAAACAGAGGAGUCGGAGAAAUGAUGAGGAGCUGGAGACAAGAGCCCACAGAGUAGCUACUGAAGAAAGGGGCCGGAAGCCCCACCAAAUUCCAGCUUCAACCCCUCAGAAUCCAGCAACUUCCCAACAUCCUCCUCCACCACCUGGUCAUCGUUCCCAGGCACCUAGUCAUCGUCCCCCGCCUCCUGGACACCGUGUUCAGCACCAGCCUCAGAAGAGGCCUCCUGCUCCGUCGGGCACACAAGUUCACCAGCAGAAAGGCCCGCCCCUCCCCAGACCUCGAGUUCAGCCAAAACCUCCCCAUGGGGCAGCAGAAAACUCAUUGUCCCCUUCCUCUAAUUAAAAAAGAUAGAAACUGUCUUUUUCAAUAAAAAGCACUGUGGAUUUCUGCCCUCCUGAUGUGCAUAUCCGUACUUCCAUGAGGUGUUUUCUGUGUGCAGAACAUUGUCACCUCCUGAGGCUGUGGGCCACAGCCACCUCUGCAUCUUCGAACUCAGCCAUGUGGUCAACAUCUGGAGUUUUUGGUCUCCUCAGAGAGCUCCAUCACACCAGUAAGGAGAAGCAAUAUAAGUGUGAUUGCAAGAAUGGUAGAGGACCGAGCACAGAAAUCUUAGAGAUUUCUUGUCCCCUCUCAGGUCAUGUGUAGAUGCGAUAAAUCAAGUGAUUGGUGUGCCUGGGUCUCACUACAAGCAGCCUAUCUGCUUAAGAGACUCUGGAGUUUCUUAUGUGCCCUGGUGGACACUUGCCCACCAUCCUGUGAGUAAAAGUGAAAUAAAAGCUUUGACUAGA-3'- Poly-A tail
  • Coding region
DNA
DNA (Gene ID: 914)
CD2
CD2 molecule
strand +
NCBI CDS gene sequence (1134 bp)
5'-ATGAGCTTTCCATGTAAATTTGTAGCCAGCTTCCTTCTGATTTTCAATGTTTCTTCCAAAGGTGCAGTCTCCAAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCATCTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAACTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGGAGGCAGCATCCTTGGCCAGAGTAATGGGCTCTCTGCCTGGACCCCTCCCAGCCATCCCACTTCTCTTCCTTTTGCAGAGAAAGGTCTGGACATCTATCTCATCATTGGCATATGTGGAGGAGGCAGCCTCTTGATGGTCTTTGTGGCACTGCTCGTTTTCTATATCACCAAAAGGAAAAAACAGAGGAGTCGGAGAAATGATGAGGAGCTGGAGACAAGAGCCCACAGAGTAGCTACTGAAGAAAGGGGCCGGAAGCCCCACCAAATTCCAGCTTCAACCCCTCAGAATCCAGCAACTTCCCAACATCCTCCTCCACCACCTGGTCATCGTTCCCAGGCACCTAGTCATCGTCCCCCGCCTCCTGGACACCGTGTTCAGCACCAGCCTCAGAAGAGGCCTCCTGCTCCGTCGGGCACACAAGTTCACCAGCAGAAAGGCCCGCCCCTCCCCAGACCTCGAGTTCAGCCAAAACCTCCCCATGGGGCAGCAGAAAACTCATTGTCCCCTTCCTCTAATTAA-3'
NCBI CDS gene sequence with introns (location: 116754493.. 116768783) (14291 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 116754430.. 116769229) (14800 bp)Download
NCBI gene sequence (location: [116754430 - 1000].. 116769229) (15800 bp)Download
Cite How to cite