NCBI Summary
This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The full-length transcript structure is predicted based on partial human and full-length homologous transcript alignments from cow GeneID:507142 and mouse GeneID:230806.
Protein
Protein (NP_001034864)
Beta/gamma crystallin domain-containing protein 2
Beta/gamma crystallin domain-containing protein 2 (Absent in melanoma 1-like protein)
CRYBG2
crystallin beta-gamma domain containing 2
Undefined
Very low evidence
Ricin-like
R-Type Lectins
b-trefoil
Uncharacterised
Undefined
Undefined
Protein sequence and protein families (fasta) (1661 amino acids) Download
MEEAGGPMARAKARVVSATLTWRQRPPTQEEIKHGFHKVSLVSGAQMEAPQKEMFEFSRREEVEVNGFATQEEETVNCQGPRDTAGSKNFQSHGPIFSKKYIPPPKEKRPEGRLKEAVDQSDGSRQAPRTEPPCVGAMARTELLVPLPGPREPSPHPGVGLTSGSSRSLEEYRVTRTVRTTTVVGGHVDRRMSSSVTVRPVSSGEALPRGRQVSRMVPPVVVGSPPGSPSRSQAVKVLSNLVPAGHSPPASHLPRPTAGGPRSTGLGSTVGAALRQLPETGTAELKDSSALASTGIPASAHLPKNQDAPAACPDRDQGRAPDARACELWQVLGAPSSTELPLQTSQGQASVPSSPRLETHVPSPGLTHPAKQPVVPTHPGARLTPLVLPPKKKDGPVDPPAATVLPMVRSEHVTVPGQPPAPSTTRRKDVPSPGGLSAPSSPRNKFVQNSENVPVLPFTQREVVKGPGAPAASSPTRKEVVQGSSASAASSPTWKEVVKGPGAPAASSPTQKEVVQGSSAPAALFPTWKEVVKGPGAPDASFPTWKEVVKGPGAPAASSPTQKEVVQGSGAPAALSTTPKEVVKGPGAPAASSPTQKEVVKGPCAPAASSPTQKEVVQGSGAPAALSPKSTEVVQGPKGSSSIQKEAVQGIAGSLAPPLTKEETVQGPIAPATSLPKQDKGVQDSEGSPISSLTQKEVVQDPDALPAPSSSVDRVSPSPGGTPAPVPTGAEASTESQLVSDPTEGKTCTETSREEDEVALAADLEIFLDTLRSMEPPEILRTHRLPRAPRSSYLSMYATLPAIEEDQLGPWVLGPGPQEVPSLEEKEEEEEEEPENPYLSDDEKLQRRQEKAGPSPSRDLHPARPTQVSCSPLEMMKKHVAGTKGPHSELGLELQGGSRPTSRLGGSLLFGSLVPTAKEASTPEPLGTKLSALLPHGAPGLRKVPGQLPLLCSERSSPTEKLACSLPLEGWSPALKTQGKLNTRPGKVIFFSESGCQGSGREVWGDIVDASGWAPVASIRVVRGCWVLYEEPEFRGQKLVLPEGDMELRTPGTKWSPQGIGSLRRVVWDYSTPEISLFSEEGLKGEQVKLTEALKNSQGLEKPLQVASATVSAGLWLLYPKPLFEDTPYILEPGEYPTSEAWGTSDPSVGSLKPMRLGCPSVEKPGEPRAVVYEAPGFQGRSWEVSRDIYNLQQPEDSQSPHLASVGSLRVLGGCWVGYEKEGFRGHQYLLEEGEYPDWSHWGGYDELLTSLRVIRTDFGDPAVVLFEAMDFEGHGVEVSKALPDVELVQHGPSTQAIHVLSGVWVAYQEVGFSGEQYVLEKGVYRNCEDWGAGNSTLASLQPVLQVGEHDLHFVSKIQLFSRPDFLGDHFSFEDDQAALPASFRPQSCRVHGGSWILFDETNFEGDQHILSEGEFPTLTAMGCLASTVLGSLQKVSLHFSEPSIFLYGLECFEGKEIELSREVRSLQAEGFNNHVLSVRIKGGIWVLCEHSDFRGRQWLVGSCEITNWLTYSGTQRVGSLYPIKQRRVYFRLWNAALGGFLAVPDHVEDMKAGRVVVADPQAGGSCIWYYEDGLLKNQMAPTMSLQVIGPPSPGSKVVLWAESRLPRQTWSISESGHICSQMFEGQILDVKGGRGYDRDHVVLWEPDEDRASQIWTIHVL
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (4 PubMed Identifiers)
  • Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. [23251661]
  • Violating the splicing rules: TG dinucleotides function as alternative 3' splice sites in U2-dependent introns. [17672918]
  • Circular rapid amplification of cDNA ends for high-throughput extension cloning of partial genes. [15203218]
  • Cloning and tissue expression of the mouse ortholog of AIM1, a betagamma-crystallin superfamily member. [9716656]
UniProt Main References (3 PubMed Identifiers)
  • The DNA sequence and biological annotation of human chromosome 1. [16710414]
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
RNA
RNA (Transcript ID: NM_001039775.4)
crystallin beta-gamma domain containing 2
m7G-5')ppp(5'-AGCUGAGAGCCCAAUCGCAUCAGGGGAGCACGGCCCAGCAGCAGGAGCUCCAGGCUGGCUGGACACCUGGGUCCCCACGCAGACUGUGAGUAGAGGGAGCUGGACCACAGUGGGACAAGGACACCUCCAGACAGGUUGCCAGGGCCCCACAUGGAGGAGGCAGGUGGGCCCAUGGCCCGGGCCAAGGCCCGAGUGGUAAGUGCCACAUUGACAUGGCGGCAGCGGCCCCCCACCCAGGAAGAGAUCAAACAUGGUUUUCACAAGGUGUCCCUGGUGUCAGGGGCCCAGAUGGAAGCCCCGCAGAAGGAGAUGUUUGAGUUCAGCCGUCGAGAGGAAGUGGAAGUCAAUGGCUUUGCAACACAGGAAGAAGAGACUGUGAAUUGCCAGGGCCCUCGGGAUACAGCUGGCUCCAAGAACUUCCAGAGCCAUGGACCCAUCUUUUCCAAGAAGUACAUACCACCUCCCAAGGAGAAAAGGCCUGAGGGGAGGCUGAAGGAGGCUGUGGACCAGAGUGAUGGCAGCCGCCAAGCUCCCAGGACUGAGCCCCCAUGUGUGGGAGCUAUGGCCAGGACUGAGCUUUUGGUUCCCCUGCCUGGGCCCCGAGAGCCAAGUCCCCACCCAGGUGUAGGUCUCACCAGUGGUAGCUCCCGGAGCCUCGAGGAAUACCGAGUGACACGCACUGUGCGGACCACCACAGUGGUGGGAGGUCAUGUGGACCGGCGGAUGAGCAGCUCUGUGACUGUGAGGCCAGUGUCCUCAGGCGAGGCCCUGCCACGGGGCCGUCAGGUCUCCCGCAUGGUGCCGCCAGUGGUGGUGGGCUCCCCACCAGGCUCGCCCAGCCGCAGCCAGGCCGUGAAAGUGCUAAGUAACCUCGUGCCUGCUGGGCACAGCCCCCCUGCCAGUCACCUGCCCAGGCCCACGGCUGGCGGGCCAAGGAGCACAGGUCUGGGCAGCACAGUGGGGGCAGCCUUGAGGCAGCUGCCUGAGACCGGGACAGCAGAGCUUAAAGACAGCUCUGCCCUGGCCUCUACAGGCAUCCCAGCCAGUGCUCACCUGCCUAAGAAUCAGGAUGCCCCUGCAGCCUGUCCGGACAGAGACCAGGGCAGAGCCCCGGAUGCCAGGGCCUGUGAGCUCUGGCAGGUGCUGGGAGCCCCCAGUUCCACUGAGCUCCCUCUCCAGACUUCUCAGGGUCAAGCAUCAGUCCCCUCCUCUCCCAGACUCGAGACCCAUGUCCCCUCUCCUGGCCUAACUCACCCUGCAAAGCAGCCUGUGGUGCCCACUCACCCCGGGGCCCGGCUCACUCCCCUUGUUCUGCCCCCUAAAAAAAAGGACGGGCCCGUGGACCCCCCUGCUGCCACCGUCCUGCCCAUGGUGAGGAGCGAGCAUGUGACAGUCCCUGGACAACCUCCUGCUCCAUCCACUACAAGAAGGAAGGAUGUCCCCAGCCCAGGAGGUCUUUCUGCUCCAUCGUCCCCAAGGAAUAAGUUUGUUCAGAACUCUGAAAAUGUCCCUGUCCUCCCCUUUACCCAGAGGGAGGUCGUGAAGGGCCCCGGUGCUCCUGCUGCCUCAUCUCCCACCCGGAAGGAGGUGGUGCAGGGGUCCAGUGCUUCUGCUGCCUCGUCCCCCACCUGGAAAGAGGUCGUGAAGGGCCCUGGUGCUCCUGCUGCCUCAUCUCCCACCCAGAAGGAGGUGGUGCAGGGGUCCAGUGCUCCUGCUGCCUUGUUCCCCACCUGGAAAGAGGUCGUGAAGGGCCCCGGUGCUCCUGAUGCCUCAUUUCCCACCUGGAAAGAGGUUGUGAAGGGCCCUGGUGCUCCUGCUGCCUCAUCCCCCACCCAGAAGGAGGUGGUGCAGGGGUCUGGUGCUCCUGCUGCCUUGUCCACCACCCCAAAAGAGGUUGUGAAGGGCCCUGGUGCUCCUGCUGCCUCAUCGCCCACCCAGAAAGAGGUUGUGAAGGGCCCCUGUGCUCCUGCUGCCUCAUCUCCCACCCAGAAGGAGGUGGUGCAGGGGUCUGGUGCUCCUGCUGCCUUGUCCCCCAAGUCAACUGAGGUUGUCCAGGGCCCAAAAGGCAGCAGUAGCAUCCAAAAAGAGGCUGUCCAGGGUAUUGCAGGCAGCCUUGCCCCGCCCCUCACCAAGGAAGAGACUGUUCAAGGCCCAAUUGCUCCUGCCACCUCACUCCCCAAACAGGAUAAGGGGGUCCAGGACUCUGAAGGGAGCCCCAUCUCAUCUCUCACCCAGAAAGAGGUUGUGCAGGACCCUGAUGCUCUCCCUGCCCCAUCUUCCUCAGUGGACAGGGUGUCCCCCAGCCCAGGAGGCACCCCUGCCCCAGUGCCAACAGGAGCAGAGGCCAGCACGGAGUCCCAGCUUGUCUCUGAUCCCACCGAGGGCAAGACGUGCACAGAGACAUCAAGGGAGGAGGAUGAGGUGGCCCUGGCCGCUGACCUGGAGAUAUUCCUGGAUACGCUGCGGAGCAUGGAGCCCCCUGAGAUCCUCCGCACUCACCGGCUGCCACGAGCCCCUCGCUCCUCCUACCUGUCCAUGUACGCCACGCUGCCUGCCAUUGAGGAGGACCAGCUGGGGCCAUGGGUGCUGGGCCCCGGACCCCAGGAGGUGCCUUCACUGGAAGAGAAAGAGGAGGAGGAGGAGGAGGAACCAGAGAACCCCUAUCUGAGUGACGAUGAGAAGCUCCAGCGCAGGCAGGAGAAAGCUGGGCCCAGCCCCUCCAGGGACCUCCACCCUGCCAGACCCACCCAGGUCUCCUGCUCUCCUCUGGAGAUGAUGAAGAAGCAUGUAGCAGGAACCAAGGGCCCCCACUCAGAGCUGGGAUUGGAACUGCAGGGAGGCAGCAGGCCCACUUCCCGUCUUGGAGGCAGCCUUCUGUUCGGCAGUCUGGUGCCUACCGCCAAGGAGGCCUCCACCCCGGAACCGCUGGGCACAAAACUAUCUGCUCUGCUGCCCCAUGGGGCACCGGGGCUCAGGAAGGUGCCAGGACAGUUGCCCCUGCUUUGCAGUGAAAGAUCAUCCCCAACGGAGAAGCUUGCCUGUUCCCUGCCCCUGGAGGGGUGGAGCCCAGCCUUAAAGACCCAGGGCAAGCUGAACACCAGGCCUGGAAAGGUGAUCUUCUUCUCAGAGUCUGGCUGCCAAGGCAGUGGCAGGGAGGUCUGGGGAGACAUCGUUGAUGCCUCAGGCUGGGCCCCCGUAGCCUCCAUAAGGGUAGUUCGAGGCUGCUGGGUGCUGUACGAAGAGCCAGAGUUCCGGGGUCAGAAGCUGGUCCUGCCUGAAGGAGACAUGGAACUCAGAACCCCAGGGACAAAGUGGAGUCCCCAAGGCAUCGGCUCCCUAAGGAGGGUUGUCUGGGACUACAGCACCCCGGAAAUCAGCCUCUUCUCUGAGGAGGGCCUCAAGGGGGAGCAAGUGAAGCUAACAGAGGCCUUGAAGAAUUCCCAGGGUCUGGAGAAGCCCCUGCAGGUGGCAUCUGCCACCGUCUCUGCAGGACUGUGGCUACUGUACCCCAAACCAUUAUUCGAAGACACUCCCUACAUCCUGGAACCUGGAGAGUACCCCACCUCAGAGGCCUGGGGCACAUCGGACCCCAGCGUGGGCUCCCUGAAGCCCAUGAGAUUGGGCUGCCCAAGUGUGGAGAAGCCAGGGGAGCCCAGGGCUGUGGUGUAUGAGGCCCCAGGCUUUCAGGGCCGCAGCUGGGAAGUGAGCCGAGACAUCUACAACCUUCAGCAGCCAGAGGACAGCCAGAGCCCCCACCUGGCCUCUGUGGGGUCCCUGAGAGUUCUCGGAGGCUGCUGGGUGGGCUACGAGAAGGAGGGCUUCCGGGGCCACCAGUAUCUGCUGGAGGAGGGGGAAUACCCAGACUGGUCACACUGGGGAGGCUAUGACGAGUUGCUGACCUCCCUCCGGGUCAUCCGGACGGACUUCGGGGACCCGGCCGUCGUGCUAUUUGAGGCCAUGGACUUCGAGGGGCACGGCGUGGAGGUGAGCAAGGCAUUGCCGGAUGUGGAGCUGGUGCAACACGGCCCCAGCACACAGGCCAUCCACGUGCUCAGCGGCGUGUGGGUGGCCUACCAGGAGGUGGGCUUCUCCGGGGAACAGUACGUGCUGGAGAAGGGCGUGUAUCGUAACUGCGAGGACUGGGGCGCUGGCAACAGCACCCUCGCCUCGCUGCAGCCGGUCCUACAGGUCGGGGAGCACGAUCUGCACUUCGUCUCAAAGAUUCAGCUUUUCUCCCGCCCCGACUUUCUGGGCGACCACUUCUCUUUCGAAGAUGACCAGGCCGCUCUGCCCGCCUCCUUCCGACCUCAGUCCUGCCGGGUCCACGGCGGCAGCUGGAUCCUGUUUGAUGAGACGAACUUCGAGGGUGACCAGCACAUUCUCUCUGAGGGCGAGUUCCCCACUCUCACGGCCAUGGGCUGCCUCGCCUCCACAGUCCUGGGCUCUCUCCAGAAGGUAUCCCUGCACUUUUCAGAGCCUUCCAUUUUCCUGUAUGGACUCGAGUGCUUCGAGGGGAAGGAGAUCGAGCUCAGCAGGGAGGUGCGGAGCCUGCAAGCCGAGGGCUUCAACAACCAUGUGCUGUCUGUGCGGAUCAAGGGGGGCAUUUGGGUGCUAUGUGAACACAGUGACUUCCGGGGCCGCCAGUGGCUGGUGGGAAGCUGCGAGAUCACCAACUGGCUGACCUACAGCGGCACCCAGAGGGUGGGCUCCCUCUACCCCAUCAAGCAGCGCCGGGUUUAUUUCCGCCUCUGGAAUGCAGCACUGGGGGGAUUCCUGGCAGUGCCGGACCAUGUGGAGGACAUGAAAGCAGGCCGUGUGGUGGUCGCCGACCCCCAAGCUGGAGGUAGCUGCAUCUGGUACUACGAGGAUGGGCUGCUGAAGAACCAGAUGGCCCCCACCAUGAGCCUACAGGUGAUUGGACCCCCUAGCCCAGGCUCCAAGGUGGUGCUGUGGGCCGAGAGCCGCCUGCCGCGCCAGACGUGGAGCAUCAGUGAAUCGGGCCACAUCUGCAGCCAGAUGUUCGAAGGCCAGAUCCUGGACGUGAAGGGAGGCCGGGGCUACGACCGGGACCACGUGGUGCUAUGGGAGCCGGAUGAGGACAGGGCAUCCCAGAUCUGGACUAUCCACGUGCUUUGAAACUUUUCCCCUCACCCUCCAGCCCUGGAGGCUUUUGCUGGGAUGAAUGUUUUUAUAGGGUUUUUGUUGUAACAUAAGCUAUUUUCUAAUAUGCUGCCAGGUA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 55057)
crystallin beta-gamma domain containing 2
strand -
FLJ38020
NCBI CDS gene sequence (4986 bp)
5'-ATGGAGGAGGCAGGTGGGCCCATGGCCCGGGCCAAGGCCCGAGTGGTAAGTGCCACATTGACATGGCGGCAGCGGCCCCCCACCCAGGAAGAGATCAAACATGGTTTTCACAAGGTGTCCCTGGTGTCAGGGGCCCAGATGGAAGCCCCGCAGAAGGAGATGTTTGAGTTCAGCCGTCGAGAGGAAGTGGAAGTCAATGGCTTTGCAACACAGGAAGAAGAGACTGTGAATTGCCAGGGCCCTCGGGATACAGCTGGCTCCAAGAACTTCCAGAGCCATGGACCCATCTTTTCCAAGAAGTACATACCACCTCCCAAGGAGAAAAGGCCTGAGGGGAGGCTGAAGGAGGCTGTGGACCAGAGTGATGGCAGCCGCCAAGCTCCCAGGACTGAGCCCCCATGTGTGGGAGCTATGGCCAGGACTGAGCTTTTGGTTCCCCTGCCTGGGCCCCGAGAGCCAAGTCCCCACCCAGGTGTAGGTCTCACCAGTGGTAGCTCCCGGAGCCTCGAGGAATACCGAGTGACACGCACTGTGCGGACCACCACAGTGGTGGGAGGTCATGTGGACCGGCGGATGAGCAGCTCTGTGACTGTGAGGCCAGTGTCCTCAGGCGAGGCCCTGCCACGGGGCCGTCAGGTCTCCCGCATGGTGCCGCCAGTGGTGGTGGGCTCCCCACCAGGCTCGCCCAGCCGCAGCCAGGCCGTGAAAGTGCTAAGTAACCTCGTGCCTGCTGGGCACAGCCCCCCTGCCAGTCACCTGCCCAGGCCCACGGCTGGCGGGCCAAGGAGCACAGGTCTGGGCAGCACAGTGGGGGCAGCCTTGAGGCAGCTGCCTGAGACCGGGACAGCAGAGCTTAAAGACAGCTCTGCCCTGGCCTCTACAGGCATCCCAGCCAGTGCTCACCTGCCTAAGAATCAGGATGCCCCTGCAGCCTGTCCGGACAGAGACCAGGGCAGAGCCCCGGATGCCAGGGCCTGTGAGCTCTGGCAGGTGCTGGGAGCCCCCAGTTCCACTGAGCTCCCTCTCCAGACTTCTCAGGGTCAAGCATCAGTCCCCTCCTCTCCCAGACTCGAGACCCATGTCCCCTCTCCTGGCCTAACTCACCCTGCAAAGCAGCCTGTGGTGCCCACTCACCCCGGGGCCCGGCTCACTCCCCTTGTTCTGCCCCCTAAAAAAAAGGACGGGCCCGTGGACCCCCCTGCTGCCACCGTCCTGCCCATGGTGAGGAGCGAGCATGTGACAGTCCCTGGACAACCTCCTGCTCCATCCACTACAAGAAGGAAGGATGTCCCCAGCCCAGGAGGTCTTTCTGCTCCATCGTCCCCAAGGAATAAGTTTGTTCAGAACTCTGAAAATGTCCCTGTCCTCCCCTTTACCCAGAGGGAGGTCGTGAAGGGCCCCGGTGCTCCTGCTGCCTCATCTCCCACCCGGAAGGAGGTGGTGCAGGGGTCCAGTGCTTCTGCTGCCTCGTCCCCCACCTGGAAAGAGGTCGTGAAGGGCCCTGGTGCTCCTGCTGCCTCATCTCCCACCCAGAAGGAGGTGGTGCAGGGGTCCAGTGCTCCTGCTGCCTTGTTCCCCACCTGGAAAGAGGTCGTGAAGGGCCCCGGTGCTCCTGATGCCTCATTTCCCACCTGGAAAGAGGTTGTGAAGGGCCCTGGTGCTCCTGCTGCCTCATCCCCCACCCAGAAGGAGGTGGTGCAGGGGTCTGGTGCTCCTGCTGCCTTGTCCACCACCCCAAAAGAGGTTGTGAAGGGCCCTGGTGCTCCTGCTGCCTCATCGCCCACCCAGAAAGAGGTTGTGAAGGGCCCCTGTGCTCCTGCTGCCTCATCTCCCACCCAGAAGGAGGTGGTGCAGGGGTCTGGTGCTCCTGCTGCCTTGTCCCCCAAGTCAACTGAGGTTGTCCAGGGCCCAAAAGGCAGCAGTAGCATCCAAAAAGAGGCTGTCCAGGGTATTGCAGGCAGCCTTGCCCCGCCCCTCACCAAGGAAGAGACTGTTCAAGGCCCAATTGCTCCTGCCACCTCACTCCCCAAACAGGATAAGGGGGTCCAGGACTCTGAAGGGAGCCCCATCTCATCTCTCACCCAGAAAGAGGTTGTGCAGGACCCTGATGCTCTCCCTGCCCCATCTTCCTCAGTGGACAGGGTGTCCCCCAGCCCAGGAGGCACCCCTGCCCCAGTGCCAACAGGAGCAGAGGCCAGCACGGAGTCCCAGCTTGTCTCTGATCCCACCGAGGGCAAGACGTGCACAGAGACATCAAGGGAGGAGGATGAGGTGGCCCTGGCCGCTGACCTGGAGATATTCCTGGATACGCTGCGGAGCATGGAGCCCCCTGAGATCCTCCGCACTCACCGGCTGCCACGAGCCCCTCGCTCCTCCTACCTGTCCATGTACGCCACGCTGCCTGCCATTGAGGAGGACCAGCTGGGGCCATGGGTGCTGGGCCCCGGACCCCAGGAGGTGCCTTCACTGGAAGAGAAAGAGGAGGAGGAGGAGGAGGAACCAGAGAACCCCTATCTGAGTGACGATGAGAAGCTCCAGCGCAGGCAGGAGAAAGCTGGGCCCAGCCCCTCCAGGGACCTCCACCCTGCCAGACCCACCCAGGTCTCCTGCTCTCCTCTGGAGATGATGAAGAAGCATGTAGCAGGAACCAAGGGCCCCCACTCAGAGCTGGGATTGGAACTGCAGGGAGGCAGCAGGCCCACTTCCCGTCTTGGAGGCAGCCTTCTGTTCGGCAGTCTGGTGCCTACCGCCAAGGAGGCCTCCACCCCGGAACCGCTGGGCACAAAACTATCTGCTCTGCTGCCCCATGGGGCACCGGGGCTCAGGAAGGTGCCAGGACAGTTGCCCCTGCTTTGCAGTGAAAGATCATCCCCAACGGAGAAGCTTGCCTGTTCCCTGCCCCTGGAGGGGTGGAGCCCAGCCTTAAAGACCCAGGGCAAGCTGAACACCAGGCCTGGAAAGGTGATCTTCTTCTCAGAGTCTGGCTGCCAAGGCAGTGGCAGGGAGGTCTGGGGAGACATCGTTGATGCCTCAGGCTGGGCCCCCGTAGCCTCCATAAGGGTAGTTCGAGGCTGCTGGGTGCTGTACGAAGAGCCAGAGTTCCGGGGTCAGAAGCTGGTCCTGCCTGAAGGAGACATGGAACTCAGAACCCCAGGGACAAAGTGGAGTCCCCAAGGCATCGGCTCCCTAAGGAGGGTTGTCTGGGACTACAGCACCCCGGAAATCAGCCTCTTCTCTGAGGAGGGCCTCAAGGGGGAGCAAGTGAAGCTAACAGAGGCCTTGAAGAATTCCCAGGGTCTGGAGAAGCCCCTGCAGGTGGCATCTGCCACCGTCTCTGCAGGACTGTGGCTACTGTACCCCAAACCATTATTCGAAGACACTCCCTACATCCTGGAACCTGGAGAGTACCCCACCTCAGAGGCCTGGGGCACATCGGACCCCAGCGTGGGCTCCCTGAAGCCCATGAGATTGGGCTGCCCAAGTGTGGAGAAGCCAGGGGAGCCCAGGGCTGTGGTGTATGAGGCCCCAGGCTTTCAGGGCCGCAGCTGGGAAGTGAGCCGAGACATCTACAACCTTCAGCAGCCAGAGGACAGCCAGAGCCCCCACCTGGCCTCTGTGGGGTCCCTGAGAGTTCTCGGAGGCTGCTGGGTGGGCTACGAGAAGGAGGGCTTCCGGGGCCACCAGTATCTGCTGGAGGAGGGGGAATACCCAGACTGGTCACACTGGGGAGGCTATGACGAGTTGCTGACCTCCCTCCGGGTCATCCGGACGGACTTCGGGGACCCGGCCGTCGTGCTATTTGAGGCCATGGACTTCGAGGGGCACGGCGTGGAGGTGAGCAAGGCATTGCCGGATGTGGAGCTGGTGCAACACGGCCCCAGCACACAGGCCATCCACGTGCTCAGCGGCGTGTGGGTGGCCTACCAGGAGGTGGGCTTCTCCGGGGAACAGTACGTGCTGGAGAAGGGCGTGTATCGTAACTGCGAGGACTGGGGCGCTGGCAACAGCACCCTCGCCTCGCTGCAGCCGGTCCTACAGGTCGGGGAGCACGATCTGCACTTCGTCTCAAAGATTCAGCTTTTCTCCCGCCCCGACTTTCTGGGCGACCACTTCTCTTTCGAAGATGACCAGGCCGCTCTGCCCGCCTCCTTCCGACCTCAGTCCTGCCGGGTCCACGGCGGCAGCTGGATCCTGTTTGATGAGACGAACTTCGAGGGTGACCAGCACATTCTCTCTGAGGGCGAGTTCCCCACTCTCACGGCCATGGGCTGCCTCGCCTCCACAGTCCTGGGCTCTCTCCAGAAGGTATCCCTGCACTTTTCAGAGCCTTCCATTTTCCTGTATGGACTCGAGTGCTTCGAGGGGAAGGAGATCGAGCTCAGCAGGGAGGTGCGGAGCCTGCAAGCCGAGGGCTTCAACAACCATGTGCTGTCTGTGCGGATCAAGGGGGGCATTTGGGTGCTATGTGAACACAGTGACTTCCGGGGCCGCCAGTGGCTGGTGGGAAGCTGCGAGATCACCAACTGGCTGACCTACAGCGGCACCCAGAGGGTGGGCTCCCTCTACCCCATCAAGCAGCGCCGGGTTTATTTCCGCCTCTGGAATGCAGCACTGGGGGGATTCCTGGCAGTGCCGGACCATGTGGAGGACATGAAAGCAGGCCGTGTGGTGGTCGCCGACCCCCAAGCTGGAGGTAGCTGCATCTGGTACTACGAGGATGGGCTGCTGAAGAACCAGATGGCCCCCACCATGAGCCTACAGGTGATTGGACCCCCTAGCCCAGGCTCCAAGGTGGTGCTGTGGGCCGAGAGCCGCCTGCCGCGCCAGACGTGGAGCATCAGTGAATCGGGCCACATCTGCAGCCAGATGTTCGAAGGCCAGATCCTGGACGTGAAGGGAGGCCGGGGCTACGACCGGGACCACGTGGTGCTATGGGAGCCGGATGAGGACAGGGCATCCCAGATCTGGACTATCCACGTGCTTTGA-3'
NCBI CDS gene sequence with introns (location: 26321968.. 26346657) (24690 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 26321865.. 26354130) (32266 bp)Download
NCBI gene sequence (location: [26321865.. 26354130 + 1000]) (33266 bp)Download
Cite How to cite