Protein
Protein (NP_940910)
Killer cell lectin-like receptor G member 2
Killer cell lectin-like receptor subfamily G member 2 (C-type lectin domain family 15 member B)
KLRG2
killer cell lectin like receptor G2
Undefined
Very low evidence
C-type lectin
Undefined
C-type - Natural Killer NK
a/b mixed / C-type lectin-like
Uncharacterised
0.281
Undefined
Protein sequence and protein families (fasta) (409 amino acids) Download
MEESWEAAPGGQAGAELPMEPVGSLVPTLEQPQVPAKVRQPEGPESSPSPAGAVEKAAGAGLEPSSKKKPPSPRPGSPRVPPLSLGYGVCPEPPSPGPALVKLPRNGEAPGAEPAPSAWAPMELQVDVRVKPVGAAGGSSTPSPRPSTRFLKVPVPESPAFSRHADPAHQLLLRAPSQGGTWGRRSPLAAARTESGCDAEGRASPAEGSAGSPGSPTCCRCKELGLEKEDAALLPRAGLDGDEKLPRAVTLTGLPMYVKSLYWALAFMAVLLAVSGVVIVVLASRAGARCQQCPPGWVLSEEHCYYFSAEAQAWEASQAFCSAYHATLPLLSHTQDFLGRYPVSRHSWVGAWRGPQGWHWIDEAPLPPQLLPEDGEDNLDINCGALEEGTLVAANCSTPRPWVCAKGTQ
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.53, 1.95] ÅDownload
The location of the lectin domain structural model is: 288-406
We infer [1.53, 1.95] Å as the interval of error of this structural model.
Template 1: 6PWS chain: A, E1BIQ4, XP_005198961.1, sequence identity: 30.3%, coverage: 95.0%, location in sequence: 174-302, (162-290 in PDB).
Template 2: 3VYK chain: A, Q5YIR8, NP_001005860.1, sequence identity: 26.9%, coverage: 96.6%, location in sequence: 106-233, (106-233 in PDB).
Template 3: 6JJJ chain: A, P70194, NP_058031.2, sequence identity: 26.1%, coverage: 100.0%, location in sequence: 393-543, (393-543 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (1 PubMed Identifiers)
  • Fine-mapping of prostate cancer aggressiveness loci on chromosome 7q22-35. [20945404]
UniProt Main References (5 PubMed Identifiers)
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The DNA sequence of human chromosome 7. [12853948]
  • Human chromosome 7: DNA sequence and biology. [12690205]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
  • Lys-N and trypsin cover complementary parts of the phosphoproteome in a refined SCX-based approach. [19413330]
All isoforms of this gene containing a lectin domain
NP_940910.1, XP_011514443.1, XP_005250368.1, XP_011514442.1
RNA
RNA (Transcript ID: NM_198508.4)
killer cell lectin like receptor G2
m7G-5')ppp(5'-CUCAGCGUCUCCGGGUGGCGGGGCGCGCGGGAUGGAGGAGUCUUGGGAGGCUGCGCCCGGAGGCCAAGCCGGGGCAGAGCUCCCAAUGGAGCCCGUGGGAAGCCUGGUCCCCACGCUGGAGCAGCCGCAGGUGCCCGCGAAGGUGCGACAACCUGAAGGUCCCGAAAGCAGCCCAAGUCCGGCCGGGGCCGUGGAGAAGGCGGCGGGCGCAGGCCUGGAGCCCUCGAGCAAGAAAAAGCCGCCUUCGCCUCGCCCCGGGUCCCCGCGCGUGCCGCCGCUCAGCCUGGGCUACGGGGUCUGCCCCGAGCCGCCGUCACCGGGCCCUGCCUUGGUCAAGCUGCCCCGGAAUGGCGAGGCGCCCGGGGCUGAGCCUGCGCCCAGCGCCUGGGCGCCCAUGGAGCUGCAGGUAGAUGUGCGCGUGAAGCCCGUGGGCGCGGCCGGUGGCAGCAGCACGCCAUCGCCCAGGCCCUCCACGCGCUUCCUCAAGGUGCCGGUGCCCGAGUCCCCUGCCUUCUCCCGCCACGCGGACCCGGCGCACCAGCUCCUGCUGCGCGCACCAUCCCAGGGCGGCACGUGGGGCCGCCGCUCGCCGCUGGCUGCAGCCCGGACGGAGAGCGGCUGCGACGCAGAGGGCCGGGCCAGCCCCGCGGAAGGAAGCGCCGGCUCCCCGGGCUCCCCCACGUGCUGCCGCUGCAAGGAGCUGGGGCUGGAGAAGGAGGAUGCGGCGCUGUUGCCCCGCGCGGGGUUGGACGGCGACGAGAAGCUGCCCCGGGCCGUAACGCUUACGGGGCUACCCAUGUACGUGAAGUCCCUGUACUGGGCCCUGGCGUUCAUGGCUGUGCUCCUGGCAGUCUCUGGGGUUGUCAUUGUGGUCCUGGCCUCAAGAGCAGGAGCCAGAUGCCAGCAGUGCCCCCCAGGCUGGGUGUUGUCCGAGGAGCACUGUUACUACUUCUCUGCAGAAGCGCAGGCCUGGGAAGCCAGCCAGGCUUUCUGCUCAGCCUACCACGCUACCCUCCCCCUGCUAAGCCACACCCAGGACUUCCUGGGCAGAUACCCAGUCUCCAGGCACUCCUGGGUGGGGGCCUGGCGAGGCCCCCAGGGCUGGCACUGGAUCGACGAGGCCCCACUCCCGCCCCAGCUACUCCCUGAGGACGGCGAGGACAAUCUGGAUAUCAACUGUGGGGCCCUGGAGGAAGGCACGCUGGUGGCUGCAAACUGCAGCACUCCAAGACCCUGGGUCUGUGCCAAGGGGACCCAGUGAUCUGGGCUCUGCCUGGUCCUCAGCCUGCCAGGCAGAUGCAGCACCCCCUACAGGGGAGGCCAGUUGAGAGCUUGGGCAGCCUCUUCCUGGACCCAGUUAUCCAGGUCUUCAUGCUCUGCUCAAGGGGGCCACAUGAGCGAGCCUAGGAGCUGGACUUCAACCCAGGAAGAUGCAUCCGAGGGAAAGGAGAUUUUCUAUGGCCUCAGGCCUGAGUGCCAAUAUUAGUCUCCAGCUUCUGUGGAUGAUCGGUUUGAUGACAUUGGGAUGGUUGUUUAGCAUUUCUGUGCCUUGGUUUCAUUAAAAUGACAAUUUCCCCCUAGAGGAAAAAGACAGGGUUAACAACCACAGCGGAUUCCAAUCUGGGUUCUCAUUCCGGCUCAUGGAAAUGAGUCUGCCGUUGUUCAGUGGCAGUGGGACUUGGCAGGGAUAACGUCAUUGCUGUGAAUUCUACUUCAGGCAGCUGGGUGUACAUCGGACACAGCCUACCGGCAGCCUCUGGAAAAUUAACCAAGGAAAAGGAGCGGUCAGCCCUGGAAAGAGGGGAGAGCAAGGUUUUCCUUCCCCACCCUGAGAGUUGGCAAAGGGUUGGCAGACAGGAAGGUUCUGGGUGGAGAUCCCGCAUGUGGGCUGGCCAGCCCCUGGCACGCUGAUGCCCAAGGGUGAGACAAGGCAGAGAGGACAGGGCCACCUGGCAGGAGAAGCCAGGAGAGCACCCCAGCUUGGUAGGUGGAAGCUGAGGAGUCUGAGUGAAAAAGGAAAUCAGAGAAAUGCAGGCACGUUCCAGGCAGCUCUUCUACCCACAGCUGCAGAGACGACCAACCUGAAGAUGUCUCCAUGCUGGGGUGCAGUGAAGACCUUCAGGCUGGAGGAUGUGGCUGACAGAGUUGUGUAGUUCCU-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 346689)
killer cell lectin like receptor G2
strand -
FLJ44186, CLEC15B
NCBI CDS gene sequence (1230 bp)
5'-ATGGAGGAGTCTTGGGAGGCTGCGCCCGGAGGCCAAGCCGGGGCAGAGCTCCCAATGGAGCCCGTGGGAAGCCTGGTCCCCACGCTGGAGCAGCCGCAGGTGCCCGCGAAGGTGCGACAACCTGAAGGTCCCGAAAGCAGCCCAAGTCCGGCCGGGGCCGTGGAGAAGGCGGCGGGCGCAGGCCTGGAGCCCTCGAGCAAGAAAAAGCCGCCTTCGCCTCGCCCCGGGTCCCCGCGCGTGCCGCCGCTCAGCCTGGGCTACGGGGTCTGCCCCGAGCCGCCGTCACCGGGCCCTGCCTTGGTCAAGCTGCCCCGGAATGGCGAGGCGCCCGGGGCTGAGCCTGCGCCCAGCGCCTGGGCGCCCATGGAGCTGCAGGTAGATGTGCGCGTGAAGCCCGTGGGCGCGGCCGGTGGCAGCAGCACGCCATCGCCCAGGCCCTCCACGCGCTTCCTCAAGGTGCCGGTGCCCGAGTCCCCTGCCTTCTCCCGCCACGCGGACCCGGCGCACCAGCTCCTGCTGCGCGCACCATCCCAGGGCGGCACGTGGGGCCGCCGCTCGCCGCTGGCTGCAGCCCGGACGGAGAGCGGCTGCGACGCAGAGGGCCGGGCCAGCCCCGCGGAAGGAAGCGCCGGCTCCCCGGGCTCCCCCACGTGCTGCCGCTGCAAGGAGCTGGGGCTGGAGAAGGAGGATGCGGCGCTGTTGCCCCGCGCGGGGTTGGACGGCGACGAGAAGCTGCCCCGGGCCGTAACGCTTACGGGGCTACCCATGTACGTGAAGTCCCTGTACTGGGCCCTGGCGTTCATGGCTGTGCTCCTGGCAGTCTCTGGGGTTGTCATTGTGGTCCTGGCCTCAAGAGCAGGAGCCAGATGCCAGCAGTGCCCCCCAGGCTGGGTGTTGTCCGAGGAGCACTGTTACTACTTCTCTGCAGAAGCGCAGGCCTGGGAAGCCAGCCAGGCTTTCTGCTCAGCCTACCACGCTACCCTCCCCCTGCTAAGCCACACCCAGGACTTCCTGGGCAGATACCCAGTCTCCAGGCACTCCTGGGTGGGGGCCTGGCGAGGCCCCCAGGGCTGGCACTGGATCGACGAGGCCCCACTCCCGCCCCAGCTACTCCCTGAGGACGGCGAGGACAATCTGGATATCAACTGTGGGGCCCTGGAGGAAGGCACGCTGGTGGCTGCAAACTGCAGCACTCCAAGACCCTGGGTCTGTGCCAAGGGGACCCAGTGA-3'
NCBI CDS gene sequence with introns (location: 139453587.. 139483642) (30056 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 139452690.. 139483673) (30984 bp)Download
NCBI gene sequence (location: [139452690.. 139483673 + 1000]) (31984 bp)Download
Cite How to cite