NCBI Summary
This gene encodes a glycan-binding receptor and member of the C-type lectin family which plays a role in the immune response. C-type lectin receptors are pattern recognition receptors located on immune cells that play a role in the recognition and uptake of both self and non-self glycoproteins as well as mediating cell adhesion, glycoprotein clearance, and cell signaling functions. This gene's protein binds complex-type N-glycans of the viral envelope proteins of Ebola virus, West Nile filovirus, and SARS coronavirus, but not HIV or hepatitis C virus. In mouse, this protein has been shown to recognize activated T-cells and to negatively regulate T-cell receptor-mediated signalling. It also acts as a novel, liver-specific regulator of NK cell-mediated immunity in mouse. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2020].
Protein
Protein (NP_940894)
LSECtin
C-type lectin domain family 4 member G (Liver and lymph node sinusoidal endothelial cell C-type lectin) (LSECtin)
CLEC4G
C-type lectin domain family 4 member G
Undefined
Curated
C-type lectin
CLEC4G
C-type - Type II transmembrane receptors
a/b mixed / C-type lectin-like
MDTTRYSKWGGSSEEVPGGPWGRWVHWSRRPLFLALAVLVTTVLWAVILSILLSKASTERAALLDGHDLLRTNASKQTAALGALKEEVGDCHSCCSGTQAQLQTTRAELGEAQAKLMEQESALRELRERVTQGLAEAGRGREDVRTELFRALEAVRLQNNSCEPCPTSWLSFEGSCYFFSVPKTTWAAAQDHCADASAHLVIVGGLDEQGFLTRNTRGRGYWLGLRAVRHLGKVQGYQWVDGVSLSFSHWNQGEPNDAWGRENCVMMLHTGLWNDAPCDSEKDGWICEKRHNC
No structure currently available in the PDB RCSB Databank.
Structural models
SWISS-MODEL structural models
The location of the lectin domain structural model is: 148-290
We infer [1.51, 1.93] Å as the interval of error of this structural model.
Template 1: 4ZES chain: A, Q8WTT0, NP_569708.1, sequence identity: 31.5%, coverage: 95.8%, location in sequence: 67-213, (67-213 in PDB).
Template 2: 6JJJ chain: A, P70194, NP_058031.2, sequence identity: 30.8%, coverage: 95.1%, location in sequence: 393-543, (393-543 in PDB).
Template 3: 3WHD chain: C, Q8WXI8, NP_525126.2, sequence identity: 28.7%, coverage: 97.2%, location in sequence: 63-215, (63-215 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
We infer [1.51, 1.93] Å as the interval of error of this structural model.
Template 1: 4ZES chain: A, Q8WTT0, NP_569708.1, sequence identity: 31.5%, coverage: 95.8%, location in sequence: 67-213, (67-213 in PDB).
Template 2: 6JJJ chain: A, P70194, NP_058031.2, sequence identity: 30.8%, coverage: 95.1%, location in sequence: 393-543, (393-543 in PDB).
Template 3: 3WHD chain: C, Q8WXI8, NP_525126.2, sequence identity: 28.7%, coverage: 97.2%, location in sequence: 63-215, (63-215 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (10 PubMed Identifiers)
- Single cell RNA sequencing of 13 human tissues identify cell types and receptors of human coronaviruses. [32199615]
- A reference map of the human binary protein interactome. [32296183]
- LSECtin on tumor-associated macrophages enhances breast cancer stemness via interaction with its receptor BTN3A3. [30858559]
- Distinct usage of three C-type lectins by Japanese encephalitis virus: DC-SIGN, DC-SIGNR, and LSECtin. [24623090]
- Mobility study of individual residue sites in the carbohydrate recognition domain of LSECtin using SDSL-EPR technique. [22711492]
- Polymorphisms in the C-type lectin genes cluster in chromosome 19 and predisposition to severe acute respiratory syndrome coronavirus (SARS-CoV) infection. [18697825]
- Interactions of LSECtin and DC-SIGN/DC-SIGNR with viral ligands: Differential pH dependence, internalization and virion binding. [18083206]
- The DC-SIGN-related lectin LSECtin mediates antigen capture and pathogen binding by human myeloid cells. [17339424]
- LSECtin interacts with filovirus glycoproteins and the spike protein of SARS coronavirus. [16051304]
- Characterization of a novel C-type lectin-like gene, LSECtin: demonstration of carbohydrate binding and expression in sinusoidal endothelial cells of liver and lymph node. [14711836]
UniProt Main References (5 PubMed Identifiers)
- The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment. [12975309]
- The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
- Identification of cell surface molecules involved in dystroglycan-independent Lassa virus cell entry. [22156524]
- Cell surface molecules involved in infection mediated by lymphocytic choriomeningitis virus glycoprotein. [22673088]
- An enzyme assisted RP-RPLC approach for in-depth analysis of human liver phosphoproteome. [24275569]
All isoforms of this gene containing a lectin domain
RNA
RNA (Transcript ID: NM_198492.4)
C-type lectin domain family 4 member G, transcript variant 1
m7G-5')ppp(5'-GCAUCGCCAUGGACACCACCAGGUACAGCAAGUGGGGCGGCAGCUCCGAGGAGGUCCCCGGAGGGCCCUGGGGACGCUGGGUGCACUGGAGCAGGAGACCCCUCUUCUUGGCCCUGGCUGUCCUGGUCACCACAGUCCUUUGGGCUGUGAUUCUGAGUAUCCUAUUGUCCAAGGCCUCCACGGAGCGCGCGGCGCUGCUUGACGGCCACGACCUGCUGAGGACAAACGCCUCGAAGCAGACGGCGGCGCUGGGUGCCCUGAAGGAGGAGGUCGGAGACUGCCACAGCUGCUGCUCGGGGACGCAGGCGCAGCUGCAGACCACGCGCGCGGAGCUUGGGGAGGCGCAGGCGAAGCUGAUGGAGCAGGAGAGCGCCCUGCGGGAACUGCGUGAGCGCGUGACCCAGGGCUUGGCUGAAGCCGGCAGGGGCCGUGAGGACGUCCGCACUGAGCUGUUCCGGGCGCUGGAGGCCGUGAGGCUCCAGAACAACUCCUGCGAGCCGUGCCCCACGUCGUGGCUGUCCUUCGAGGGCUCCUGCUACUUUUUCUCUGUGCCAAAGACGACGUGGGCGGCGGCGCAGGAUCACUGCGCAGAUGCCAGCGCGCACCUGGUGAUCGUUGGGGGCCUGGAUGAGCAGGGCUUCCUCACUCGGAACACGCGUGGCCGUGGUUACUGGCUGGGCCUGAGGGCUGUGCGCCAUCUGGGCAAGGUUCAGGGCUACCAGUGGGUGGACGGAGUCUCUCUCAGCUUCAGCCACUGGAACCAGGGAGAGCCCAAUGACGCUUGGGGGCGCGAGAACUGUGUCAUGAUGCUGCACACGGGGCUGUGGAACGACGCACCGUGUGACAGCGAGAAGGACGGCUGGAUCUGUGAGAAAAGGCACAACUGCUGACCCCGCCCAGUGCCCUGGAGCCGCGCCCAUUGCAGCAUGUCGUAUCCUGGGGGCUGCUCACCUCCCUGGCUCCUGGAGCUGAUUGCCAAAGAGUUUUUUCUUCCUCAUCCACCGCUGCUGAGUCUCAGAAACACUUGGCCCAACAUAGCCCUGUCCAGCCCAGUGCCUGGGCUCUGGGACCUCCAUGCCGACCUCAUCCUAACUCCACUCACGCAGACCCAACCUAACCUCCACUAGCUCCAAAAUCCCUGCUCCUGCGUCCCCGUGAUAUGCCUCCACUUCUCUCCCUAACCAAGGUUAGGUGACUGAGGACUGGAGCUGUUUGGUUUUCUCGCAUUUUCCACCAAACUGGAAGCUGUUUUUGCAGCCUGAGGAAGCAUCAAUAAAUAUUUGAGAAAUGAAUCCAGGA-3'- Poly-A tail - Coding region
DNA
DNA (Gene ID: 339390)
C-type lectin domain family 4 member G
strand -
UNQ431, LSECTIN
NCBI CDS gene sequence (882 bp)
5'-ATGGACACCACCAGGTACAGCAAGTGGGGCGGCAGCTCCGAGGAGGTCCCCGGAGGGCCCTGGGGACGCTGGGTGCACTGGAGCAGGAGACCCCTCTTCTTGGCCCTGGCTGTCCTGGTCACCACAGTCCTTTGGGCTGTGATTCTGAGTATCCTATTGTCCAAGGCCTCCACGGAGCGCGCGGCGCTGCTTGACGGCCACGACCTGCTGAGGACAAACGCCTCGAAGCAGACGGCGGCGCTGGGTGCCCTGAAGGAGGAGGTCGGAGACTGCCACAGCTGCTGCTCGGGGACGCAGGCGCAGCTGCAGACCACGCGCGCGGAGCTTGGGGAGGCGCAGGCGAAGCTGATGGAGCAGGAGAGCGCCCTGCGGGAACTGCGTGAGCGCGTGACCCAGGGCTTGGCTGAAGCCGGCAGGGGCCGTGAGGACGTCCGCACTGAGCTGTTCCGGGCGCTGGAGGCCGTGAGGCTCCAGAACAACTCCTGCGAGCCGTGCCCCACGTCGTGGCTGTCCTTCGAGGGCTCCTGCTACTTTTTCTCTGTGCCAAAGACGACGTGGGCGGCGGCGCAGGATCACTGCGCAGATGCCAGCGCGCACCTGGTGATCGTTGGGGGCCTGGATGAGCAGGGCTTCCTCACTCGGAACACGCGTGGCCGTGGTTACTGGCTGGGCCTGAGGGCTGTGCGCCATCTGGGCAAGGTTCAGGGCTACCAGTGGGTGGACGGAGTCTCTCTCAGCTTCAGCCACTGGAACCAGGGAGAGCCCAATGACGCTTGGGGGCGCGAGAACTGTGTCATGATGCTGCACACGGGGCTGTGGAACGACGCACCGTGTGACAGCGAGAAGGACGGCTGGATCTGTGAGAAAAGGCACAACTGCTGA-3'
By using this site you agree to our privacy policy.
Please confirm you agree with the privacy policy before using the site.
How to cite
