NCBI Summary
This is one of three closely related paralogous genes on chromosome 16 encoding secreted proteins containing C-type lectin domains. These domains bind to carbohydrates in the presence of calcium, and may be involved in cell adhesion, immune response and apoptosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2012].
Protein
Protein (NP_872425)
C-type lectin domain family 18 member A
C-type lectin domain family 18 member A (Mannose receptor-like protein 2)
CLEC18A
C-type lectin domain family 18 member A
Undefined
Low evidence
C-type lectin
Undefined
C-type - Others
a/b mixed / C-type lectin-like
Fucoidan and fungal polysaccharides
Undefined
0.314
Protein sequence and protein families (fasta) (446 amino acids) Download
MLHPETSPGRGHLLAVLLALLGTAWAEVWPPQLQEQAPMAGALNRKESFLLLSLHNRLRSWVQPPAADMRRLDWSDSLAQLAQARAALCGTPTPSLASGLWRTLQVGWNMQLLPAGLVSFVEVVSLWFAEGQRYSHAAGECARNATCTHYTQLVWATSSQLGCGRHLCSAGQAAIEAFVCAYSPRGNWEVNGKTIVPYKKGAWCSLCTASVSGCFKAWDHAGGLCEVPRNPCRMSCQNHGRLNISTCHCHCPPGYTGRYCQVRCSLQCVHGRFREEECSCVCDIGYGGAQCATKVHFPFHTCDLRIDGDCFMVSSEADTYYRARMKCQRKGGVLAQIKSQKVQDILAFYLGRLETTNEVIDSDFETRNFWIGLTYKTAKDSFRWATGEHQAFTSFAFGQPDNHGFGNCVELQASAAFNWNDQRCKTRNRYICQFAQEHISRWGPGS
No structure currently available in the PDB RCSB Databank.
Structural models
Model Confidence:
  •    Very high (pLDDT > 90)
  •    Confident (90 > pLDDT > 70)
  •    Low (70 > pLDDT > 50)
  •    Very low (pLDDT < 50)

  AlphaFold produces a per-residue confidence score (pLDDT) between 0 and 100. Some regions with low pLDDT may be unstructured in isolation.


SWISS-MODEL structural models
Modeller structural model (Homology modelling pipeline), Error: [1.57, 2.03] ÅDownload
The location of the lectin domain structural model is: 306-441
We infer [1.57, 2.03] Å as the interval of error of this structural model.
Template 1: 7L67 chain: A, P22897, NP_002429.1, sequence identity: 27.2%, coverage: 85.3%, location in sequence: 659-779, (641-761 in PDB).
Template 2: 3L9J chain: C, P05452, NP_003269.2, sequence identity: 25.7%, coverage: 89.7%, location in sequence: 67-201, (46-180 in PDB).
Template 3: 2OX9 chain: A, Q8K4Q8, NP_569716.2, sequence identity: 24.3%, coverage: 87.5%, location in sequence: 606-735, (606-735 in PDB).
Show the alignment used for the construction of the structural model, Download.
Show the plot of DOPE energy score, Download.
Ligand
Glycan ligands from structural data
No crystal structures of complexes with glycan ligand.
References
NCBI References (6 PubMed Identifiers)
  • Endosomal TLR3 co-receptor CLEC18A enhances host immune response to viral infection. [33603190]
  • A reference map of the human binary protein interactome. [32296183]
  • Association of C-type lectin 18 levels with extrahepatic manifestations in chronic HCV infection. [30470801]
  • The human C-type lectin 18 is a potential biomarker in patients with chronic hepatitis B virus infection. [30055605]
  • Human CLEC18 Gene Cluster Contains C-type Lectins with Differential Glycan-binding Specificity. [26170455]
  • The C-type lectin-like domain superfamily. [16336259]
UniProt Main References (3 PubMed Identifiers)
  • Complete sequencing and characterization of 21,243 full-length human cDNAs. [14702039]
  • The sequence and analysis of duplication-rich human chromosome 16. [15616553]
  • The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). [15489334]
All isoforms of this gene containing a lectin domain
NP_001129686.1, NP_001258126.1, NP_001357452.1, NP_872425.2, XP_016878696.1, XP_016878697.1, XP_016878695.1
RNA
RNA (Transcript ID: NM_182619.5)
C-type lectin domain family 18 member A, transcript variant 1
m7G-5')ppp(5'-GCCCAGUUCCUGCUCACCAGAAGGACCAUAGCCGAGGUCCUCCUCCCAGGGCCCGGGGCUGGGGAGCGGAAGCCAUCAGUGGGCUCGGAGGACACUGUCCCAGCCAGGACACGGCCAUCGGUCACUAAUCUGCAGCACUGGAAUGUCCGCGGGCCAAUCAGCGGGCCCAGCCUGACUCCUGGAGAUUGUGAAUAGCUCCAUCCAGCCUGAGAAACAAGCCGGGUGGCUGAGCCAGGCUGUGCACGGAGCGCCUGACGGGCCCAACAGACCCAUGCUGCAUCCAGAGACCUCCCCUGGCCGGGGGCAUCUCCUGGCUGUGCUCCUGGCCCUCCUUGGCACCGCCUGGGCAGAGGUGUGGCCACCCCAGCUGCAGGAGCAGGCUCCGAUGGCCGGAGCCCUGAACAGGAAGGAGAGUUUCUUGCUCCUCUCCCUGCACAACCGCCUGCGCAGCUGGGUCCAGCCCCCUGCGGCUGACAUGCGGAGGCUGGACUGGAGUGACAGCCUGGCCCAGCUGGCUCAAGCCAGGGCAGCCCUCUGUGGAACCCCAACCCCGAGCCUGGCGUCCGGCCUGUGGCGCACCCUGCAAGUGGGCUGGAACAUGCAGCUGCUACCCGCGGGCUUGGUGUCCUUUGUCGAAGUGGUCAGCCUAUGGUUUGCAGAGGGGCAGCGGUACAGCCACGCGGCAGGAGAGUGUGCUCGCAACGCCACCUGCACCCACUACACGCAGCUCGUGUGGGCCACCUCAAGCCAGCUGGGCUGUGGGCGGCACCUGUGCUCUGCAGGCCAGGCAGCGAUAGAAGCCUUUGUCUGUGCCUACUCCCCCAGAGGCAACUGGGAGGUCAACGGGAAGACAAUCGUCCCCUAUAAGAAGGGUGCCUGGUGUUCGCUCUGCACAGCCAGUGUCUCAGGCUGCUUCAAAGCCUGGGACCAUGCAGGGGGGCUCUGUGAGGUCCCCAGGAAUCCUUGUCGCAUGAGCUGCCAGAACCAUGGACGUCUCAACAUCAGCACCUGCCACUGCCACUGUCCCCCUGGCUACACGGGCAGAUACUGCCAAGUGAGGUGCAGCCUGCAGUGUGUGCACGGCCGGUUCCGGGAGGAGGAGUGCUCGUGCGUCUGUGACAUCGGCUACGGGGGAGCCCAGUGUGCCACCAAGGUGCAUUUUCCCUUCCACACCUGUGACCUGAGGAUCGACGGAGACUGCUUCAUGGUGUCUUCAGAGGCAGACACCUAUUACAGAGCCAGGAUGAAAUGUCAGAGGAAAGGCGGGGUGCUGGCCCAGAUCAAGAGCCAGAAAGUGCAGGACAUCCUCGCCUUCUAUCUGGGCCGCCUGGAGACCACCAACGAGGUGAUUGACAGUGACUUCGAGACCAGGAACUUCUGGAUCGGGCUCACCUACAAGACCGCCAAGGACUCCUUCCGCUGGGCCACAGGGGAGCACCAGGCCUUCACCAGUUUUGCCUUUGGGCAGCCUGACAACCACGGGUUUGGCAACUGCGUGGAGCUGCAGGCUUCAGCUGCCUUCAACUGGAACGACCAGCGCUGCAAAACCCGAAACCGUUACAUCUGCCAGUUUGCCCAGGAGCACAUCUCCCGGUGGGGCCCAGGGUCCUGAGGCCUGACCACAUGGCUCCCUCGCCUGCCCUGGGAGCACCGGCUCUGCUUACCUGUCUGCCCACCUGUCUGGAACAAGGGCCAGGUUAAGAUCACAUGCCUCAUGUCCAAAGAGGUCUCAGACCUUGCACAAUGCCAGAAGUUGGGCAGAGAGAGGCAGGGAGGCCAGUGAGGGCCAGGGAGUGAGUGUUAGAAGAAGCUGGGGCCCUUCGCCUGCUUUUGAUUGGGAAGAUGGGCUUCAAUUAGAUGGCGAAGGAGAGGACACCGCCAGUGGUCCAAAAAGGCUGCUCUCUUCCACCUGGCCCAGACCCUGUGGGGCAGCGGAGCUUCCCUGUGGCAUGAACCCCACAGGGUAUUAAAUUAUGAAUCAGCUGAA-3'- Poly-A tail
  • Coding region
;
DNA
DNA (Gene ID: 348174)
C-type lectin domain family 18 member A
strand +
NCBI CDS gene sequence (1341 bp)
5'-ATGCTGCATCCAGAGACCTCCCCTGGCCGGGGGCATCTCCTGGCTGTGCTCCTGGCCCTCCTTGGCACCGCCTGGGCAGAGGTGTGGCCACCCCAGCTGCAGGAGCAGGCTCCGATGGCCGGAGCCCTGAACAGGAAGGAGAGTTTCTTGCTCCTCTCCCTGCACAACCGCCTGCGCAGCTGGGTCCAGCCCCCTGCGGCTGACATGCGGAGGCTGGACTGGAGTGACAGCCTGGCCCAGCTGGCTCAAGCCAGGGCAGCCCTCTGTGGAACCCCAACCCCGAGCCTGGCGTCCGGCCTGTGGCGCACCCTGCAAGTGGGCTGGAACATGCAGCTGCTACCCGCGGGCTTGGTGTCCTTTGTCGAAGTGGTCAGCCTATGGTTTGCAGAGGGGCAGCGGTACAGCCACGCGGCAGGAGAGTGTGCTCGCAACGCCACCTGCACCCACTACACGCAGCTCGTGTGGGCCACCTCAAGCCAGCTGGGCTGTGGGCGGCACCTGTGCTCTGCAGGCCAGGCAGCGATAGAAGCCTTTGTCTGTGCCTACTCCCCCAGAGGCAACTGGGAGGTCAACGGGAAGACAATCGTCCCCTATAAGAAGGGTGCCTGGTGTTCGCTCTGCACAGCCAGTGTCTCAGGCTGCTTCAAAGCCTGGGACCATGCAGGGGGGCTCTGTGAGGTCCCCAGGAATCCTTGTCGCATGAGCTGCCAGAACCATGGACGTCTCAACATCAGCACCTGCCACTGCCACTGTCCCCCTGGCTACACGGGCAGATACTGCCAAGTGAGGTGCAGCCTGCAGTGTGTGCACGGCCGGTTCCGGGAGGAGGAGTGCTCGTGCGTCTGTGACATCGGCTACGGGGGAGCCCAGTGTGCCACCAAGGTGCATTTTCCCTTCCACACCTGTGACCTGAGGATCGACGGAGACTGCTTCATGGTGTCTTCAGAGGCAGACACCTATTACAGAGCCAGGATGAAATGTCAGAGGAAAGGCGGGGTGCTGGCCCAGATCAAGAGCCAGAAAGTGCAGGACATCCTCGCCTTCTATCTGGGCCGCCTGGAGACCACCAACGAGGTGATTGACAGTGACTTCGAGACCAGGAACTTCTGGATCGGGCTCACCTACAAGACCGCCAAGGACTCCTTCCGCTGGGCCACAGGGGAGCACCAGGCCTTCACCAGTTTTGCCTTTGGGCAGCCTGACAACCACGGGTTTGGCAACTGCGTGGAGCTGCAGGCTTCAGCTGCCTTCAACTGGAACGACCAGCGCTGCAAAACCCGAAACCGTTACATCTGCCAGTTTGCCCAGGAGCACATCTCCCGGTGGGGCCCAGGGTCCTGA-3'
NCBI CDS gene sequence with introns (location: 69951367.. 69963611) (12245 bp)Download
NCBI CDS gene sequence with introns, 5'UTR and 3'UTR (location: 69950875.. 69963986) (13112 bp)Download
NCBI gene sequence (location: [69950875 - 1000].. 69963986) (14112 bp)Download
Cite How to cite